Use of osmt1a gene as a target in regulating rice fertility and seed setting rate

By knocking out or overexpressing the OsMT1a gene, combined with gene editing and chromosome doubling technology, the problem of low fertility in autotetraploid rice was solved, and rice fertility and seed setting rate were significantly improved.

CN122146773AActive Publication Date: 2026-06-05SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2026-05-07
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Homotetraploid rice has low and unstable fertility, and its breeding cycle is long and costly. Existing technologies are not effective in improving its fertility and seed setting rate.

Method used

By using the OsMT1a gene as a target, rice fertility and seed setting rate can be regulated by knocking out or overexpressing the OsMT1a gene, combined with gene editing and chromosome doubling technology.

Benefits of technology

It significantly improved pollen fertility and seed setting rate in tetraploid rice, created a new male-sterile rice line, and provided an effective way to improve the fertility of homotetraploid rice using the OsMT1a gene.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146773A_ABST
    Figure CN122146773A_ABST
Patent Text Reader

Abstract

The application discloses use of an OsMT1a gene as a target point in regulation of rice fertility and seed setting rate, and belongs to the technical field of molecular breeding. Through transgenic technology, the application obtains a male sterile rice strain by overexpressing OsMT1a, and through gene editing OsMT1a and PPi chromosome doubling technology, a new homologous tetraploid rice strain with obviously improved pollen fertility and seed setting rate is created, thereby providing an effective approach for application of the OsMT1a gene in improvement of fertility of the homologous tetraploid rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically the use of the OsMT1a gene as a target in regulating rice fertility and seed setting rate. Background Technology

[0002] Currently, research on polyploid rice breeding has made some progress. Compared with diploid rice, autotetraploid rice has the characteristics of strong stress resistance, high biological yield, and obvious heterosis.

[0003] However, the low and unstable fertility of autotetraploid rice hinders the progress of polyploid rice breeding research. Furthermore, the time required for complete homozygosity of the four homologous chromosomes is much longer than that for diploid rice, limiting this fertility improvement strategy to its long breeding cycle and high cost. Therefore, it is necessary to develop more direct methods for improving the sterility of autotetraploid rice.

[0004] The OsMT1a gene encodes a metallothionein that can scavenge reactive oxygen species in stress responses and enhance the abiotic tolerance of rice. However, there are currently no research reports on the role of this gene in fertility regulation and fertility improvement of tetraploid rice. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the OsMT1a gene as a target in regulating rice fertility and seed setting rate, so as to solve the problems mentioned in the background art.

[0006] To solve the above-mentioned technical problems, the present invention is achieved through the following technical solution:

[0007] The purpose of this invention is to provide the use of the OsMT1a gene as a target in regulating rice fertility and seed setting rate.

[0008] Furthermore, knocking out the OsMT1a gene improves rice seed setting rate and pollen fertility.

[0009] Furthermore, male-sterile rice lines were obtained by overexpressing the OsMT1a gene.

[0010] Furthermore, the rice is a tetraploid rice.

[0011] Another object of the present invention is to provide the use of OsMT1a gene knockout or inhibitor in improving seed setting rate and pollen fertility in tetraploid rice.

[0012] Furthermore, the OsMT1a gene knockout or inhibitor is one of the following: nucleic acid molecule, small molecule compound, polypeptide, protein, gene editing vector, lentivirus or adeno-associated virus.

[0013] Furthermore, the OsMT1a gene knockout or inhibitor is a CRISPR / Cas9 vector that targets and knocks out the OsMT1a gene, and its target sequence is shown in SEQ ID NO.11.

[0014] Another objective of this invention is to provide a reagent for improving the seed setting rate and pollen fertility of tetraploid rice, comprising the aforementioned OsMT1a gene knockout or inhibitor.

[0015] Another object of the present invention is to provide the use of reagents that overexpress the OsMT1a gene in the breeding of transgenic tetraploid rice lines with male sterility.

[0016] Another objective of this invention is to provide the use of a reagent for regulating the expression level of the OsMT1a gene in the germplasm improvement of tetraploid rice.

[0017] The present invention has the following beneficial effects:

[0018] This invention obtains male-sterile rice lines by overexpressing OsMT1a through transgenic technology, and creates new tetraploid rice lines with significantly improved pollen fertility and seed setting rate by gene editing of OsMT1a and PPi chromosome doubling technology, providing an effective approach for the application of the OsMT1a gene in improving the fertility of tetraploid rice. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The graph shows the expression level of OsMT1a in the anthers of polyploid rice. Among them, A is the result of the analysis of OsMT1a gene expression pattern in the RiceXPro database; B is a comparison of OsMT1a expression levels in the anther transcriptome during meiosis of HJX74 and HJX74-4x; C is a graph showing the expression level of OsMT1a gene in the anthers of T65 / T65-4x and 02428 / 02428-4x during the S8b-S10 stage detected by qRT-PCR.

[0021] Figure 2Figure 1 shows the effect of OsMT1a gene overexpression on rice fertility. Figure 2 shows the transgenic vector used for pE-MT1a, where proEAT1-2102 represents the first 2102 bp of the rice EAT1 gene sequence in the ATG region. Figure 3 shows the rice grains of pE-MT1a and E231. Figure 4 shows the growth of pE-MT1a and E231. Figure 5 shows the pollen of pE-MT1a and E231. Figure 6 shows the seed setting rate and pollen fertility of pE-MT1a. Figure 7 shows pE-MT1a-1, pE-MT1a-3, and pE-MT1a-18, which are three independent pE-MT1a transgenic lines.

[0022] Figure 3 The diagram shows the effect of knocking out the OsMT1a gene on the seed setting rate and pollen fertility of autotetraploid rice. A represents the sequence information of WT and mt1a-1 at the gene editing target site; B represents the percentage of T1 generation plants without T-DNA and tetraploid plants when WT and mt1a-1 are doubled using PPi technology; C represents the flow cytometry analysis of tetraploid WT-4x and mt1a-4x; D represents the seed setting rate and pollen fertility of WT-4x and mt1a-4x; and F represents the I2 / KI stained pollen of WT-4x and mt1a-4x. Detailed Implementation

[0023] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] Example 1: Expression level of OsMT1a in anthers of polyploid rice

[0025] By comparing the transcriptional levels of the OsMT1a gene in the anthers of diploid and autotetraploid rice, it was found that polyploidization leads to the upregulation of OsMT1a expression in rice anthers. The specific process is as follows:

[0026] (1) Spatiotemporal expression characteristics of OsMT1a gene in diploid rice

[0027] The spatiotemporal expression characteristics of the OsMT1a gene in diploid rice were analyzed using the rice gene expression database RiceXPro (Sato et al., 2010, Neclei Acids Research, https: / / doi.org / 10.1093 / nar / gkq1085).

[0028] The results are as follows Figure 1As shown in Figure A, OsMT1a is highly expressed in multiple vegetative tissues such as roots, leaves, leaf sheaths, and stems, but its expression level is extremely low or absent in reproductive tissues such as anthers.

[0029] (2) Transcriptome analysis of diploid rice and autotetraploid rice

[0030] Transcriptome analysis was performed on anther samples from diploid rice HJX74 and its corresponding tetraploid rice HJX74-4x at the S8 stage (data processing procedure can be found in the literature: Lu et al., 2024, Frontiers in Plant Science, https: / / doi.org / 10.3389 / fpls.2024.1421207) to compare gene expression between the two groups of samples.

[0031] The results are as follows Figure 1 As shown in Figure B, the expression level of the OsMT1a gene in the anthers of HJX74-4x at the S8 stage (FPKM = 25.28) was significantly higher than that of HJX74 (FPKM = 10.57).

[0032] (3) qRT-PCR analysis of diploid and autotetraploid anthers of Taichung 65

[0033] Anther samples from diploid Taizhong 65 (T65) and its corresponding homotetraploid T65-4x at stages S8, S9, and S10 were collected. Using cDNA as a template, qRT-PCR was employed to detect the expression of OsMT1a in various tissues and developmental stages. The specific primers used for the OsMT1a gene were as follows:

[0034] MT1a-trF: 5'-ccctgacctggaagagaagagc-3' (SEQ ID No. 1);

[0035] MT1a-trR: 5'-atgatagatggtagatgcaggcag-3' (SEQ ID No. 2);

[0036] The qRT-PCR amplification system was amplified using a two-step PCR method. The PCR reaction program was: 95℃ denaturation for 10 s, 60℃ extension for 20 s, for 40 cycles.

[0037] Figure 1 The results showed that the expression level of OsMT1a in the anthers of the autotetraploid T65-4x at the S8b, S9, and S10 stages was significantly higher than that in the diploid rice T65.

[0038] (4) qRT-PCR analysis of diploid and autotetraploid 02428 anthers. Anther samples from diploid 02428 and its corresponding autotetraploid 02428-4x at stages S8, S9, and S10 were taken. Using cDNA as a template, qRT-PCR experiments were performed with MT1a-trF and MT1a-trR primers to detect the gene expression of OsMT1a in each tissue and at each developmental stage.

[0039] Figure 1 The results showed that the expression level of OsMT1a in the anthers of the autotetraploid 02428-4x at the S8b, S9, and S10 stages was significantly higher than that in the diploid rice 02428.

[0040] Example 2: Effects of OsMT1a overexpression on rice fertility

[0041] To test the effect of OsMT1a gene overexpression in the anther on male gamete development in rice, a transgenic material specifically overexpressing OsMT1a in the rice tapetum was constructed, and its male sterility phenotype was verified. The specific process is as follows:

[0042] (1) Construct the recombinant overexpression vector (named proEAT1::MT1a vector)

[0043] Sequences SEQ ID No. 3 and SEQ ID No. 4 were amplified using a high-fidelity PCR reaction system and merged into a single sequence via overlap PCR. The resulting product was then recombined into the pCAMBIA1300 vector via double enzyme digestion-ligation or homologous recombination. Key components of the transgenic vector used are described below. Figure 2 a.

[0044] The 2200 bp promoter upstream of EAT1, a key gene for programmed cell death in rice tapetum (proEAT1), has been shown to drive reporter gene expression specifically in anthers, with expression peaking at S9 stage (Ono et al., 2018, PLoS Genetics, https: / / doi.org / 10.1371 / journal.pgen.1007238).

[0045] proEAT1 promoter sequence (SEQ ID No. 3):

[0046]

[0047] CDS sequence of the OsMT1a gene (SEQ ID No. 4):

[0048] 5'-ATGTCTTGCAGCTGTGGATCTAGCTGCAGCTGCGGCTCAAACTGCTCCTGCGGAAAGAAGTACCCTGACCTGGAAGAGAAGAGCAGCAGCACCAAGGCCACCGTCGTGCTGGGTGTGGCGCCGGAGAAGAAGGCGCAGCAGTTTGAGGCGGCCGCAGAGTCCGGCGAGACCGCCCATGGCTGCAGCTGCGGTTCCAGCTGCAGGTGCAACCCTTGCAACTGCTAA-3'.

[0049] One specific method for constructing the proEAT1::MT1a vector is as follows:

[0050] a. PCR1: SEQ ID No. 3 was amplified using rice leaf DNA as a template. The amplification primers used were:

[0051] proEAT1-BF: 5'- cctagcactgttttgccaaaATGTCTTGCAGCTGTGGATC -3' (SEQ IDNo. ​​5);

[0052] proEAT1-LR: 5'- GATCCACAGCTGCAAGACATtttggcaaaacagtgctagg -3' (SEQ IDNo. ​​6);

[0053] The PCR1 reaction system was as follows: 5 μL 10× Buffer + 0.2 μL dNTPs (200 mM) + 0.2 U high-fidelity Taq enzyme + 0.4 μL proEAT1-BF (10 mM) + 0.4 μL proEAT1-LR (10 mM) + 0.2 μL DNA + 3.6 μL water.

[0054] The PCR1 reaction program was as follows: denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 2 min, for 34 cycles.

[0055] b. PCR2: SEQ ID No. 4 was amplified using rice reproductive tissue cDNA as a template. The amplification primers used were as follows:

[0056] OsMT1a-pF: 5'-cctagcactgttttgccaaaATGTCTTGCAGCTGTGGATC-3' (SEQ IDNo. ​​7);

[0057] OsMT1a-HR: 5'-taaaacgacggccagtgccaagcttTTAGCAGTTGCAAGGGTTGC ACCTGCAG-3' (SEQ ID No. 8);

[0058] The PCR2 reaction system was as follows: 5 μL 10× Buffer + 0.2 μL dNTPs (200 mM) + 0.2 U high-fidelity Taq enzyme + 0.4 μL proEAT1-F (10 mM) + 0.4 μL proEAT1-R (10 mM) + 0.2 μL DNA + 3.6 μL water.

[0059] The PCR2 reaction program was as follows: 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 20 s, 8 cycles; or 95℃ denaturation for 15 s, 68℃ annealing and extension for a total of 20 s, 22 cycles.

[0060] c. PCR3: SEQ ID No. 3 + SEQ ID No. 4 was obtained by splicing the products of PCR1 and PCR2.

[0061] The PCR3 reaction system was as follows: 5 μL 10× Buffer + 0.2 μL dNTPs (200 mM) + 0.2 U high-fidelity Taq enzyme + 0.5 μL PCR1 product + 0.5 μL PCR2 product + 2.8 μL water.

[0062] The PCR3 reaction program was as follows: denaturation at 95℃ for 15 seconds, annealing and extension at 68℃ for 2 minutes, for 10 cycles.

[0063] d. PCR4: Add 0.4 μL each of primers proEAT1-BF and OsMT1a-HR to the PCR3 product and continue the reaction.

[0064] The PCR4 reaction program was as follows: denaturation at 95℃ for 15 s, annealing and extension at 68℃ for 2.5 min, for 30 cycles.

[0065] e. Homologous recombination was performed between the PCR4 product and the double digestion product (BamHⅠ+HindⅢ) of the pCAMBIA1300 plasmid (50℃, 20 min) to obtain the recombinant vector proEAT1::MT1a.

[0066] (2) 10 ng of proEAT1::MT1a plasmid was added to competent EHA105 Agrobacterium (purchased directly). Transformation was completed after 5 min each of ice bath-liquid nitrogen-37℃-ice bath. Positive clones were screened on YEP plates containing 50 μg / mL kanamycin and 20 μg / mL rifampin. Then, callus tissue (obtained from seed embryo induction dedifferentiation) of rice cultivars such as Taichung 65 was infected with Agrobacterium carrying the proEAT1::MT1a vector, and transgenic seedlings were obtained by tissue culture. T-DNA was detected using specific markers (Htp-F+Htp-R) to identify positive transgenic plants. OsMT1a overexpression transgenic lines pE-MT1a-1, pE-MT1a-3, and pE-MT1a-18 were obtained.

[0067] The primer sequences for Htp-F+Htp-R are:

[0068] Htp-F: 5'-ATTTGTGTACGCCCGACAGT-3' (SEQ ID No. 9);

[0069] Htp-R: 5'-GTGCTTGACATTGGGGAGTT-3' (SEQ ID No. 10);

[0070] The PCR reaction system was: 5 μL 2× PCR Mix + 0.2 μL Htp-F (10 mM) + 0.2 μL Htp-R (10 mM) + 0.2 μL gDNA (transgenic plant) + 3.6 μL water.

[0071] The PCR reaction program was as follows: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 30 s, for 36 cycles.

[0072] Figure 2 Figures b and c show the rice grains and growth of the transgenic plants, while according to... Figure 2 The results of the tests showed that the seed setting rates of pE-MT1a-1, pE-MT1a-3, and pE-MT1a-18 were significantly reduced. Compared to the wild type's 87.63%, the seed setting rates of pE-MT1a-1, pE-MT1a-3, and pE-MT1a-18 were only 17.21%, 4.59%, and 4.52%, respectively, with an average decrease of 78.86%. The fertility of mature pollen was observed using the I2 / KI staining method. Figure 2The mature pollen fertility of pE-MT1a-1, pE-MT1a-3, and pE-MT1a-18 (d and e) was 1.02%, 0.36%, and 0.65%, respectively, a decrease of approximately 93.78% compared to the wild-type mature pollen fertility. Among these, pE-MT1a-3 and pE-MT1a-18 exhibited a higher frequency of pollen absence. These results indicate that altering the expression pattern of OsMT1a in the anthers, specifically overexpressing OsMT1a around the S9 stage, significantly reduces pollen fertility and seed setting rate. Therefore, this invention utilizes transgenic technology to alter the OsMT1a expression pattern, achieving the artificial creation of a male-sterile phenotype in rice.

[0073] Example 3: Homotetraploid Rice Fertility Improved Based on Gene Editing OsMT1a

[0074] To test the feasibility of gene editing OsMT1a to improve the fertility of autotetraploid rice, an OsMT1a mutant autotetraploid, Taichung 65, was created, which showed higher seed setting rate and pollen fertility than the wild type. The specific process is as follows:

[0075] (1) Creating mt1a mutants using CRISPR / Cas9

[0076] a. Vector construction: The "5'-tgcggctcaaactgctcctg-3' (SEQ ID No. 11)" sequence in the OsMT1a gene was used as the target ( Figure 3 The CRISPR / Cas9 vector Cas-MT1a was constructed by referring to the literature (Ma et al., 2015, Molecular Plant, https: / / doi.org / 10.1016 / j.molp.2015.04.007).

[0077] b. Add 10 ng of Cas-MT1a plasmid to competent EHA105 Agrobacterium (purchased directly), and complete the transformation by incubating on ice, liquid nitrogen, 37℃, and ice for 5 min each. Positive clones are screened on YEP plates containing 50 μg / mL kanamycin and 20 μg / mL rifampin. Then, Agrobacterium carrying the Cas-MT1a vector is used to infect callus tissue (obtained from seed embryo-induced dedifferentiation) of rice varieties (such as Taichung 65). Transgenic seedlings are obtained through tissue culture, and positive transgenic plants are identified by detecting T-DNA using specific markers (Htp-F + Htp-R).

[0078] The PCR reaction system was: 5 μL 2× PCR Mix + 0.2 μL Htp-F (10 mM) + 0.2 μL Htp-R (10 mM) + 0.2 μL gDNA (transgenic plant) + 3.6 μL water.

[0079] The PCR reaction program was as follows: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 30 s, for 36 cycles.

[0080] c. Obtain mt1a plants with the target sequence mutation of SEQ ID No. 11. The OsMT1a target sequence was amplified using leaf DNA from T0 generation positive transgenic plants as a template. The amplification primers were:

[0081] MT1a-TF: 5'-gccaccaagtagtagaagttgtagc-3' (SEQ ID No. 12);

[0082] MT1a-TR: 5'-caaactgctgcgccttcttc-3' (SEQ ID No. 13);

[0083] The PCR reaction system was: 15 μL 2× PCR Mix + 0.6 μL MT1a-TF (10 mM) + 0.6 μL MT1a-TR (10 mM) + 0.2 μL gDNA (transgenic plant) + 13.6 μL water.

[0084] The PCR reaction program was as follows: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, for 30 cycles.

[0085] The PCR products were Sanger sequenced and compared with the OsMT1a sequence. The mutant strain mt1a-1 with a mutation in the OsMT1a target sequence was screened and a C base was inserted at 47 bp in the first exon.

[0086] d. Using leaf DNA from T1 generation mt1a-1 plants as templates, PCR amplification was performed to identify mt1a-1 plants without T-DNA. The amplification primers were Htp-F+Htp-R, and the PCR system and reaction procedure were the same as in step b.

[0087] (2) This invention utilizes PPi technology (which has been disclosed in the invention patent application with application number 202310741224.7) to double mt1a-1 and its wild-type T65 to obtain the autotetraploid mt1a-4x and WT-4x. The specific operation is as follows:

[0088] a. Add 10 ng of PPi plasmid to competent EHA105 Agrobacterium (purchased directly), and complete the transformation by incubating on ice, liquid nitrogen, 37℃, and ice for 5 min each. Positive clones are screened on YEP plates containing 50 μg / mL kanamycin and 20 μg / mL rifampin. Then, Agrobacterium carrying the PPi vector is used to infect mt1a-1 and T65 callus tissue (obtained from seed embryo-induced dedifferentiation), and transgenic seedlings are obtained through tissue culture. Positive transgenic plants are identified by detecting T-DNA using specific markers (Htp-F + Htp-R).

[0089] b. No further selection is required for the T0 generation of positive transgenic plants; they can simply be cultured to maturity and the seeds harvested. In this generation, the second meiotic division during gamete development is absent due to the PPi vector, resulting in rice seeds that are morphologically identical to diploid seeds, but with a homotetraploid embryo and a homohexaploid endosperm. Since most transgenic plants obtained from Agrobacterium infection are hemizygous (the transgenic fragment exists on only one homologous chromosome), segregation will occur in the T0 generation seeds; some seeds will contain the PPi vector transgenic fragment, while others will not (these seeds will not undergo chromosome doubling in their offspring).

[0090] c. After germinating the above seeds into T1 generation seedlings, DNA is extracted from the leaves during the seedling stage, and T-DNA is detected using specific markers (Htp-F + Htp-R). Plants without T-DNA are selected and planted in the field. The resulting plants without T-DNA and their offspring are plants with doubled chromosomes, i.e., autotetraploid rice. Compared with the diploid original species, autotetraploid rice exhibits the following typical trait changes, which can be used as a basis for preliminary ploidy identification: ① reduced tiller number; ② reduced number of grains per panicle; ③ larger grain size; ④ lower seed setting rate; ⑤ stronger stems.

[0091] d. Plumpness detection was further performed on the successfully doubled plants using flow cytometry. Figure 3 (Qi et al., 2023, Plant Communications, https: / / doi.org / 10.1016 / j.xplc.2022.100454), identified it as a homotetraploid rice mt1a-4x and WT-4x.

[0092] A survey was conducted on the seed set rate and pollen fertility of mt1a-4x, and the results are as follows: Figure 3 As shown in D, E, and F, compared to 6.11% for wild-type WT-4x, the seed setting rate of mt1a-4x increased to 28.63%, an increase of 22.52%. The fertility of mature pollen of mt1a-4x was 58.72%, significantly higher than that of wild-type WT-4x (21.40%).

[0093] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention.

Claims

1. The use of the OsMT1a gene as a target in regulating rice fertility and seed setting rate.

2. The use according to claim 1, characterized in that, Knocking out the OsMT1a gene improves rice seed setting rate and pollen fertility.

3. The use according to claim 1, characterized in that, Male-sterile rice lines were obtained by overexpressing the OsMT1a gene.

4. The use according to any one of claims 1 to 3, characterized in that, The rice is a tetraploid rice.

5. The use of OsMT1a gene knockout or inhibitor in improving seed setting rate and pollen fertility in tetraploid rice.

6. The use according to claim 5, characterized in that, OsMT1a gene knockout or inhibitor is one of the following: nucleic acid molecule, small molecule compound, polypeptide, protein, gene editing vector, lentivirus or adeno-associated virus.

7. The use according to claim 6, characterized in that, OsMT1a gene knockout or inhibitor is a CRISPR / Cas9 vector that targets and knocks out the OsMT1a gene, and its target sequence is shown in SEQ ID NO.

11.

8. A reagent for improving the seed setting rate and pollen fertility of tetraploid rice, characterized in that, Includes the OsMT1a gene knockout or inhibitor as described in claim 5.

9. The use of reagents that overexpress the OsMT1a gene in the breeding of transgenic tetraploid rice lines for male sterility.

10. The use of reagents that regulate the expression of the OsMT1a gene in the germplasm improvement of tetraploid rice.