A SNP molecular marker associated with intramuscular fat content trait of pigs and application thereof

By detecting the SNP molecular marker at 55,097,258 bp on chromosome 4 of the pig genome and using the KASP primer set, the problem of detecting intramuscular fat content in live pigs was solved, enabling early and precise selection of live pork quality and improving the efficiency and speed of pork quality improvement.

CN122146896APending Publication Date: 2026-06-05ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610550053.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-24
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Current technology cannot accurately detect intramuscular fat content in pigs in a live animal state, which makes it difficult to select and breed pork of high quality.

Method used

Using the SNP molecular marker located at 55,097,258 bp on chromosome 4 in the 11.1 version of the pig genome reference sequence, a KASP primer set was designed for genotyping. By performing early genotyping screening on live newborn piglets, individuals with high intramuscular fat content were selected.

Benefits of technology

It enables accurate, efficient, and low-cost genotyping of live piglets without slaughter, significantly accelerating the process of pig genetic improvement and enhancing the precision and efficiency of pork quality breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146896A_ABST
    Figure CN122146896A_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker associated with a pig intramuscular fat content character, the SNP molecular marker is located at 55,097,258 bp of a No. 4 chromosome in a 11.1 version reference sequence of a pig genome, and there are three genotypes of GG, AG and AA, wherein the intramuscular fat content of the AA genotype is higher than that of the AG genotype, and the intramuscular fat content of the AG genotype is higher than that of the GG genotype. The application also discloses application of the SNP molecular marker in pig intramuscular fat content character molecular marker assisted selection. The application further discloses a KASP primer group for detecting the SNP molecular marker and application of the KASP primer group in pig intramuscular fat content character molecular marker assisted selection. The KASP primer group can be used for accurately, efficiently and low-costly early screening of a genotype of a newborn live piglet, and a piglet with high intramuscular fat content and genetic stability can be selected, so that the process of pig genetic improvement can be accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pig molecular breeding technology, specifically to an SNP molecular marker associated with the intramuscular fat content trait in pigs and its application. Background Technology

[0002] my country is a major country in pig farming and breed development. With consumption upgrading, the market's requirements for pork quality are increasing. Intramuscular fat content is one of the important indicators for measuring pork quality. Pork with high intramuscular fat content is tender and juicy with better flavor, while pork with low intramuscular fat content is dry, lacks juiciness, and has a relatively bland flavor. Therefore, intramuscular fat content is usually one of the important indicators for pig breed selection. However, currently, intramuscular fat content can only be determined after pig slaughter, and it cannot be measured in vivo, which makes direct selection of this trait difficult. Utilizing the correlation between genes and traits, and using molecular marker-assisted selection technology, is one of the important methods to solve this problem.

[0003] Patent CN 118562971 A discloses a SNP molecular marker associated with intramuscular fat content in Duroc, Landrace, and Large White pigs, located at 98,424,251 on chromosome 4. Individuals with the AA genotype have an intramuscular fat content approximately 0.3 percentage points higher than those with the GG genotype (Figure 3). Patent CN 120249497 A discloses a molecular marker associated with both color and intramuscular fat content in Selenium-rich black pork, located at 7,314,350 on chromosome 1. Individuals with the GG genotype have a significantly higher muscle color value (L1) than those with the AG and AA genotypes, a significantly higher muscle color value (L24) than those with the AA genotype, and significantly lower intramuscular fat content than those with the AA genotype. Patent CN 119331990 A discloses a SNP molecular marker associated with both backfat thickness and intramuscular fat content in pigs. This marker is located in the interleukin-15 gene at positions 85,740,980 on chromosome 8, and is also a G / A mutation. Individuals with the GG and GA genotypes have significantly higher intramuscular fat content than those with the AA genotype. Patent CN 121022831 A discloses a miRNA molecule, SSC-miRNA-874, that regulates intramuscular fat deposition in pigs. This miRNA negatively regulates the proliferation and adipogenic differentiation of preadipocytes in pig muscle, providing an effective strategy for increasing intramuscular fat content in pigs. Patent CN 119592704 A discloses a molecular marker associated with intramuscular fat content and meat color traits in Beijing Black pigs, located in the FM03 gene at chromosome 9, position 63,757,964. Beijing Black pigs exhibit a 2279 bp gene insertion variation at this locus. Homozygous individuals without the insertion (WW) have significantly higher intramuscular fat content than homozygous individuals with the insertion (AA) or heterozygous individuals (AW). However, the mechanism of intramuscular fat formation is complex, with different genetic regulatory sites under different genetic backgrounds. These genetic sites are of great significance for improving pork quality. Summary of the Invention

[0004] The purpose of this invention is to provide an SNP molecular marker associated with intramuscular fat content in pigs and its application, in order to overcome the shortcomings of the prior art.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides a SNP molecular marker associated with the intramuscular fat content trait in pigs, wherein the SNP molecular marker is located at 55,097,258 bp on chromosome 4 in the pig genome version 11.1 reference sequence.

[0007] Furthermore, there is a G / A polymorphism at 55,097,258 bp on chromosome 4 of pigs, with three genotypes: GG, AG, and AA. Among them, the intramuscular fat content of the AA genotype is higher than that of the AG genotype, and the intramuscular fat content of the AG genotype is higher than that of the GG genotype.

[0008] Furthermore, the pigs in question are offspring of Duroc pigs and Jinwu pigs.

[0009] The second aspect of this invention provides the application of the above-mentioned SNP molecular markers in marker-assisted breeding of the intramuscular fat content trait in pigs.

[0010] A third aspect of the present invention provides a KASP primer set for detecting the above-mentioned SNP molecular markers, the KASP primer set comprising primers as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0011] The fourth aspect of this invention provides the application of the above-mentioned KASP primer set in marker-assisted breeding of the trait of intramuscular fat content in pigs.

[0012] The beneficial effects of this invention are:

[0013] This invention uses a porcine SNP chip to perform genome-wide association analysis on the offspring of Duroc pigs and Jinwu pigs, and screens out one major genetic locus associated with intramuscular fat content. Then, a KASP primer set is designed for this locus to re-validate the genotype of this locus, and the association between this locus and intramuscular fat content is repeatedly validated, thereby determining the genetic effect of this locus.

[0014] Using the KASP primer set of this invention, early genotypic screening of newborn piglets can be performed accurately, efficiently, and at low cost without slaughter, selecting individuals with high and genetically stable intramuscular fat content (the intramuscular fat content of the AA genotype is higher than that of the AG genotype, and the intramuscular fat content of the AG genotype is higher than that of the GG genotype). This allows for the retention of individuals with superior genotypes and the culling of those with inferior genotypes, thereby accelerating the process of pig genetic improvement. This invention provides a reliable molecular marker for pork quality improvement and has significant scientific and application value. Attached Figure Description

[0015] Figure 1KASP labeling was used to determine the genotype of DNA samples from 418 pigs. The horizontal axis, FAM, represents the relative intensity of the amplification signal from primer F1 labeled with FAM fluorophore. The vertical axis, HEX, represents the relative intensity of the amplification signal from primer F2 labeled with HEX fluorophore. Blue dots represent individuals with the AA genotype, red dots represent individuals with the GG genotype, brown dots represent individuals with the AG genotype, and gray dots represent individuals whose amplification failed (DNA was re-extracted from these individuals for testing).

[0016] Figure 2 The values ​​represent the mean intramuscular fat content of pigs of different genotypes and the least squares mean after adjusting for the effect of carcass weight. **** indicates that the difference between groups is highly significant (P<0.0001). Detailed Implementation

[0017] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and embodiments of the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0018] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this invention are of analytical grade or higher.

[0019] 1. Test materials

[0020] The experimental subjects were an early generation population of 418 pigs (randomized males and females) resulting from crossbreeding between Duroc and Jinhua pigs. The entire experimental group was fed and managed under standardized conditions by professionals at the Anji Anxing Livestock Co., Ltd. pig breeding base. All experimental pigs were in good health.

[0021] 2. Experimental Procedure

[0022] 2.1 DNA Extraction

[0023] After birth, healthy piglets were selected and ear-tagged. Ear tissue samples were collected from each piglet while still alive. The ear tissue samples were placed in 75% (v / v) alcohol, flash-frozen in liquid nitrogen, and then stored at -20°C for later use. EasyPure technology from Beijing TransGen Biotechnology Co., Ltd. was used. ® The Genomic DNA Kit (catalog number: EE101) was used to extract whole-genome DNA from each sample. Specific procedures were followed according to the kit's instructions. DNA concentration and purity were determined using a Nano Drop UV-Vis spectrophotometer. 260 / OD 280Samples with a ratio below 1.6 should be re-extracted. After adjusting the DNA concentration to 50 ng / μL with ddH2O, store at -20°C for later use.

[0024] 2.2 Design of KASP primers

[0025] A primer combination was designed to detect the nucleotide diversity at position G / A on chromosome 4 at 55,097,258 bp in the porcine genome version 11.1 reference sequence (obtained through genome-wide association analysis of Duroc and Jinwu pig crossbred offspring using a porcine SNP microarray). The primer sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. The upstream primers are SEQ ID NO.1 (primer name F1) and SEQ ID NO.2 (primer name F2), with the last bases being G and A, respectively, corresponding to the diverse nucleotide base site. Bases 1-21 of SEQ ID NO.1 form the adapter (underlined portion) for fluorescent probe recognition; bases 1-21 of SEQ ID NO.2 also form the adapter (underlined portion) for recognition by another fluorescent probe. SEQ ID NO.3 is the downstream primer for this site (primer name R), which is compatible with both genotypes. Details are as follows:

[0026] SEQ ID NO.1: 5'- GAAGGTGACCAAGTTCATGCT CTGGTAGCCACCCTCATCG -3' (F1)

[0027] SEQ ID NO.2: 5'- GAAGGTCGGAGTCAACGGATT CTGGTAGCCACCCTCATCA -3' (F2)

[0028] SEQ ID NO.3: 5'-TAGGGAGTATGCCATAACCC-3' (R)

[0029] After the primers were designed, they were synthesized by Beijing Qingke Biotechnology Co., Ltd. The synthesized primers were then prepared into a 10 µM solution using ddH2O.

[0030] 2.3 Preparation of 10×KASP Primer Mix

[0031] To prepare 10×KASP Primer Mix, first mix the components according to the proportions in Table 1, then denature at 95°C for 5 min, and then quickly cool it in an ice-water mixture for later use.

[0032] Table 1 Composition of 10×KASP Primer Mix

[0033] 2.4 PCR reaction system

[0034] Place the PCR plate on ice, and add each component to the corresponding well of the PCR plate in the order shown in Table 2. The total reaction volume is set to 5 µL. After adding each component, place the PCR plate in a PCR plate centrifuge and centrifuge at 1500 rpm for 30 seconds.

[0035] Table 2 PCR reaction system

[0036] The 2×KASP Master Mix was purchased from LGC, UK, catalog number KBS-1050-102. It includes TAQ enzyme, dNTPs, and probes. The probe that binds to upstream primer F1 is labeled with FAM fluorescent dye, and the probe that binds to upstream primer F2 is labeled with HEX fluorescent dye.

[0037] 2.5 Reaction Conditions

[0038] PCR reactions were performed in an IntelliQube instrument in SNP genotyping inline mode. The thermal cycling conditions were as follows: pre-denaturation at 94°C for 15 min, 1 cycle; denaturation at 94°C for 20 sec, annealing and extension at 61°C–55°C for 60 sec, 10 cycles, with the annealing and extension temperatures decreasing by 0.6°C per cycle; and denaturation at 94°C for 20 sec, annealing and extension at 55°C for 60 sec, 28 cycles.

[0039] 2.6 Genotyping

[0040] After the reaction, KlusterCaller software was used to read the fluorescence signal of each sample and determine the genotype. Samples with only FAM fluorescence signal were identified as the GG genotype, those with only HEX fluorescence signal were identified as the AA genotype, and those with both FAM and HEX fluorescence signals were identified as the AG genotype. Figure 1 ).

[0041] 2.7 Determination of intramuscular fat content in pigs

[0042] After 230 days of standardized feeding following weaning, 418 pigs that had been tagged with ear tags and had ear tissue samples taken were slaughtered. The longissimus dorsi muscle between the third and fourth ribs from the bottom was taken to determine the intramuscular fat content. The determination method was carried out in accordance with NY / T 821-2019 "Technical Specification for Determination of Pork Quality".

[0043] 2.8 Statistical Analysis

[0044] Data analysis was performed using SAS 8.1 software. The association analysis between genotype and intramuscular fat was conducted using a mixed linear model Y = μ + G + S + D + e, where Y represents intramuscular fat content, μ represents the population mean, G represents the genotype effect, S represents the sex effect, D represents the carcass weight effect as a covariate, and e represents the residual.

[0045] 3. Test Results

[0046] Genotypic analysis was performed on 418 pigs using the KASP marker. Among them, 93 pigs were of the AA genotype, 203 were of the AG genotype, and 122 were of the GG genotype. The average intramuscular fat content of the longissimus dorsi muscle in AA genotype individuals was 5.12 ± 1.08%, and the average carcass weight was 95.63 ± 6.15 kg. The average intramuscular fat content of the longissimus dorsi muscle in AG genotype individuals was 4.27 ± 1.08%, and the average carcass weight was 91.87 ± 7.15 kg. The average intramuscular fat content of the longissimus dorsi muscle in GG genotype individuals was 3.42 ± 0.96%, and the average carcass weight was 88.07 ± 6.82 kg. The specific results are shown in Table 3.

[0047] Covariance analysis using a mixed linear model showed that genotype had a highly significant effect on intramuscular fat content (P<0.0001), explaining 25.30% of the phenotypic variance at this locus (Table 4). The AA genotype contributed 1.313 ± 0.147 percentage points more to intramuscular fat content than the GG genotype, and the AG genotype contributed 0.652 ± 0.117 percentage points more (Table 5). Carcass weight also had a highly significant effect on intramuscular fat content (P<0.0001), contributing 8.30% of the phenotypic variance (Table 4). For every 1 kg increase in carcass weight, intramuscular fat content increased by approximately 0.051 ± 0.007 percentage points (Table 5). There was no significant correlation between sex and intramuscular fat content (P=0.6878) (Table 4). After adjusting for the effect of carcass weight on intramuscular fat content, the least squares mean intramuscular fat content for the AA genotype was 4.91 ± 0.11%, for the AG genotype it was 4.25 ± 0.07%, and for the GG genotype it was 3.42 ± 0.09%, with highly significant differences among the groups (P < 0.0001). Figure 2 This indicates that the genetic effect of this locus is extremely significant, making it suitable for molecular marker-assisted early selection of intramuscular fat content traits. Without slaughtering, individuals with high intramuscular fat content can be screened simply by collecting ear tissue samples from newborn piglets and detecting their genotypes, thus achieving early and precise breeding of this trait.

[0048] Table 3. Genotypic and phenotypic statistics of Duroc and Jinhua pig crossbred offspring

[0049] Table 4. Analysis of Covariance of Intramuscular Fat Content

[0050] Table 5. Estimated values ​​of parameters from the analysis of covariance of intramuscular fat content.

[0051] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with intramuscular fat content in pigs, characterized in that, The SNP molecular marker is located at position 55,097,258 bp on chromosome 4 in the pig genome version 11.1 reference sequence.

2. The SNP molecular marker associated with intramuscular fat content in pigs according to claim 1, characterized in that, The pig chromosome 4 has a G / A polymorphism at position 55,097,258 bp, with three genotypes: GG, AG, and AA. The intramuscular fat content of the AA genotype is higher than that of the AG genotype, and the intramuscular fat content of the AG genotype is higher than that of the GG genotype.

3. A SNP molecular marker associated with intramuscular fat content in pigs according to claim 1 or 2, characterized in that, The pigs in question are offspring of Duroc and Jinwu pigs.

4. The application of the SNP molecular marker according to any one of claims 1-3 in marker-assisted breeding of intramuscular fat content in pigs.

5. A KASP primer set for detecting the SNP molecular marker according to any one of claims 1-3, characterized in that, The KASP primer set includes primers as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

6. The application of the KASP primer set as described in claim 5 in marker-assisted breeding of intramuscular fat content in pigs.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to low backfat thickness and high intramuscular fat content of pig on IL-15 (Interleukin-15) gene and application of SNP molecular marker

    CN119331990A

  • Molecular marker related to intramuscular fat content and meat color character of pig and application of molecular marker

    CN119592704A

  • Molecular marker associated with pork color and intramuscular fat content and application

    CN120249497A

  • MiRNA (micro Ribonucleic Acid) molecule for regulating and controlling fat deposition in pig muscle as well as product and application of miRNA molecule

    CN121022831A