A kasp marker, primer and application thereof related to a high oleic acid trait of safflower germplasm

By using genome-wide association analysis and KASP marker technology, the problems of long screening cycles and low efficiency of existing markers in safflower breeding have been solved, achieving efficient, accurate, and low-cost early screening, which is suitable for safflower germplasm resource identification and breeding.

CN122146933APending Publication Date: 2026-06-05IND CROPS RES INST YUNNAN ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610639704.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-11
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Traditional safflower breeding involves long screening cycles, high costs, and the inability to screen for high oleic acid traits in the early stages. Existing molecular markers, such as SSR markers, have poor specificity, low detection efficiency, and narrow applicability, which cannot meet the needs of large-scale breeding.

Method used

Core SNP sites closely linked to the high oleic acid trait in safflower seeds were identified through genome-wide association analysis. Specific KASP markers and primers were designed, and an efficient detection method was established to achieve early and accurate screening.

Benefits of technology

It shortens the breeding cycle by more than 60%, has high detection accuracy and specificity, low cost, and wide applicability. It is suitable for non-destructive testing during the seedling stage and its applicability covers major planting areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146933A_ABST
    Figure CN122146933A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular markers, and specifically discloses a KASP marker related to a high-oleic acid character of safflower germplasm, a primer and application thereof, the KASP marker is referenced to a genome version Saf_v1, corresponds to a 5' end SnpHOA_62569356 site on a 10th chromosome of safflower, nucleotide polymorphism of the site is A / G, and the A allele gene is a high-oleic acid dominant allele gene. The breeding cycle is greatly shortened by adopting the technical scheme of the application, early-stage screening of seedlings is realized, a single-round screening cycle is shortened from 6 months to 10-15 days, a multi-generation breeding cycle is shortened from 3-5 years to 1-2 years, the breeding efficiency is increased by more than 60%, and the detection accuracy and specificity are high: the KASP marker is associated with the high-oleic acid character at a degree of 99.2%, and the detection coincidence rate is 98.3%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a KASP marker, primers, and their applications related to the high oleic acid trait of safflower germplasm. Background Technology

[0002] safflower( Carthamus tinctorius Safflower (L.) is an annual herbaceous plant belonging to the genus Safflower in the family Asteraceae. Its seeds are rich in oil (20%-40% oil content), making it an important specialty oilseed crop in my country. The fatty acid composition of safflower seed oil is the core factor determining its market value. Oleic acid (C18:1), as a monounsaturated fatty acid, has advantages such as strong antioxidant capacity, resistance to high temperatures and non-rancidity, and help regulate human blood lipid metabolism. It has broad application prospects in high-end edible oils, health foods, pharmaceuticals, and industrial fields. The economic value of high-oleic safflower seed oil (oleic acid content ≥75%) is far higher than that of ordinary safflower seed oil (oleic acid content 10%-20%). Therefore, cultivating high-oleic safflower varieties has become the core goal of safflower breeding.

[0003] Traditional breeding of high-oleic safflower relies on phenotypic screening, requiring oleic acid content detection after seed harvest when plants are mature. Early stages such as seedling and flowering periods cannot determine plant traits. Stable high-oleic safflower varieties are eventually bred through multiple generations of self-pollination, purification, and field identification. However, traditional methods suffer from long cycles, high costs, and the inability to perform early screening. Molecular marker technology offers a solution to these problems. Among these, KASP markers have become the preferred technology for crop molecular breeding due to their high specificity, rapid detection, low cost, and high-throughput application. However, there is a severe shortage of highly efficient molecular markers closely linked to the high-oleic trait in safflower breeding. Existing markers are mostly SSR markers, which suffer from low polymorphism, cumbersome detection procedures, and insufficient accuracy. The few reported fatty acid-related markers have not been widely validated in germplasm resources, have narrow applicability, and cannot meet the needs of large-scale breeding. Therefore, developing highly efficient KASP markers and supporting technologies closely linked to the high-oleic trait in safflower is of great significance for promoting the breeding process of high-oleic safflower and improving breeding efficiency. Summary of the Invention

[0004] This invention aims to provide a KASP marker, primers, and their applications related to the high oleic acid trait in safflower seeds, in order to solve the problems of long cycle, high cost, and inability to perform early non-destructive screening in traditional breeding screening methods, as well as the problems of poor specificity, low detection efficiency, and narrow applicability of existing molecular marker methods (such as SSR markers).

[0005] This invention identifies core SNP loci closely linked to the high oleic acid trait in safflower seeds through genome-wide association analysis, designs specific KASP primers, and establishes an efficient detection method to achieve early and accurate screening of high-oleic acid safflower. The specific technical solution provided by this invention is as follows: In one embodiment, the present invention provides a KASP marker associated with the high oleic acid trait in safflower germplasm. The KASP marker references genome version Saf_v1 and corresponds to the SnpHOA_62569356 locus on safflower chromosome 10 starting from the 5' end. The nucleotide polymorphism of this locus is A / G, and the A allele is the high oleic acid dominant allele.

[0006] In another embodiment, the present invention provides a primer combination for detecting the KASP marker, the nucleotide sequences of the primer combination being shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0007] In another embodiment, the present invention provides a kit for detecting the KASP marker, the kit comprising primers and probes, the primer nucleotide sequences being shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0008] Preferably, in the kit, the primers of sequence as described in SEQ ID NO.1 have a FAM fluorescent probe attached to their 5' end; the primers of sequence as described in SEQ ID NO.2 have a HEX fluorescent probe attached to their 5' end. In other embodiments, the primers can be modified or replaced: the fluorescent linker of the upstream primer can be replaced with other commonly used fluorescent groups such as ROX or TAMRA, and 1-2 degenerate bases (such as Y=C / T) can be added to the 3' end of the downstream primer without affecting specificity and detection effect, and adapting to different models of fluorescence detectors.

[0009] In another embodiment, the present invention provides the application of the KASP marker, the primer combination, or the kit in the identification of safflower germplasm resources, molecular marker-assisted breeding of high-oleic safflower, or purity detection of high-oleic safflower varieties. In some embodiments, it can also be combined with KASP markers for traits such as disease resistance and high yield in safflower to construct a multi-trait joint screening system, achieving simultaneous screening of target traits such as high oleic acid, disease resistance, and high yield, thus meeting the needs of comprehensive trait breeding.

[0010] In another embodiment, the present invention provides a KASP detection method for safflower germplasm with a high oleic acid trait, comprising the following steps: extracting genomic DNA from safflower samples; using the aforementioned kit, determining the genotype of safflower plants through KASP-PCR amplification and fluorescence signal detection; and identifying the high oleic acid trait when the genotype at the SnpHOA_62569356 locus shows homozygous allele AA, with an oleic acid content ≥75%. Specifically, the detection system in the kit can be a 5μL micro-PCR system (2×KASP Master Mix 2.5μL, primer mixture 0.2μL, DNA 1μL, enzyme-free water 1.3μL), or the 10μL system described in the embodiments of the present invention, with the same detection effect as the 10μL system, further reducing detection costs.

[0011] Preferably, the safflower sample includes safflower seedling leaves, flowering petals, or seeds.

[0012] The beneficial effects of the technical solution of this invention are as follows: 1. Breeding cycle significantly shortened: Early screening at the seedling stage is achieved, the single-round screening cycle is shortened from 6 months to 10-15 days, the multi-generation breeding cycle is shortened from 3-5 years to 1-2 years, and the breeding efficiency is improved by more than 60%.

[0013] 2. High accuracy and specificity: The KASP marker is associated with the high oleic acid trait by 99.2%, and the detection accuracy rate is 98.3%.

[0014] 3. High efficiency and low cost: No electrophoresis or staining steps are required. A single detection takes only 2.5 hours and can achieve high-throughput detection of 96 wells / 384 wells. The cost per sample is about 1.5 yuan, which is 97% lower than the cost of gas chromatography detection.

[0015] 4. Non-destructive testing with wide applicability: Using seedling leaves as testing material, it does not damage the plant and does not require the consumption of seeds; verified by 450 germplasm samples with different genetic backgrounds, its applicability covers germplasm resources in major safflower growing areas in my country. Attached Figure Description

[0016] Figure 1 Comparison of average oleic acid content among three haplotypes in safflower sequencing populations; Figure 2 Manhattan plot and QQ plot for association analysis between SnpHOA_62569356 locus and oleic acid content in safflower; (A is Manhattan plot; B is QQ plot) Note: The horizontal axis represents the 12 chromosomes of safflower, the vertical axis is -log10(P), and the arrows indicate the significant association signal of SnpHOA_62569356 locus (P=3.2e-8).

[0017] Figure 3KASP genotyping plots of 230 sequencing materials (plus 4 blank controls), where A is a scatter plot of samples 1-96, B is a plate display plot of samples 1-96; C is a scatter plot of samples 97-192, D is a plate display plot of samples 97-192; E is a scatter plot of samples 193-230; F is a plate display plot of samples 193-230; Note: The horizontal axis of the scatter plot is the FAM fluorescence signal intensity, and the vertical axis is the HEX fluorescence signal intensity; red dots represent the AA genotype (high oleic acid), blue dots represent the GG genotype (normal oleic acid), green dots represent the AG genotype (heterozygous), and black dots represent the template-free control (NTC).

[0018] Figure 4 KASP typing diagram of 220 breeding materials. Detailed Implementation

[0019] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with embodiments, so as to fully understand the purpose, features and effects of this application. For the testing methods, purchased goods, unless otherwise specified, shall be used under conventional conditions or conditions recommended by the manufacturer. Unless otherwise defined herein, the scientific and technical terms used in connection with this invention shall have the meanings commonly understood by one of ordinary skill in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials described herein may also be used in the practice and testing of this disclosure.

[0020] Example 1 I. KASP Primer Design The reference genome version of the KASP marker for the high oleic acid trait in safflower germplasm is Saf_v1 (https: / / www.scuec.edu.cn / safflower / Download.htm), corresponding to the SnpHOA_62569356 locus on chromosome 10 of safflower, starting from the 5' end. Based on the 50bp sequences upstream and downstream of the SnpHOA_62569356 locus, a KASP-specific primer combination was designed, including two allele-specific upstream primers (each connected to a different fluorescent adapter) and one universal downstream primer, with the sequences as follows: 1. Upstream primer 1 (corresponding to the A allele): 5'-GAAGGTGACCAAGTTCATGCTGAGAACGGATTTTAACTGCCTTCG-3' (5' end ligated to FAM fluorescent adapter: GAAGGTGACCAAGTTCATGCT) 2. Upstream primer 2 (corresponding to the G allele): 5'-GAAGGTCGGAGTCAACGGATTGAGAACGGATTTTAACTGCCTTCA-3' (5' end connected to the HEX fluorescent adapter: GAAGGTCGGAGTCAACGGATT) 3. Downstream primer: 5'-GACCATGTTTGTATGTGATGGCAT-3' Key parameters for primer design: length 38-42bp, Tm value 58-60℃, the last base at the 3' end of the upstream primer is complementary to the polymorphic base at the SNP site to avoid primer dimerization and non-specific binding.

[0021] II. KASP Marker Detection Method 1. Sample preparation: Genomic DNA was extracted from leaves during the seedling stage, petals during the flowering stage, or seeds of safflower using the CTAB method or a commercial DNA extraction kit. The DNA concentration was adjusted to 10-50 ng / μL, and the OD260 / OD280 ratio was 1.8-2.0.

[0022] 2. PCR reaction system (10μL): 2×KASP Master Mix 5μL, upstream primer 1 (10μmol / L) 0.14μL, upstream primer 2 (10μmol / L) 0.14μL, downstream primer (10μmol / L) 0.28μL, genomic DNA 2μL, enzyme-free water 2.44μL.

[0023] 3. PCR reaction procedure: 94℃ pre-denaturation for 15 minutes; 94℃ denaturation for 20 seconds, 61-55℃ annealing and extension for 60 seconds (decreasing by 0.6℃ per cycle, for a total of 10 cycles); 94℃ denaturation for 20 seconds, 55℃ annealing and extension for 60 seconds (for a total of 26 cycles); 40℃ incubation for 5 minutes.

[0024] 4. Result Interpretation: Fluorescence signals were detected using a KASP fluorescence detector (such as LGC Genomics SNPline): only FAM fluorescence signal was detected, indicating a high oleic acid homozygous genotype (AA); only HEX fluorescence signal was detected, indicating a normal oleic acid homozygous genotype (GG); and simultaneous detection of two fluorescence signals indicated a heterozygous genotype (GA).

[0025] III. Screening and Validation of Core SNP Sites 1. Test materials: 230 safflower germplasm resources with different genetic backgrounds (including 5 high oleic acid varieties and 225 ordinary oleic acid varieties) were collected, planted in the experimental field, and the seeds were harvested after maturity. The oleic acid content was determined by gas chromatography to clarify the phenotypic data.

[0026] Table 1. Germplasm resources of 5 high-oleic safflower species

[0027] 2. SNP site screening ( Figure 1 , Figure 2 , Figure 3 Genomic DNA was extracted from all germplasm resources and subjected to 10× depth whole-genome resequencing; GWAS analysis was used to screen for those significantly associated with oleic acid content (P < 1 e). -6 The SNP locus of safflower was identified by linkage disequilibrium (LD) analysis as SnpHOA_62569356 on chromosome 10 as the core associated locus. The nucleotide variation type of this locus is A / G, where the AA allele is the dominant high oleic acid allele (plants carrying this allele have an oleic acid content ≥75%), and the GG allele is the normal oleic acid allele (plants carrying this allele have an oleic acid content <30%).

[0028] 3. Tag Validation ( Figure 4 ): 220 safflower materials from breeding populations (with unknown oleic acid content) were selected for genotyping and oleic acid content determination. The results showed that the average oleic acid content of the three haplotypes (G / G, G / A, and A / A) in the sequenced population showed a significant difference (P<0.01%). The A allele at the SnpHOA_62569356 locus was associated with the high oleic acid trait in 99.2%. The concordance rate between the genotyping results and the gas chromatography results was 98.3%, with no false positives.

[0029] Based on the molecular marker sites provided by this invention, applications can be made in multiple fields, such as: identification of high-oleic safflower germplasm resources: rapid screening of high-oleic materials in collected safflower germplasm resources, shortening the germplasm evaluation cycle; molecular marker-assisted breeding: screening of high-oleic plants at the seedling stage (3-4 leaf stage), eliminating ordinary oleic plants, and reducing field planting costs; used in hybridization breeding for parental screening and identification of F1 and F2 generation plants, accelerating the breeding process; purity detection of high-oleic safflower varieties: conducting field sampling tests on cultivated high-oleic varieties to verify variety purity and ensure variety quality.

[0030] The above detailed embodiments provide a specific description of the analytical methods involved in this invention. It should be noted that the above description is only intended to help those skilled in the art better understand the methods and ideas of this invention, and is not intended to limit the scope of the invention. Without departing from the principles of this invention, those skilled in the art can make appropriate adjustments or modifications to this invention, and such adjustments and modifications should also fall within the protection scope of this invention.

Claims

1. A KASP marker associated with the high oleic acid trait in safflower germplasm, characterized in that, The KASP marker reference genome version Saf_v1 corresponds to the SnpHOA_62569356 site on chromosome 10 of *Safflower*, starting from the 5' end. This site has a nucleotide polymorphism of A / G, with the A allele being the high oleic acid dominant allele.

2. A primer combination for detecting the KASP marker of claim 1, characterized in that, The primer combination nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

3. A kit for detecting the KASP label of claim 1, the kit comprising primers and probes, characterized in that, The primer nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

4. The reagent kit according to claim 3, characterized in that, The primer with the sequence as described in SEQ ID NO.1 has a 5' end connected to a FAM fluorescent probe; the primer with the sequence as described in SEQ ID NO.2 has a 5' end connected to a HEX fluorescent probe.

5. The application of the KASP marker of claim 1, the primer combination of claim 2, or the kit of claim 3 or 4 in the identification of safflower germplasm resources, molecular marker-assisted breeding of high oleic safflower, or the detection of purity of high oleic safflower varieties.

6. A KASP detection method for safflower germplasm with high oleic acid trait, characterized in that, Includes the following steps: Genomic DNA was extracted from safflower samples; Using the kit described in claim 3 or 4, the genotype of safflower plants is determined by KASP-PCR amplification and fluorescence signal detection. When the genotype at the SnpHOA_62569356 locus shows a homozygous allele AA, it is determined to be a high oleic acid trait.

7. The method according to claim 6, characterized in that, The safflower samples include safflower seedling leaves, flowering petals, or seeds.