A sustained-release eye drop and a preparation method thereof

Abstract

This invention relates to a sustained-release eye drop and its preparation method, belonging to the field of ophthalmic drug technology. The invention provides a self-assembled microparticle comprising an elastin-like peptide and sodium hyaluronate; the molar ratio of the elastin-like peptide to sodium hyaluronate is 5-7:1-2; the amino acid sequence of the elastin-like peptide is shown in SEQ ID NO.1. The self-assembled microparticles of this invention have a sustained-release effect and exhibit synergistic properties with hydroxypropyl methylcellulose. The eye drops prepared by combining these two components possess excellent sustained-release performance, adhesion, and stability, allowing for prolonged application to the eye, effectively solving the problem of short duration of action in existing eye drops.

Description

Technical Field

[0001] This invention relates to the field of ophthalmic drug technology, and in particular to a sustained-release eye drop and its preparation method. Background Technology

[0002] Wearing contact lenses often causes a series of uncomfortable symptoms in the eyes. Initially, these symptoms mainly include dry eyes, a foreign body sensation, and a rubbing sensation. The lenses can hinder the normal tear circulation and oxygen exchange on the ocular surface, while continuously rubbing against the cornea and conjunctiva, leading to problems such as dry and tight eyes, eye strain, and visual fatigue. With increased wearing time, corneal hypoxia and mucosal irritation can cause conjunctival congestion and redness. Some people may also experience itchy eyes, burning, photophobia, and tearing. Uneven moisture distribution on the lens surface or slight corneal edema may also cause temporary blurred vision or double vision. If worn for a long time or improperly cared for, these discomforts will significantly worsen, potentially leading to persistent dryness, increased stinging, and increased secretions. In severe cases, it can even cause damage to the ocular surface, and the symptoms are difficult to relieve quickly after stopping wearing.

[0003] Using eye drops to relieve eye symptoms after wearing contact lenses is a common method. However, the effective duration of eye drops is generally short, mostly lasting only 10-30 minutes. Even high-viscosity artificial tears only provide continuous hydration for less than an hour. Because the tear film on the ocular surface is rapidly renewed, and tear circulation and blinking constantly dilute and flush out the medication, coupled with the lack of long-lasting retention and sustained-release technology, most eye drops are lost with the tears or excreted through the nasolacrimal duct shortly after instillation. The actual time spent on the ocular surface to provide lubrication and hydration is very limited, making it difficult to achieve prolonged and continuous relief.

[0004] Based on this, the present invention is proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a sustained-release eye drop and its preparation method, so as to solve the problem of short effective action time of eye drops in the prior art.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a self-assembling microparticle, which comprises an elastin-like polypeptide and sodium hyaluronate; The molar ratio of the elastin-like polypeptide to sodium hyaluronate is 5~7:1~2; The amino acid sequence of the elastin-like polypeptide is shown in SEQ ID NO.1.

[0007] This invention provides a method for preparing the self-assembled microparticles, comprising the following steps: (1) Mix the elastin-like polypeptide with phosphate buffer to obtain solution 1; (2) Sodium hyaluronate was mixed with water to obtain solution 2; (3) Mix solution 1 and solution 2, stir for 15-25 min, incubate for 25-35 min, and dry to obtain self-assembled microparticles.

[0008] Preferably, the concentration of the elastin-like polypeptide in solution 1 in step (1) is 5~7 μmol / L; The concentration of sodium hyaluronate in solution 2 in step (2) is 1~2 μmol / L.

[0009] Preferably, the volume ratio of solution 1 to solution 2 in step (3) is 1~2:1~2; The stirring speed is 500~700 rpm; the incubation temperature is 34~36℃.

[0010] This invention provides the application of the self-assembled microparticles described herein or the self-assembled microparticles prepared by the aforementioned preparation method in the preparation of eye care products.

[0011] This invention provides a sustained-release eye drop, which comprises the following components in parts by weight: 2.5-4.5 parts of self-assembled microparticles, 1.5-3.5 parts of hydroxypropyl methylcellulose, 0.05-0.15 parts of corneal repair promoter, 0.005-0.015 parts of benzalkonium chloride, and 90-100 parts of water; The self-assembled microparticles are the self-assembled microparticles described above or the self-assembled microparticles prepared by the preparation method described above; The corneal repair promoter includes recombinant human epidermal growth factor and vitamin B12, with a mass ratio of 1:2 to 4.

[0012] Preferably, the sustained-release eye drops have a pH of 6.0 to 7.0 and an osmotic pressure of 280 to 320 mOsm / kg.

[0013] This invention provides a method for preparing the sustained-release eye drops, comprising the following steps: (1) Mix self-assembled microparticles, hydroxypropyl methylcellulose, corneal repair promoter, benzalkonium chloride and water and sonicate for 15-25 minutes to obtain a mixed solution; (2) Adjust the pH and osmotic pressure of the mixed solution and filter to obtain sustained-release eye drops.

[0014] Preferably, the power of the ultrasound in step (1) is 35~45KHz.

[0015] Preferably, the filtration method in step (2) is membrane filtration, and the pore size of the membrane is 0.12~0.32μm.

[0016] The present invention has the following technical effects and advantages: This invention designs an elastin-like polypeptide with a phase transition temperature of 35°C, which can form self-assembled microparticles with sodium hyaluronate, thus providing a sustained-release effect. Hydroxypropyl methylcellulose has viscoelasticity, and its aqueous solution has a certain viscosity, which can effectively prolong the residence time of the drug in the eye. Its combination with the self-assembled microparticles can further improve the sustained-release effect of sodium hyaluronate. The eye drops prepared by combining the two have good sustained-release performance, adhesion and stability, and can act on the eye for a long time, which effectively solves the problem of short duration of action of existing eye drops. Attached Figure Description

[0017] Figure 1 The results show the relative turbidity of elastin peptides at different temperatures. Detailed Implementation

[0018] This invention provides a self-assembling microparticle, which comprises an elastin-like polypeptide and sodium hyaluronate; The molar ratio of the elastin-like polypeptide to sodium hyaluronate is 5~7:1~2, preferably 6:1; The amino acid sequence of the elastin-like polypeptide is shown in SEQ ID NO.1; The amino acid sequence shown in SEQ ID NO. 1 is: VPGKGVPGVGVPGVGVPGVGVPGFGVPGVGVPGVGVPGFGVPGVGVPGKGVPGVGVPGFGVPGVGVPGVGVPGVGVPGFGVPGVGVPGVGVPGVGVPGKG.

[0019] This invention provides a method for preparing the self-assembled microparticles, comprising the following steps: (1) Mix the elastin-like polypeptide with phosphate buffer to obtain solution 1; (2) Sodium hyaluronate was mixed with water to obtain solution 2; (3) Mix solution 1 and solution 2, stir for 15-25 min, incubate for 25-35 min, and dry to obtain self-assembled microparticles; The method for mixing solution 1 and solution 2 is to add solution 2 dropwise into solution 1; The stirring time is preferably 20 minutes.

[0020] In this invention, the concentration of the elastin-like polypeptide in solution 1 in step (1) is 5~7 μmol / L, preferably 6 μmol / L; The concentration of sodium hyaluronate in solution 2 in step (2) is 1~2 μmol / L, preferably 1 μmol / L.

[0021] In this invention, the volume ratio of solution 1 to solution 2 in step (3) is 1~2:1~2, preferably 1:1; The stirring speed is 500~700 rpm, preferably 600 rpm; the incubation temperature is 34~36℃, preferably 35℃.

[0022] This invention provides the application of the self-assembled microparticles described herein or the self-assembled microparticles prepared by the aforementioned preparation method in the preparation of eye care products.

[0023] This invention provides a sustained-release eye drop, which comprises the following components in parts by weight: 2.5-4.5 parts of self-assembled microparticles, 1.5-3.5 parts of hydroxypropyl methylcellulose, 0.05-0.15 parts of corneal repair promoter, 0.005-0.015 parts of benzalkonium chloride, and 90-100 parts of water; The preferred mass fraction of the self-assembled microparticles is 3.5 parts; The preferred mass fraction of the hydroxypropyl methylcellulose is 2.5 parts; The preferred mass fraction of the corneal repair promoter is 0.1 parts; The preferred mass fraction of benzalkonium chloride is 0.01 parts; The preferred mass fraction of the water is 94 parts; The self-assembled microparticles are the self-assembled microparticles described above or the self-assembled microparticles prepared by the preparation method described above; The corneal repair promoter includes recombinant human epidermal growth factor and vitamin B12, with a mass ratio of recombinant human epidermal growth factor to vitamin B12 of 1:2 to 4, preferably 1:3.

[0024] In this invention, the pH value of the sustained-release eye drops is 6.0~7.0, preferably 6.5; the osmotic pressure is 280~320mOsm / kg, preferably 300mOsm / kg.

[0025] This invention provides a method for preparing the sustained-release eye drops, comprising the following steps: (1) Mix self-assembled microparticles, hydroxypropyl methylcellulose, corneal repair promoter, benzalkonium chloride and water and sonicate for 15-25 minutes to obtain a mixed solution; The preferred duration of the ultrasound is 20 minutes. (2) Adjust the pH and osmotic pressure of the mixed solution and filter to obtain sustained-release eye drops.

[0026] In this invention, the power of the ultrasound in step (1) is 35~45KHz, preferably 40KHz.

[0027] In this invention, the filtration method in step (2) is membrane filtration, and the pore size of the membrane is 0.12~0.32μm, preferably 0.22μm.

[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1

[0030] 1. Design of elastin-like peptides

[0031] Elastin-like polypeptides (ELPs) are a class of thermosensitive biopolymers synthesized using artificial genetic engineering techniques, based on structural motifs found in mammalian elastin. They were first designed and prepared by Urry's research group. Their structure is mainly composed of pentapeptide repeating sequence units (Val-Pro-Gly-Xaa-Gly, VPGXG), derived from the hydrophobic region of elastin, where Xaa represents any amino acid except Pro. With changes in ambient temperature, ELPs undergo a reversible phase transition: at a certain concentration, they are solutions at low temperatures; upon heating to a certain temperature, they form a condensed phase; and as the temperature decreases, they return to a solution state.

[0032] Based on the properties of elastin-like peptides, the inventors constructed an elastin-like peptide by replacing the X in VPGXG with valine (V), lysine (K), and phenylalanine (F), and then repeatedly constructed an elastin-like peptide ELP (K3V). 15F4-20), whose amino acid sequence is VPGKGVPGVGVPGVGVPGVGVPGFGVPGVGVPGVGVPGFGVPGVGVPGKGVPGVGVPGFGVPGVGVPGVGVPGVGVPGFGVPGVGVPGVGVPGVGVPGKG (SEQ ID NO.1), with the nucleotide sequence: GTTCCAGGTAAAGGTGTACCGGGTGTTGGCGTTCCAGGCGTTGGCGTGCCGGGTGTTGGTGTACCGGGTTTTGGTGTTCCGGGTGTCGGTGTACCGGGCGTTGGTGTTCCGGGTTTCGGTGTTCCGGGTGTTGGCGTGCCGGGCAAAGGCGTACCGGGTGTAGGCGTACCGGGCTTCGGCGTACCGGGTGTAGGTGTACCGGGTGTGGGTGTTCCGGGCGTTGGTGTGCCGGGCTTCGGCGTTCCGGGTGTTGGTGTGCCGGGCGTGTTGGTGTTGGTGTTCCGGGCGTGGGTGTACCTGGTAAAGGT (SEQ ID NO.2). Shanghai Taopu Biotechnology Co., Ltd. was commissioned to express the designed elastin-like peptide using genetic engineering expression methods, resulting in the elastin-like peptide ELP (K3V). 15 F4-20) powder.

[0033] 2. Determination of the phase transition temperature of elastin-like peptides

[0034] The phase transition temperature of the designed elastin-like polypeptide was determined according to the method in "Improved non-chromatographic purification of arecombinant protein by cationic elastin-like polypeptides" published in 2007. Specifically, the turbidity of PBS solution (containing ELPs, with a final concentration of 25 µmol / L) at a wavelength of 350 nm was measured at a temperature of 10–95 °C, with a heating rate of 1 °C / min.

[0035] This application describes a method for determining the turbidity of a PBS solution with a final concentration of 6 µmol / L at 20–40 °C at a wavelength of 350 nm (heating rate of 0.5 °C / min). The relative turbidity results of the elastin peptide at different temperatures are shown below. Figure 1 As shown in the figure, the horizontal axis represents temperature, and the vertical axis represents the relative turbidity at 350 nm.

[0036] The phase transition temperature is defined as the temperature at which half of the maximum relative turbidity at 350 nm is reached. According to... Figure 1 It is known that the elastin-like polypeptide ELP (K3V) 15 F4-20 exhibits an S-shaped turbidity distribution at temperatures ranging from 20 to 40°C, with the highest relative turbidity occurring at 40°C. Based on the definition of phase transition temperature, 35°C is considered the critical temperature for the elastin-like polypeptide ELP (K3V). 15 The phase transition temperature of F4-20.

[0037] In summary, the elastin-like polypeptide ELP (K3V) designed in this scheme... 15 F4-20 exhibits phase transition characteristics at a temperature of 35°C.

[0038] Example 2

[0039] 1. Preparation of self-assembled microparticles

[0040] Weigh out the elastin-like polypeptide ELP (K3V) designed in Example 1. 15 F4-20 powder was dissolved in phosphate buffer to obtain solution 1 with a concentration of 6 μmol / L; sodium hyaluronate was weighed and mixed with water to obtain solution 2 with a concentration of 1 μmol / L; solution 2 was added dropwise to solution 1 (the volume ratio of solution 2 to solution 1 was 1:1) and stirred at 600 rpm for 20 min, then incubated at 35℃ for 30 min, and dried to obtain self-assembled microparticles. The results of transmission electron microscopy showed that the average diameter of the self-assembled microparticles was about 1 μm.

[0041] 2. Determination of encapsulation efficiency of self-assembled microparticles with different molar ratios

[0042] Weigh out the elastin-like polypeptide ELP (K3V) designed in Example 1. 15 F4-20 powder was dissolved in phosphate buffer to obtain solutions 1 with concentrations of 2, 4, 6, 8, and 10 μmol / L. Sodium hyaluronate was weighed and mixed with water to obtain solution 2 with a concentration of 1 μmol / L. Solution 2 was added dropwise to solutions 1 of different concentrations (the volume ratio of solution 2 to solution 1 was 1:1), and stirred at 600 rpm for 20 min. Then, it was incubated at 35℃ for 30 min to obtain different self-assembled microparticle solutions. DTX was quantitatively analyzed by HPLC. The chromatographic conditions were: Kromasil C18 column (250 mm × 4.6 mm, 5 μm); mobile phase: acetonitrile-water (65:35); flow rate: 1.0 mL / min; detection wavelength: 230 nm; column temperature: 25℃; injection volume: 20 μL. The retention time of DTX was 5 min. The specific method is as follows: Take a certain amount of the self-assembled microparticle solution, and centrifuge it at the phase transition temperature (1.2 × 10⁻⁶).3 g) After 10 min, take the supernatant and determine the concentration of free DTX in the supernatant using the above HPLC conditions, and calculate the drug encapsulation efficiency (EE) according to the following formula.

[0043] EE (%) = (W Total -W Free ) / W Total ×100%; In the formula, W Total For the total dosage, W Free This represents the weight of the free drug in the supernatant.

[0044] The encapsulation efficiency of self-assembled microparticles with different molar ratios is shown in Table 1.

[0045] Table 1. Encapsulation efficiency of self-assembled microparticles with different molar ratios

[0046] As shown in Table 1, the encapsulation efficiency of self-assembled microparticles with different molar ratios is not the same. Among them, the encapsulation efficiency of elastin-like peptide ELP (K3V) is the highest. 15 The highest encapsulation efficiency is achieved when the molar ratio of F4-20 to sodium hyaluronate is 6:1.

[0047] 3. Determination of encapsulation efficiency of self-assembled microparticles at different temperatures

[0048] Weigh out the elastin-like polypeptide ELP (K3V) designed in Example 1. 15 F4-20 powder was dissolved in phosphate buffer to obtain solution 1 with a concentration of 6 μmol / L; sodium hyaluronate was weighed and mixed with water to obtain solution 2 with a concentration of 1 μmol / L; solution 2 was added dropwise to solution 1 (the volume ratio of solution 2 to solution 1 was 1:1) and stirred at 600 rpm for 20 min. Then, it was incubated at temperatures of 30, 35, 37 and 39 °C for 30 min to obtain different self-assembled microparticle solutions. The encapsulation efficiency was measured, and the encapsulation efficiency of the self-assembled microparticles at different temperatures is shown in Table 2.

[0049] Table 2. Encapsulation efficiency of self-assembled microparticles at different temperatures.

[0050] As shown in Table 2, the encapsulation efficiency of self-assembled microparticles varies at different temperatures, with the highest encapsulation efficiency obtained at a temperature of 35℃.

[0051] In summary, the optimal method for preparing self-assembled microparticles is as follows: Weigh out the elastin-like polypeptide ELP (K3V) designed in Example 1.15 F4-20 powder was dissolved in phosphate buffer to obtain solution 1 with a concentration of 6 μmol / L; sodium hyaluronate was weighed and mixed with water to obtain solution 2 with a concentration of 1 μmol / L; solution 2 was added dropwise to solution 1 (the volume ratio of solution 2 to solution 1 was 1:1) and stirred at 600 rpm for 20 min, and then incubated at 35℃ for 30 min to obtain a self-assembled microparticle solution, which was then dried to obtain self-assembled microparticles.

[0052] Example 3

[0053] A sustained-release eye drop, with the following formula: Example 2: 3.5g of self-assembled microparticles, 2.5g of hydroxypropyl methylcellulose, 0.1g of corneal repair promoter, 0.01g of benzalkonium chloride, and 94g of water were obtained by the optimal preparation method. The corneal repair promoter is composed of recombinant human epidermal growth factor and vitamin B12, with a mass ratio of 1:3.

[0054] The preparation method is as follows: (1) Mix self-assembled microparticles, hydroxypropyl methylcellulose, corneal repair promoter, benzalkonium chloride and water, and sonicate for 20 min at a power of 40 kHz to obtain a mixed solution; (2) Adjust the pH of the mixed solution to 6.5 and the osmotic pressure to 300 mOsm / kg. Use a filter membrane with a pore size of 0.22 μm to filter and sterilize to obtain sustained-release eye drops.

[0055] Comparative Example 1

[0056] Compared with Example 3, hydroxypropyl methylcellulose was excluded, but the remaining components and preparation method were the same, and eye drops were prepared.

[0057] Comparative Example 2

[0058] Compared with Example 3, sodium hyaluronate was directly used to replace the self-assembled microparticles, while the other components and preparation methods were the same, and eye drops were prepared.

[0059] Comparative Example 3

[0060] Compared with Example 3, the amount of hydroxypropyl methylcellulose used was 5g, and the other components and preparation methods were the same, resulting in the preparation of eye drops.

[0061] Test case

[0062] 1. Measurement Protocol

[0063] 1.1 Adhesion Test

[0064] Adhesion is a key factor affecting the retention time of eye drops on the ocular surface, and is directly related to the efficacy and duration of drug release.

[0065] Using a rabbit corneal model (New Zealand rabbits), the adhesiveness of different eye drops was determined by simulating the ocular environment. The rabbits were divided into four groups: Group 1 used the sustained-release eye drops prepared in Example 3; Group 2 used the eye drops prepared in Comparative Example 1; Group 3 used the eye drops prepared in Comparative Example 2; and Group 4 used the eye drops prepared in Comparative Example 3. The method involved instilling one drop of eye drop into the rabbit corneal model and measuring the adhesion duration of different groups of eye drops on the ocular surface to assess their retention.

[0066] 1.2 Sustained-release performance test

[0067] Sustained-release performance testing is a key indicator for evaluating whether eye drops can stably release drugs during long-term use.

[0068] Using PBS solution to simulate the ocular surface environment, the drug (sodium hyaluronate) release rate of different eye drops was determined in a constant temperature water bath at 37°C. The groups were divided into four groups: Group 1 used the sustained-release eye drops prepared in Example 3, Group 2 used the eye drops prepared in Comparative Example 1, Group 3 used the eye drops prepared in Comparative Example 2, and Group 4 used the eye drops prepared in Comparative Example 3. The drug release rate of the eye drops in different groups was measured after 24 hours.

[0069] 1.3 Stability determination

[0070] Stability is key to evaluating whether eye drops retain their original properties under long-term storage conditions.

[0071] The eye drops were stored at room temperature and 4°C, and their clarity was observed periodically. They were divided into four groups: Group 1 was the sustained-release eye drops prepared in Example 3, Group 2 was the eye drops prepared in Comparative Example 1, Group 3 was the eye drops prepared in Comparative Example 2, and Group 4 was the eye drops prepared in Comparative Example 3. The clarity of each group was measured after 60 days.

[0072] 2. Results and Analysis

[0073] The results of tests on the adhesion, sustained-release properties and stability of different eye drops are shown in Table 3.

[0074] Table 3. Results of tests on the adhesion, sustained-release properties, and stability of different eye drops.

[0075] As shown in Table 3, the eye drops in Example 3 are the best in terms of adhesion, sustained-release performance and stability. Compared with the eye drops in Comparative Examples 1 to 3, they have good stability, adhesion and sustained-release performance, indicating that the self-assembled microparticles have sustained-release performance. At the same time, the combination with hydroxypropyl methylcellulose can further improve the rate of sustained release of sodium hyaluronate, indicating that the two have a synergistic effect.

[0076] As can be seen from the above embodiments, the present invention provides a sustained-release eye drop and its preparation method. The present invention designs an elastin-like polypeptide with a phase transition temperature of 35°C, capable of forming self-assembled microparticles with sodium hyaluronate, thus exhibiting a sustained-release effect. Hydroxypropyl methylcellulose possesses viscoelasticity, and its aqueous solution has a certain viscosity, effectively prolonging the drug's residence time in the eye. Its combination with the self-assembled microparticles further enhances the sustained-release effect of sodium hyaluronate. The eye drop prepared by combining these two components exhibits excellent sustained-release performance, adhesion, and stability, allowing for prolonged application to the eye and effectively solving the problem of short-duration action in existing eye drops.

[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A self-assembling microparticle, characterized in that, The self-assembled microparticles include elastin-like peptides and sodium hyaluronate; The molar ratio of the elastin-like polypeptide to sodium hyaluronate is 5~7:1~2; The amino acid sequence of the elastin-like polypeptide is shown in SEQ ID NO.

1.

2. The method for preparing self-assembled microparticles according to claim 1, characterized in that, Includes the following steps: (1) Mix the elastin-like polypeptide with phosphate buffer to obtain solution 1; (2) Sodium hyaluronate was mixed with water to obtain solution 2; (3) Mix solution 1 and solution 2, stir for 15-25 min, incubate for 25-35 min, and dry to obtain self-assembled microparticles.

3. The preparation method according to claim 2, characterized in that, The concentration of the elastin-like polypeptide in solution 1 in step (1) is 5~7 μmol / L; The concentration of sodium hyaluronate in solution 2 in step (2) is 1~2 μmol / L.

4. The preparation method according to claim 2, characterized in that, In step (3), the volume ratio of solution 1 to solution 2 is 1~2:1~2; The stirring speed is 500~700 rpm; the incubation temperature is 34~36℃.

5. The application of the self-assembled microparticles according to claim 1 or the self-assembled microparticles prepared by the preparation method according to any one of claims 2 to 4 in the preparation of eye care products.

6. A sustained-release eye drop, characterized in that, The sustained-release eye drops comprise the following components in parts by weight: 2.5-4.5 parts of self-assembled microparticles, 1.5-3.5 parts of hydroxypropyl methylcellulose, 0.05-0.15 parts of corneal repair promoter, 0.005-0.015 parts of benzalkonium chloride, and 90-100 parts of water; The self-assembled microparticles are the self-assembled microparticles according to claim 1 or the self-assembled microparticles prepared by the preparation method according to any one of claims 2 to 4; The corneal repair promoter includes recombinant human epidermal growth factor and vitamin B12, with a mass ratio of 1:2 to 4.

7. The sustained-release eye drops according to claim 6, characterized in that, The sustained-release eye drops have a pH of 6.0 to 7.0 and an osmotic pressure of 280 to 320 mOsm / kg.

8. The method for preparing the sustained-release eye drops according to claim 6 or 7, characterized in that, Includes the following steps: (1) Mix self-assembled microparticles, hydroxypropyl methylcellulose, corneal repair promoter, benzalkonium chloride and water and sonicate for 15-25 minutes to obtain a mixed solution; (2) Adjust the pH and osmotic pressure of the mixed solution and filter to obtain sustained-release eye drops.

9. The preparation method according to claim 8, characterized in that, The power of the ultrasound in step (1) is 35~45KHz.

10. The preparation method according to claim 8, characterized in that, The filtration method described in step (2) is membrane filtration, and the pore size of the membrane is 0.12~0.32μm.

Images