Use of pitpa modulators in the preparation of a medicament for white matter remyelination
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE FIFTH AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV
- Filing Date
- 2026-03-23
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies have poor targeting and unstable effects in the treatment of white matter damage and remyelination disorders after ischemic stroke, and are difficult to effectively promote the maturation, differentiation and remyelination of oligodendrocyte precursor cells.
By delivering PITPα regulators, especially PITPα mRNA, to oligodendrocyte precursor cells and using lipid nanoparticles for targeted delivery, the expression level of PITPα was increased, promoting the maturation, differentiation, and remyelination of oligodendrocytes.
It significantly promoted the repair of white matter structure and the recovery of neurological function after ischemic brain injury, improved the efficiency of neurological function deficit repair, enhanced MBP signal and myelinated axon density, and improved learning and memory abilities.
Smart Images

Figure CN122163837A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of nerve injury repair, and in particular to the application of PITPα modulators in the preparation of drugs for white matter remyelination repair. Background Technology
[0002] Ischemic stroke is a significant type of disease leading to neurological dysfunction. Recent studies have shown that white matter damage and impaired remyelination are important reasons for limited long-term functional recovery after stroke. Oligodendrocyte progenitor cells (OPCs), as the main cellular source of remyelination, are considered to have impaired differentiation as a key factor affecting white matter repair. Existing research mainly focuses on strategies such as cell transplantation and growth factor stimulation, but these still suffer from poor targeting and unstable effects. Therefore, there is an urgent need for a new, highly targeted, and easily operable technique to promote white matter remyelination repair after ischemic brain injury. Summary of the Invention
[0003] The primary objective of this invention is to overcome the shortcomings and deficiencies of existing technologies and provide the application of PITPα regulators in the preparation of drugs for white matter remyelination repair and / or neurological function recovery. This invention aims to improve white matter structure and neurological outcomes after ischemic brain injury by increasing the expression level of phospholipid transfer protein alpha (PITPα) in oligodendrocyte precursor cells, thereby promoting oligodendrocyte maturation, differentiation, and remyelination.
[0004] Another object of the present invention is to provide the use of PITPα modulators in the preparation of medicaments for the treatment of ischemic brain injury.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] The application of PITPα regulators in the preparation of drugs for white matter remyelination repair and / or neurological function recovery, wherein the PITPα regulators are used to increase the expression level of PITPα in oligodendrocyte precursor cells (OPCs), thereby promoting oligodendrocyte maturation, differentiation and remyelination.
[0007] The use of PITPα modulators in the preparation of drugs for the treatment and / or improvement of ischemic brain injury.
[0008] Preferably, the ischemic brain injury includes ischemic stroke or ischemia-reperfusion brain injury.
[0009] Preferably, the PITPα regulator is PITPα mRNA or a pharmaceutical preparation containing PITPα mRNA.
[0010] Preferably, the nucleotide sequence of the PITPα mRNA is shown in SEQ ID NO.1.
[0011] Preferably, the pharmaceutical preparation comprises PITPα mRNA and a pharmaceutically acceptable carrier.
[0012] Preferably, the pharmaceutically acceptable carrier is a lipid nanoparticle, and PITPα mRNA is delivered in the form of lipid nanoparticles.
[0013] More preferably, the lipid nanoparticles are coated with targeting ligands for oligodendrocyte precursor cells, thereby achieving targeted delivery to oligodendrocyte precursor cells.
[0014] Preferably, the targeting ligand is an antibody or a functional fragment thereof targeting platelet-derived growth factor receptor PDGFRα (CD140a).
[0015] Preferably, the pharmaceutical formulation containing PITPα mRNA is at least one of lipid nanoparticles encapsulating PITPα mRNA and lipid nanoparticles containing PITPα mRNA with a targeting ligand for oligodendrocyte precursor cells attached to their surface.
[0016] Preferably, the lipid nanoparticles encapsulating PITPα mRNA are prepared by the following method:
[0017] (1) PITPα mRNA was dissolved in a buffer solution to form an aqueous phase; at the same time, ionizable cationic lipids, structural phospholipids, cholesterol and polyethylene glycol modified lipids were dissolved in an organic solvent to form a lipid phase;
[0018] (2) The aqueous phase and lipid phase are mixed by microfluidic mixing to form lipid nanoparticles (PITPα mRNA-LNP) loaded with PITPα mRNA.
[0019] Preferably, the buffer solution in step (1) is sodium acetate buffer; more preferably, it is a 25mM sodium acetate buffer solution with pH 4.0.
[0020] Preferably, the final concentration of PITPα mRNA in the aqueous phase in step (1) is 0.05–0.2 mg / mL; more preferably, it is 0.1 mg / mL.
[0021] Preferably, the ionizable cationic lipid described in step (1) is DLin-MC3-DMA (4-(N,N-dimethylamino)butyrate (dilinyl) methyl ester).
[0022] Preferably, the structural phospholipid in step (1) is DSPC (distearate phosphatidylcholine).
[0023] Preferably, the polyethylene glycol modified lipid in step (1) is DMG-PEG2000.
[0024] Preferably, the molar ratio of the ionizable cationic lipid, structural phospholipid, cholesterol and polyethylene glycol modified lipid in step (1) is 50:10:38.5:1.5.
[0025] Preferably, the total lipid concentration in the lipid phase described in step (1) is 10 mg / mL.
[0026] Preferably, the volume ratio of the aqueous phase to the lipid phase in step (2) is 3:1.
[0027] Preferably, in step (2), the total flow rate of microfluidic mixing is 12 mL / min.
[0028] Preferably, in step (2), after the aqueous phase and lipid phase are mixed by microfluidics, they are immediately replaced with PBS (pH 7.4) buffer, and ethanol and unencapsulated components are removed by dialysis or ultrafiltration.
[0029] Preferably, the lipid nanoparticles with PITPα mRNA targeting ligands for oligodendrocyte precursor cells attached to their surface are obtained by introducing an antibody against CD140a onto the surface of the PITPα mRNA lipid nanoparticles; specifically, they are prepared by the following method:
[0030] (I) The anti-CD140a monoclonal antibody (CD140a antibody for short) was dissolved in a buffer solution, and then Traut's Reagent (chemical name 2-iminothione hydrochloride, CAS No.: 4781-83-3) was added. The reaction was carried out at room temperature to introduce thiol groups (-SH) onto the surface of the antibody molecule. After the reaction was completed, the excess reagent was removed using a Zeba desalting column to obtain the thiolized antibody.
[0031] (II) The lipid nanoparticles (PITPα mRNA-LNP) loaded with PITPα mRNA were added to a buffer solution, and then DSPE-PEG(2000)-maleimide was added for incubation (co-incubation for surface modification). After the surface modification was completed, the thiolized antibody obtained in step (I) was added for coupling reaction (the maleimide group undergoes a thiol-maleimide covalent coupling reaction with the thiol group on the surface of CD140a antibody, thereby stably linking the CD140a antibody to the surface of the nanoparticles). After the reaction was completed, the nanoparticles (C-PITPα) were purified by ultrafiltration to obtain the lipid nanoparticles (C-PITPα) with PITPα mRNA on the surface linked to a targeting ligand for oligodendrocyte precursor cells.
[0032] Preferably, the buffer solution described in steps (I) and (II) is PBS (pH 7.2–7.4) buffer; more preferably, it is PBS (pH 7.2) buffer.
[0033] Preferably, in step (I), the concentration of the system formed by dissolving the anti-CD140a monoclonal antibody in the buffer solution is 0.5–2 mg / mL; more preferably, it is about 1 mg / mL.
[0034] Preferably, the molar ratio of the anti-CD140a monoclonal antibody to Traut's Reagent in step (I) is 1:20.
[0035] Preferably, the room temperature reaction in step (I) is a room temperature slight oscillation reaction, and the reaction time is 0.5 to 1.5 h, more preferably 1 h.
[0036] Preferably, the amount of DSPE-PEG(2000)-maleimide used in step (II) is 1.5% of the total molar amount of lipids in PITPα mRNA-LNP.
[0037] Preferably, the mass ratio of the thiolized antibody to the total lipids in the lipid nanoparticles (PITPα mRNA-LNP) loaded with PITPα mRNA in step (II) is 1:50.
[0038] Preferably, the coupling reaction in step (II) takes 1.5 to 2.5 hours; more preferably, it takes 2 hours.
[0039] Preferably, the ultrafiltration in step (II) is performed using a 100kDa ultrafiltration centrifuge tube (Millipore).
[0040] Preferably, the drug is administered within 0 to 72 hours (excluding 0) after the onset of ischemic brain injury.
[0041] Preferably, the dosage of the drug is 0.05–2.0 mg / kg.
[0042] Preferably, the drug is administered via intravenous injection, intraventricular injection, or perilesional injection.
[0043] Preferably, the drug is administered in a single or multiple dose manner.
[0044] Preferably, the drug may also contain other pharmaceutically acceptable carriers, such as fillers, binders, diluents, disintegrants, glidants, etc.
[0045] The technical solution of this invention includes: increasing the expression level of PITPα in oligodendrocyte precursor cells (OPCs) to promote OPC maturation, differentiation, and remyelination; preferably, the messenger RNA (mRNA) encoding PITPα is encapsulated in lipid nanoparticles (LNPs), and can be directed to OPCs by linking a targeting ligand. Experimental results show that PITPα is specifically highly expressed in hiPSC-derived Olig2-OPCs; downregulation of PITPα leads to PDGFRα... + The reduction in OPC cell pools, decreased expression of myelin basic protein (MBP), and reduced in vitro myelination capacity; in an animal model of ischemic brain injury, a single injection of PITPα mRNA-LNP targeting OPCs can reduce neurological deficits, improve survival rate, enhance MBP signaling, increase myelinated axon density, and improve learning and memory abilities. These techniques provide a new therapeutic strategy for white matter repair and functional recovery after ischemic brain injury / stroke.
[0046] The present invention has the following advantages and effects compared with the prior art:
[0047] (1) This invention provides a new molecular target and nucleic acid delivery technology to solve the problems of insufficient repair of white matter damage, limited maturation of oligodendrocytes and poor recovery of neurological function after ischemic brain injury / stroke.
[0048] (2) This invention reveals for the first time the key regulatory role of phospholipid transporter α (PITPα) in oligodendrocyte precursor cell differentiation and myelin formation, providing a new molecular target for white matter repair after ischemic brain injury.
[0049] (3) This invention improves the expression level of PITPα in oligodendrocyte precursor cells by delivering PITPα mRNA, which can significantly promote the maturation and differentiation of oligodendrocytes and enhance their remyelination ability.
[0050] (4) The present invention can improve the delivery efficiency and expression level of PITPα mRNA in target cells and reduce non-targeting effects by delivering lipid nanoparticles and combining OPC targeting modification.
[0051] (5) In an animal model of ischemic brain injury, the present invention can improve neurological deficits, promote white matter structure repair and improve cognitive function recovery with a single administration.
[0052] (6) The technical solution provided by the present invention is applicable to the preparation and clinical application of drugs for white matter repair and neurological function recovery after ischemic brain injury (ischemic stroke or ischemia-reperfusion brain injury), and has good application prospects. Attached Figure Description
[0053] Figure 1 This diagram illustrates the expression of PITPα in hiPSC-derived Olig2-OPC and its effects on OPC maintenance, differentiation, and in vitro myelination capacity. A shows the results of Western blot analysis of PITPα and PITPβ protein expression in Olig2-OPC; B shows the results of qPCR analysis of PITPα and PITPβ mRNA expression in Olig2-OPC; and C shows the results of flow cytometry analysis of PDGFRα. + A representative result of the OPC ratio (comparing the control group and the PITPαshRNA treatment group); D represents PDGFRα. + Statistical analysis chart of OPC ratio; E represents MBP detected by immunofluorescence. + Representative images of mature oligodendrocytes (comparing the control group and the PITPα shRNA treatment group); F represents MBP. + Statistical analysis of signal / cell number; G is a representative image of NF200 and MBP immunofluorescence co-staining in the neuron-OPC co-culture system, used to characterize the level of axonal wrapping / myelination; H is a quantitative statistical graph of NF200 and MBP co-localization / co-staining signals, used to compare the difference in myelination efficiency between the control group and the PITPα shRNA treatment group.
[0054] Figure 2This diagram illustrates the preparation, characterization, and delivery of PITPα mRNA lipid nanoparticles targeting oligodendrocyte precursor cells in this embodiment of the invention (in the diagram, PITPα: basic lipid nanoparticles without antibody linkage; C-PITPα: OPC-targeting PITPα mRNA lipid nanoparticles with CD140a antibody linked to their surface); A is a schematic diagram of the preparation process of PITPα mRNA lipid nanoparticles, showing the process of encapsulating PITPα mRNA in lipid nanoparticles and introducing CD140a antibody onto their surface to achieve OPC targeting; B is a transmission electron microscope image of the PITPα mRNA lipid nanoparticles, showing the morphology and dispersion state of the lipid nanoparticles; C is a graph showing the particle size distribution and Zeta potential test results of the PITPα mRNA lipid nanoparticles, used to characterize the particle size and surface charge of the lipid nanoparticles; D is a schematic diagram of lipid nanoparticle delivery with luciferase mRNA as a control, comparing lipid nanoparticles without antibody modification with targeted lipid nanoparticles modified with CD140a antibody; E is PITPα mRNA... The encapsulation efficiency test results in lipid nanoparticles are shown in the figure, which is used to show the encapsulation of PITPα mRNA in lipid nanoparticles; F is a comparison of the delivery efficiency of targeted and non-targeted lipid nanoparticles at different time points after drug administration, which is used to characterize the effect of CD140a antibody modification on mRNA delivery efficiency.
[0055] Figure 3 Figure 1 shows the experimental results of PITPα mRNA delivery improving myelin ultrastructure and promoting cognitive function recovery after ischemic injury. A is a schematic diagram of the experimental procedure; B is the neurological deficit score after MCAO modeling, used to assess functional impairment and recovery after ischemic injury; C and D are representative images and quantitative analysis of MBP immunofluorescence staining of brain tissue sections, showing enhanced MBP signal in ischemia-related areas in the PITPα mRNA treatment group (especially the C-PITPα group), indicating improved remyelination; E and F are representative images of myelin ultrastructure observed by transmission electron microscopy (TEM) and quantitative analysis of myelinated axon density, showing that PITPα mRNA delivery can improve myelin structure and increase myelinated axon density, with more significant improvement in the C-PITPα group; G, H, and I are the results of the Morris water maze behavioral test: representative swimming path trajectory (G), escape latency (H), and target quadrant dwell / percentage (I), showing that the PITPα mRNA treatment group compared to the MCAO group... The control group showed improved learning and memory performance. Detailed Implementation
[0056] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed according to conventional experimental conditions or experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention are commercially available.
[0057] Example 1
[0058] Verification of the role of PITPα in the differentiation and myelination of hiPSC-derived Olig2-OPC
[0059] I. Detection of PITPα expression in hiPSC-derived Olig2-OPC
[0060] This embodiment uses human induced pluripotent stem cells (hiPSCs) to induce differentiation into oligodendrocyte precursor cells (Olig2-OPCs) expressing the Olig2 marker. The hiPSCs are commercially available; the cells used in this embodiment are human induced pluripotent stem cell lines purchased from ATCC. The specific steps are as follows:
[0061] (a) hiPSCs were cultured in Matrigel (Corning, catalog number 354277) coated culture plates and maintained in an undifferentiated state using mTeSR1 medium (STEMCELL Technologies) at 37°C and 5% CO2.
[0062] (b) Then, differentiation was performed using the classic neural induction method: First, N2 supplement (final concentration range 0.5-1×, final concentration 1× in this example), SB431542 (10 μM) and LDN193189 (100 nM) were added to DMEM / F12 medium to induce the formation of neural progenitor cells (NPCs), and cultured for about 7 days; then, the medium was changed to OPC induction medium (DMEM / F12+B27+N2) (final concentration range of B27 and N2 is 0.5-1×, final concentration of both is 1× in this example), and retinoic acid was added. Cells were cultured for 3–4 weeks with retinoic acid (100 nM), SAG (Hedgehog / Smoothened agonist, 1 μM), PDGF-AA (platelet-derived factor, 10 ng / mL), IGF-1 (insulin-like growth factor-1, 10 ng / mL) and NT-3 (neurotrophic factor-3, 10 ng / mL) to differentiate into OPCs expressing Olig2.
[0063] (c) Olig2 and PDGFRα expression were detected by immunofluorescence staining to confirm the OPC phenotype. Olig2-OPCs were then collected for phospholipid metabolism-related protein expression detection. Total protein was extracted using RIPA lysis buffer, and the protein expression levels of PITPα and PITPβ were detected by Western blotting, with β-actin as an internal control. Simultaneously, total RNA was extracted using TRIzol, and cDNA was synthesized using a reverse transcription kit. Real-time quantitative PCR (qPCR) was performed using the SYBR Green system to detect the mRNA expression levels of PITPα (PITPNA) and PITPβ (PITPNB), with GAPDH as an internal control gene. The qPCR primer sequences are as follows:
[0064] PITPNA-F: 5'-TATCGGGTCATCCTGCCTGT-3' (SEQ ID NO. 2);
[0065] PITPNA-R: 5'-AGGTGGGTACTTTGCTCTGTA-3' (SEQ ID NO. 3);
[0066] PITPNB-F: 5'-TGACCTGCTGAAGATGGAGA-3' (SEQ ID NO.4);
[0067] PITPNB-R: 5'-CAGGTTCTTGGTGATGGTGA-3' (SEQ ID NO.5);
[0068] GAPDH-F: 5'-AGGTCGGTGTGAACGGATTTG-3' (SEQ ID NO. 6);
[0069] GAPDH-R: 5'-GGGGTCGTTGATGGCAACA-3' (SEQ ID NO. 7).
[0070] All experiments were performed in triplicate. The results were used to analyze the expression of PITPα and PITPβ in Olig2-OPCs to verify their association with phospholipid metabolism and myelin formation.
[0071] The results showed that PITPα expression was significantly increased in Olig2-OPC, while PITPβ expression remained unchanged (see [link to Olig2-OPC]). Figure 1 (A and B in the original text). The above results indicate that there is a regulatory phenomenon in Olig2-OPC that specifically enhances PITPα expression, suggesting that PITPα may be related to its strong phospholipid metabolism capacity and myelin formation potential.
[0072] II. Effects of PITPα downregulation on the maintenance of the OPC cell pool
[0073] To further verify the functional role of PITPα in oligodendrocyte precursor cells, this embodiment used short hairpin RNA (shRNA) to silence PITPα in Olig2-OPCs. The Olig2-OPCs were obtained by induced differentiation of human induced pluripotent stem cells (hiPSCs) (using the same method as step one above). A specific shRNA sequence targeting the human PITPα gene (PITPNA) was designed and constructed in the lentiviral expression vector pLKO.1. The shRNA can be obtained commercially, for example, from Sigma-Aldrich's MISSION shRNA series, or synthesized and packaged into lentivirus by companies such as GeneChem and Hanbio. The shPITPα target sequence used in this embodiment was 5'-GCTGATGTTGAGATCATTA-3' (SEQ ID NO.8); the negative control scramble shRNA sequence was 5'-TTCTCCGAACGTGTCACGT-3' (SEQ ID NO.9). The lentiviral titer was approximately 1 × 10⁻⁶. 8 TU / mL. The specific steps are as follows:
[0074] (a) Olig2-OPCs were seeded in 6-well plates and infected when the cell density reached approximately 60–70%. shPITPα lentivirus or scrambled shRNA lentivirus was added to the culture medium at a multiplicity of infection (MOI) of 10. Polybrene (Sigma-Aldrich, molecular weight approximately 4–8 kDa, final concentration range 4–8 μg / mL, final concentration in this experiment 8 μg / mL) was added to improve infection efficiency. After incubation at 37°C for 12–16 hours, the medium was replaced with fresh medium for further culture. 48–72 hours after infection, stably expressing cells were selected using puromycin (2 μg / mL) for 3–5 days to obtain a PITPα-silenced OPC cell population.
[0075] (b) Subsequently, the proportion of PDGFRα-positive OPC cells after PITPα silencing was detected by flow cytometry. The specific method was as follows: cells were collected and digested with Accutase (STEMCELL Technologies) to prepare a single-cell suspension. After washing with PBS, fluorescently labeled anti-human PDGFRα antibody (e.g., PE-anti-human PDGFRα, BioLegend, 1:100 dilution) was added and incubated at 4°C in the dark for 30 minutes. After staining, the cells were washed twice with PBS and resuspended in 500 μL PBS. Detection was performed using a BD FACSCantoII flow cytometer, and data analysis was performed using FlowJo software. The experiment included a shPITPα group and a scramble shRNA control group, with three independent replicates for each group to compare the change in the proportion of PDGFRα-positive cells in OPC cells after PITPα silencing, thereby assessing the regulatory role of PITPα in OPC maintenance and differentiation status.
[0076] The results showed that, compared with the control group, PITPα silenced PDGFRα + The proportion of OPC decreased significantly (see Figure 1 The values of C and D in the data suggest that PITPα plays an important role in maintaining the OPC cell pool. This decrease may be associated with impaired OPC proliferation, survival, or lineage progression.
[0077] III. Effects of PITPα downregulation on oligodendrocyte maturation and differentiation
[0078] To evaluate the effect of PITPα on the differentiation of Olig2-OPC cells into myelin-forming oligodendrocytes, this embodiment used immunofluorescence to detect the expression of myelin basic protein (MBP), a marker of mature oligodendrocytes. The specific steps are as follows:
[0079] (a) The control OPC cell population (scramble shRNA) and PITPα-silenced OPC cell population (shPITPα) obtained above through lentiviral infection (both Olig2-positive OPCs) were seeded into glass slides or culture dishes coated with poly-L-lysine (Sigma-Aldrich, 10 μg / mL) and cultured in differentiation medium (DMEM / F12+B27 supplement (final concentration range 1–2×, final concentration in this experiment was 1×), with added triiodothyronine T3 (40 ng / mL)) for about 3–5 days to induce differentiation into mature oligodendrocytes.
[0080] (b) After differentiation, cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes, washed three times with PBS, and permeabilized with 0.3% (v / v) Triton X-100 for 10 minutes. They were then blocked with 5% (v / v) bovine serum albumin (BSA) at room temperature for 1 hour. Anti-MBP primary antibody (e.g., Abcam antibody, 1:500 dilution) was added and incubated overnight at 4°C. After washing with PBS, Alexa Fluor-labeled fluorescent secondary antibody (Invitrogen, 1:1000 dilution) was added and incubated at room temperature in the dark for 1 hour. Cell nuclei were stained with DAPI (1 μg / mL).
[0081] (c) Finally, confocal microscopy was used to acquire images, and ImageJ software was used to quantitatively analyze the proportion of MBP-positive cells and fluorescence intensity. A control group and a PITPα silencing group were set up, with each group performed in three independent replicates to compare changes in MBP expression levels under different treatment conditions, thereby evaluating the regulatory effect of PITPα on Olig2-OPC differentiation and myelination capacity.
[0082] The results showed that PITPα silencing MBP + Cell number / signaling was significantly reduced (see Figure 1 The results (E and F in the data) indicate that PITPα deficiency inhibits the maturation and differentiation of Olig2-OPC and reduces the ability to form myelin-related structural proteins, thus hindering the production of myelin-forming oligodendrocytes.
[0083] IV. Effects of PITPα downregulation on in vitro axonal wrapping / myelination capacity
[0084] To further evaluate the functional impact of PITPα on myelination, this embodiment established a neuron-OPC co-culture system and detected axonal encapsulation and myelination levels. The neurons could be obtained commercially, for example, human-derived neurons purchased from ScienCell Research Laboratories (catalog number 1520), or isolated from the cortex of E18 mouse embryos. In this embodiment, neurons were isolated from the cortex of E18 mouse embryos, and the specific steps are as follows:
[0085] (a) Embryonic cortical tissue from pregnant mice (C57BL / 6 strain, female, 8–12 weeks old, weighing approximately 20–30 g, purchased from Guangdong Experimental Animal Center) at day 18 of the embryonic period (E18) was placed in HBSS buffer (Gibco) and minced. It was then digested at 37°C for 15 minutes with 0.25% trypsin-EDTA (Gibco). Subsequently, DMEM containing 10% (v / v) fetal bovine serum (FBS, Gibco) was added to terminate the digestion and the cells were gently pipetted to form a single-cell suspension. Cells were filtered through a 70 μm screen and seeded into culture plates coated with poly-D-lysine (molecular weight 30–70 kDa, Sigma-Aldrich, 50 μg / mL) and laminin (Sigma-Aldrich, 10 μg / mL). They were cultured in Neurobasal medium (Gibco) + B27 supplement (Gibco, final concentration range 1–2×, final concentration in this experiment was 1×) + GlutaMAX (Gibco, final concentration 1×, approximately 2 mM) + penicillin and streptomycin (100 U / mL) for 7 days to form a mature neuronal network.
[0086] (b) Subsequently, Olig2-OPCs treated with shPITPα or scramble shRNA lentivirus (prepared in the same way as in step two above) were digested into single-cell suspensions and seeded into the neuronal culture system at a ratio of approximately 1:5 OPC:neuron. The co-culture medium was Neurobasal medium + B27 (final concentration 1×) + PDGF-AA (10 ng / mL) + IGF-1 (10 ng / mL) + triiodothyronine T3 (40 ng / mL).
[0087] (c) After co-culturing for approximately 5–7 days, immunofluorescence detection was performed. The specific method was as follows: cells were fixed with 4% paraformaldehyde for 15 minutes, washed with PBS, permeabilized with 0.3% (v / v) Triton X-100 for 10 minutes, and blocked with 5% (v / v) BSA for 1 hour. Then, a primary antibody mixture was added and incubated overnight at 4°C, with simultaneous incubation of the neuronal axonal marker NF200 antibody (Abcam, 1:500) and the myelin marker MBP antibody (Abcam, 1:500). After washing with PBS, the corresponding Alexa Fluor 488-labeled secondary antibody (Invitrogen, 1:1000) was added, and the cells were incubated at room temperature in the dark for 1 hour. Cell nuclei were stained with DAPI (1 μg / mL).
[0088] (d) Finally, images were acquired using a confocal microscope (such as the Zeiss LSM series), and the colocalization area or colocalization ratio of MBP and NF200 signals was quantitatively analyzed using ImageJ software to assess the level of axonal encapsulation and myelination. The experiment included a shPITPα treatment group and a scramble shRNA control group, with three independent replicates for each group.
[0089] The results showed that, compared with the control group, the co-staining / co-localization signal of NF200 and MBP was significantly reduced in the PITPα silencing group (see [link to study]). Figure 1 The presence of G and H in the data suggests that PITPα deficiency weakens Olig2-OPC-mediated axonal wrapping and myelination capabilities, leading to decreased in vitro myelination efficiency.
[0090] V. Conclusions and Beneficial Effects of this Embodiment
[0091] In summary, this embodiment confirms that:
[0092] (1) PITPα is specifically upregulated in hiPSC-derived Olig2-OPC;
[0093] (2) PITPα vs. PDGFRα + Maintaining the OPC cell pool plays an important role;
[0094] (3) PITPα deficiency inhibits Olig2-OPC maturation and differentiation and reduces MBP expression;
[0095] (4) PITPα deficiency weakens the axonal wrapping / myelination ability of neurons under co-culture conditions.
[0096] Therefore, PITPα can serve as a key molecular target for promoting OPC differentiation and myelin regeneration, providing a basis for cell therapy or nucleic acid drug delivery related to white matter repair after ischemic brain injury.
[0097] Example 2
[0098] A PITPα mRNA lipid nanoparticle targeting OPCs and its preparation and characterization
[0099] I. Preparation of PITPα mRNA lipid nanoparticles
[0100] like Figure 2As shown in Figure A, this embodiment provides a method for preparing PITPα mRNA lipid nanoparticles (LNPs). The PITPα mRNA is obtained through in vitro transcription. First, using a DNA plasmid encoding human PITPα (PITPNA) as a template (the plasmid can be obtained from Addgene or synthesized by a biotechnology company, such as Shanghai Sangon Biotech Co., Ltd.), mRNA is synthesized through in vitro transcription using the T7 RNA polymerase in vitro transcription kit (MEGAscript T7 Kit, Thermo Fisher Scientific). During transcription, a Cap1 structural analogue (CleanCap Reagent, TriLink Biotechnologies) is added to form a 5′ cap structure, and a poly(A) tail (approximately 100–120 nt) is designed at the end of the template sequence to improve mRNA stability and translation efficiency. After transcription, the mRNA is purified using the MEGAclear RNA purification kit (Thermo Fisher Scientific), and the concentration and purity are detected by ultraviolet spectrophotometer. The specific preparation steps are as follows:
[0101] (1) Preparation of aqueous and lipid phases:
[0102] First, PITPα mRNA (NCBI accession number NM_008845.4; SEQ ID NO.1) was dissolved in 25 mM sodium acetate buffer (pH 4.0) to form an aqueous phase, with a final mRNA concentration of 0.1 mg / mL. Simultaneously, the lipid components were dissolved in anhydrous ethanol to form a lipid phase. The lipid components included: the ionizable cationic lipid DLin-MC3-DMA (4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, Med Chem Express), the structural phospholipid DSPC (distearylphosphatidylcholine, Avanti PolarLipids), cholesterol (Cholesterol, Sigma-Aldrich), and the PEG-modified lipid DMG-PEG2000 (AvantiPolar Lipids), prepared in a molar ratio of 50:10:38.5:1.5 (MC3:DSPC:Cholesterol:DMG-PEG2000), with a total lipid concentration of 10 mg / mL.
[0103] PITPα mRNA (SEQ ID NO.1) (710bp):
[0104] ATGGCGACCCCTGGCAACCTGGGGTCCTCCGTCCTGGCGAGCAAGACCAAGACGAAGAAGAAGCACTTCGTGGCTCAGAAAGTGAAGCTGTTCCGGGCCAGCGACCCGCTGCTCAGCGTGCTCATGTGGGGGGTCAACCATTCGATCAATGAACTGAGCCACGTTCAAATCCCTGTCATGTTGATGCCTGATGACTTCAAAGCCTACTCAAAGATAAAGGTTGACAACCACCTTTTTAACAAGGAAAACATGCCGAGCCATTTCAAGTTTAAGGAATACTGCCCAATGGTCTTCCGGAATCTGCGGGAGAGGTTTGGAATCGACGACCAAGATTTCCAGAATTCCTTGACCAGAAGTGCACCCCTTCCCAATGACTCCCAGGCTCGCAGCGGGGCTCGGTTTCACACGTCTTATGATAAAAGATACGTCATCAAGACCATTACCAGTGAGGACGTGGCAGAGATGCACAACATCCTGAAGAAGTACCACCAGTATATAGTGGAATGTCATGGGGTCACACTTCTTCCTCAGTTCTTGGGAATGTACCGGCTTAATGTCGATGGAGTGGAAATATATGTGATTGTTACAAGGAATGTGTTCAGCCACCGGCTATCTGTATATAGGAAATACGACTTAAAGGGCTCGACAGTGGCTAGAGAAGCTAGTGATAAAGAAAAGGCCAAAGAGCTGCCAACTTTAAAGGATAATGA。
[0105] (2) Preparation of basic lipid nanoparticles without conjugated antibodies (PITPα mRNA-LNP):
[0106] Nanoparticles were assembled using a microfluidic mixing device (NanoAssemblr Benchtop, Precision Nano Systems). An aqueous phase (containing PITPα mRNA) and a lipid phase were injected into the microfluidic chip at a volume ratio of 3:1 and rapidly mixed at a total flow rate of 12 mL / min, self-assembling to form lipid nanoparticles encapsulating PITPα mRNA. Immediately after mixing, the mixture was replaced with PBS (pH 7.4), and ethanol and unencapsulated components were removed by dialysis or ultrafiltration (100 kDa ultrafiltration tube, Millipore). The resulting nanoparticles were PITPα mRNA-LNP.
[0107] (3) Targeted modification
[0108] ① Preparation of OPC-targeted PITPα mRNA lipid nanoparticles with CD140a antibody linked to their surface (C-PITPα):
[0109] To achieve specific targeting of oligodendrocyte precursor cells (OPCs), antibodies were conjugated to the surface of PITPα mRNA-LNPs using DSPE-PEG-maleimide (Avanti Polar Lipids). Anti-PDGFRα (CD140a) monoclonal antibody (BioLegend) was thiolated using Traut'sreagent (Thermo Fisher Scientific) and then reacted with LNPs containing maleimide groups in PBS (pH 7.2) for 2 hours (room temperature), covalently linking the antibody to the nanoparticle surface to obtain CD140a-LNP-PITPα mRNA, denoted as C-PITPα. The specific preparation method is as follows:
[0110] The anti-CD140a monoclonal antibody (anti-mouse PDGFRα, BioLegend) was first thiolated using Traut's reagent. Specifically, the antibody was dissolved in PBS (pH 7.2) at a concentration of 1 mg / mL, and added to the reaction system at a Traut's reagent to antibody molar ratio of 20:1. The mixture was gently shaken at room temperature for 1 hour to introduce thiol groups (-SH) onto the antibody molecule surface. After the reaction, excess reagent was removed using a Zeba desalting column to obtain the thiolated anti-CD140a monoclonal antibody (referred to as thiolated antibody).
[0111] To achieve antibody-coupled modification, DSPE-PEG(2000)-maleimide was first introduced onto the surface of PITPα mRNA-LNP using a post-insertion method. Specifically, DSPE-PEG(2000)-maleimide was added at 1.5% of the total lipid molar amount in PITPα mRNA-LNP to a pre-prepared PITPα mRNA-LNP suspension (PITPα mRNA-LNP was added to phosphate-buffered saline (PBS, pH 7.2–7.4) and mixed to form a suspension). The suspension was incubated at 37°C for 30 min to complete the surface modification. The mass ratio of the thiolized antibody to PITPα mRNA-LNP (calculated based on the total lipid content) was (0.5–5):1, preferably (1–2):1. The reaction was carried out at room temperature for 2 h under PBS (pH 7.2). The maleimide group underwent a thiol-maleimide covalent coupling reaction with the thiol groups on the antibody surface, thereby stably linking the CD140a antibody to the nanoparticle surface. After the reaction, the sample was purified by ultrafiltration using 100kDa ultrafiltration centrifuge tubes (Millipore) to remove unbound antibodies and resuspended in PBS to finally obtain CD140a antibody-modified PITPα mRNA lipid nanoparticles (C-PITPα).
[0112] ② Preparation of control nanoparticles (C-Luc):
[0113] The PITPα mRNA of this invention was replaced with luciferase mRNA (TriLink Biotechnologies) (Luc for short) and Luc mRNA-LNP was prepared by the same method as described above; and C-Luc was obtained by conjugating CD140a antibody on its surface.
[0114] ③ Preparation of PITPα mRNA lipid nanoparticles with surface-linked isotype control IgG antibodies (I-PITPα):
[0115] In addition, the CD140a antibody in step ① above was replaced with a normal IgG antibody (BioLegend), and then conjugated to the surface of PITPα mRNA-LNP using the same method to obtain IgG-modified PITPα mRNA lipid nanoparticles IgG-LNP-PITPα mRNA (I-PITPα). These control nanoparticles are identical to C-PITPα in lipid composition, particle size, mRNA content, and preparation conditions, differing only in antibody type, and are used to exclude the non-specific effects of antibody conjugation.
[0116] The final obtained nanoparticles had a particle size of approximately 80–100 nm, determined by dynamic light scattering (DLS, Malvern Zeta sizer), and an mRNA encapsulation efficiency of approximately 85–95%, determined by RiboGreen RNAassay (Thermo Fisher Scientific). The resulting formulation was used for subsequent in vitro and in vivo experiments, and its preparation process is as follows: Figure 2 As shown in A in the diagram.
[0117] II. Morphological observation of lipid nanoparticles
[0118] The morphology of the prepared PITPα mRNA lipid nanoparticles (C-PITPα) was observed using transmission electron microscopy, and the results are as follows: Figure 2 As shown in B, the obtained lipid nanoparticles exhibit a regular spherical structure, good dispersibility, and no obvious agglomeration, indicating that this preparation method can obtain nanoparticles with uniform morphology.
[0119] III. Particle size and Zeta potential characterization of lipid nanoparticles
[0120] The particle size and zeta potential of PITPα mRNA lipid nanoparticles were detected using dynamic light scattering technology, and the results are as follows: Figure 2 As shown in C. The results show that the average particle size of the lipid nanoparticles is within the nanoscale range suitable for in vivo delivery, and the particle size distribution is concentrated; the zeta potential is close to neutral, indicating that the lipid nanoparticles have good colloidal stability and are suitable for in vivo application.
[0121] IV. Encapsulation and Protective Effect of Lipid Nanoparticles
[0122] The encapsulation and protection of lipid nanoparticles were detected by agarose gel electrophoresis. The specific method is as follows:
[0123] The encapsulation and protection of mRNA by lipid nanoparticles (LNPs) were evaluated using agarose gel electrophoresis. Naked Luc mRNA and PITPα mRNA, along with their corresponding LNP encapsulation forms (C-Luc LNP and C-PITPα LNP), were used as experimental groups. RNA loading buffer was added to each sample, and the samples were loaded onto 1%–2% agarose gels for electrophoresis (80–120 V, 20–30 min). After electrophoresis, the samples were stained with nucleic acid dyes (such as SYBR Safe), and the distribution of RNA bands was observed using a gel imaging system.
[0124] The results are as follows Figure 2As shown in Figure D, naked mRNA appears as a clear band in the gel; while mRNA encapsulated by LNP is effectively encapsulated by lipid nanoparticles and is not released into the gel, so no obvious band is observed, thus proving that LNP has a good encapsulation and protection effect on mRNA.
[0125] V. Encapsulation efficiency determination of PITPα mRNA
[0126] The encapsulation efficiency of PITPα mRNA in lipid nanoparticles was determined, with three replicates.
[0127] The results are as follows Figure 2 As shown in E in the figure. The results indicate that PITPα mRNA can be efficiently encapsulated in lipid nanoparticles, and its encapsulation efficiency remains at a high level before and after the introduction of CD140a antibody modification, indicating that the antibody modification process does not significantly affect the mRNA encapsulation efficiency.
[0128] VI. Validation of the delivery efficiency of targeted lipid nanoparticles
[0129] To verify the targeted delivery capability of the lipid nanoparticles to oligodendrocyte precursor cells (OPCs), this embodiment uses luciferase mRNA (Luc mRNA) as a tracer molecule to compare the delivery efficiency of unmodified antibody-modified lipid nanoparticles with that of CD140a antibody-modified lipid nanoparticles. Specifically:
[0130] In the in vitro targeting experiment, Olig2-OPCs (prepared using the same method as in step one above) were seeded into 24-well plates (approximately 5 × 10⁶ per well). 4 Cells were cultured overnight and then incubated with Luc mRNA-LNP, C-Luc, and C-PITPα at a final mRNA concentration of 0.5 μg / mL for 6 h. A control group (Mock) without any drug treatment (LNP treatment containing mRNA) was used. Cells were then cultured in fresh medium for another 18 h. Cells were lysed using the Luciferase Assay System (Promega) and luciferase activity was measured. The luminescence signal was measured using a fluorescence spectrometer (Promega GloMax). The effect of CD140a antibody modification on OPC targeted delivery efficiency was evaluated by comparing the luciferase activity of cells treated with Luc mRNA-LNP and C-Luc. The experiment was performed in triplicate, and the results were used to analyze the delivery effect of the targeted modified nanoparticles.
[0131] The results are as follows Figure 2As shown in F, luciferase expression levels were detected at 24 and 48 hours post-drug administration. The results showed that, compared to untargeted lipid nanoparticles, CD140a antibody-modified lipid nanoparticles (C-PITPα) exhibited higher luciferase expression levels at the same time points, indicating that these lipid nanoparticles can improve the delivery efficiency of mRNA in OPC.
[0132] VII. Beneficial Effects of This Embodiment
[0133] Through the above embodiments and Figure 2 It can be seen that the PITPα mRNA lipid nanoparticles targeting oligodendrocyte precursor cells provided by the present invention have at least the following beneficial effects: PITPα mRNA can be stably and efficiently encapsulated in lipid nanoparticles; the lipid nanoparticles have uniform particle size and good stability, making them suitable for in vivo delivery; specific targeting of OPC is achieved through CD140a antibody modification; and the in vivo delivery and expression efficiency of mRNA is significantly improved, providing a new technical means for the treatment of central nervous system diseases such as stroke.
[0134] Example 3
[0135] A single injection of PITPα mRNA-LNP targeting OPC improves neurological function, survival rate, and myelin repair after ischemic brain injury.
[0136] I. Laboratory Animals, Models, and Grouping
[0137] After establishing the ischemic brain injury model, experimental animals were administered drugs within a set time window. The experimental animals were 8–10-week-old C57BL / 6 mice (weighing 20–25 g). The ischemic brain injury model was established using a middle cerebral artery occlusion (MCAO) model: mice were anesthetized with 2% isoflurane inhalation, and the middle cerebral artery was occluded by inserting a silicone-coated nylon suture (approximately 0.20–0.22 mm in diameter) through the external carotid artery. After 60 minutes of occlusion, the suture embolus was removed to restore blood flow and form a reperfusion model. Postoperatively, the animals were placed on a heated mat for recovery and given routine care. After successful model establishment, the mice were randomly divided into 4 groups (n=8 per group):
[0138] (1) Sham Group: The experimental animals were 8–10-week-old C57BL / 6 mice (weighing 20–25 g). Under 2% isoflurane inhalation anesthesia, a midline incision was made in the neck to separate the common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA), but no nylon suture was inserted to block the middle cerebral artery. After the vascular separation was completed, the vessels were repositioned and the incision was sutured. Routine postoperative care was provided, and at the same time point as the model group, an equal volume of PBS buffer (100 μL) was injected via the tail vein.
[0139] (2) Ischemia model control group (Mock): A middle cerebral artery occlusion (MCAO) model was established in mice under 2% isoflurane anesthesia. Specifically, the middle cerebral artery was blocked for 60 min by inserting a silicone-coated nylon suture (approximately 0.20–0.22 mm in diameter) into the external carotid artery, and then the suture embolus was removed to restore blood flow and form a reperfusion model. 24 h postoperatively, an equal volume of empty LNP (prepared using the same lipid components and preparation method as described above, but without any mRNA-encapsulated lipid nanoparticles) or PBS buffer (100 μL / mouse) was injected via the tail vein as a model control. In this example, PBS buffer (100 μL / mouse) was selected.
[0140] (3) Treatment group (C-PITPα): After the MCAO model was established and blood flow was restored for 24 hours, OPC-targeted PITPα mRNA lipid nanoparticles (C-PITPα) with CD140a antibody attached to the surface were injected via the tail vein (preparation method is the same as in Example 2). The dosage was 1 mg / kg (based on mRNA) and the injection volume was 100 μL / mouse.
[0141] (4) IgG control nanoparticle group (I-PITPα): After establishing the MCAO model and restoring blood flow for 24 hours, PITPα mRNA lipid nanoparticles (I-PITPα) with isotype control IgG antibody attached to their surface were injected via the tail vein (preparation method is the same as in Example 2). The dosage was 1 mg / kg (based on mRNA) and the injection volume was 100 μL per mouse. I-PITPα and C-PITPα were kept consistent in lipid composition, mRNA content and dosage to exclude the influence of non-specific antibody conjugation.
[0142] All animals in each group were administered the drug and underwent subsequent experimental testing at the same time point to compare the effects of different treatments on the recovery of ischemic brain injury and myelin regeneration.
[0143] II. Dosing Regimen
[0144] The treatment window was 24 hours after model establishment and restoration of blood flow. Treatment mice received a single systemic administration via intravenous injection. The administration formulation could be the mRNA nanoparticle to be validated or a related therapeutic agent. The dosage was calculated based on body weight, for example, 1 mg / kg (mRNA or equivalent active substance), with an injection volume controlled at 100–200 μL per mouse. Injection was performed using a 29G disposable insulin syringe, administered slowly over 10–20 seconds. Control mice received the same treatment under the same conditions, with an equal volume of sterile PBS or carrier solution injected via intravenous injection. The animals' general condition was continuously monitored after administration, and subsequent behavioral tests and histological analyses were performed at predetermined time points. Figure 3 (A) The dosage and injection volume were controlled within the tolerable range of the experimental animals and met the standard for routine intravenous administration to mice.
[0145] III. Neurological Function Scoring Evaluation
[0146] The modified neurological severity score (mNSS) was used to assess the neurobehavioral characteristics of the experimental animals in each group. The experimental animals were 8–10-week-old C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.). The mNSS scoring system comprehensively assessed the animals' motor function, sensory function, reflexes, and balance, among other neurobehavioral indicators. The score ranged from 0 to 18 points, with higher scores indicating more severe neurological impairment. The scoring was performed blinded by the researchers without knowledge of the group assignments.
[0147] The specific scoring items are as follows:
[0148] (1) Motor function (Motortest, 0–6 points):
[0149] Place the mouse on a flat surface and observe its voluntary activities and limb movements. If the forelimbs or hindlimbs are flexed, the mouse walks towards the affected side, or the mouse cannot support itself properly, 1 point is awarded for each limb. If the mouse cannot walk in a straight line or exhibits obvious motor impairment, additional points are awarded, up to a maximum of 6 points.
[0150] (2) Sensory function (Sensorytest, 0–2 points):
[0151] The mouse's responsiveness to stimuli was assessed using the tail suspension test and tactile response. One point was awarded for each weakened or absent response to tail suspension or tactile stimulation.
[0152] (3) Balance function (Balancetest, 0–6 points):
[0153] Mice were placed on balance beams of varying widths (e.g., 3cm, 2cm, and 1cm) and their ability to maintain balance and walk was observed. If a mouse could not stand steadily or fell off within a specified time, it was scored according to the difficulty level, with a maximum score of 6 points.
[0154] (4) Reflex function (Reflextest, 0–4 points):
[0155] The test includes corneal reflex, auricular reflex, and startle reflex. A point is awarded for each diminished or absent reflex; if obvious abnormal reflexes are observed, the score is accumulated according to the standard.
[0156] All scores were assessed at fixed time points (e.g., day 1, day 3, day 7, and day 14 post-surgery), with scores recorded independently for each animal and mean scores calculated within each group. The impact of the treatments on neurological function recovery was evaluated by comparing changes in mNSS scores across different experimental groups.
[0157] The results are as follows Figure 3 As shown in B: Compared with the ischemic model control group, the neurological deficit in animals was significantly reduced after a single dose of C-PITPa; within 7 days after stroke, the recovery of neurological function in the treatment group was about 40% higher, suggesting that PITPα mRNA treatment can promote early improvement of neurological function after ischemia.
[0158] IV. MBP Immunofluorescence Assessment of Myelin Regeneration / Oligodendrocyte Maturation
[0159] To assess myelin repair, myelin basic protein (MBP) immunofluorescence staining was performed on the ischemic brain tissue.
[0160] The results are as follows Figure 3 As shown in C and D, compared with the ischemia model control group, the PITPα mRNA-LNP treatment group showed significantly enhanced MBP signal in ischemia-related areas and more abundant MBP-positive myelin-related structures. Quantitative analysis showed that the MBP-positive area in the cortex and subcortical regions increased by approximately 60% in the treatment group, suggesting that C-PITPa can promote oligodendrocyte maturation and enhance remyelination.
[0161] V. Transmission electron microscopy assessment of myelin sheath structure recovery
[0162] Further ultrastructural analysis of ischemia-related white matter regions was performed using transmission electron microscopy, and the density of myelinated axons was quantified.
[0163] The results are as follows Figure 3As shown in F of E in the figure: the number / density of myelinated axons in the C-PITPa treatment group was significantly increased compared with the control group; quantitative results showed that the density of myelinated axons in the treatment group increased by about 40%, suggesting that PITPα mRNA treatment promotes the structural repair of white matter after ischemia and enhances myelin remodeling.
[0164] VI. Water maze test to assess learning and memory recovery
[0165] To evaluate the recovery of cognitive function in experimental animals, this embodiment uses the Morris water maze (MWM) behavioral test. Eight-–10-week-old C57BL / 6 mice (available from Beijing Vital River Laboratory Animal Technology Co., Ltd. or Shanghai Slack Laboratory Animal Co., Ltd.) were used. The experimental setup consisted of a circular pool with a diameter of 120 cm and a height of 50 cm, with a water depth of approximately 30 cm and a water temperature maintained at 22 ± 1℃. A 10 cm diameter circular hidden platform was placed inside the pool, approximately 1 cm below the water surface. To conceal the platform, a suitable amount of non-toxic white pigment was added to the water to make it opaque. Fixed visual references were placed around the laboratory walls as spatial orientation cues.
[0166] The experiment consisted of two phases: a training phase and a probe trial. The training phase lasted five days, with four training sessions per day. Each time, mice were randomly placed into a pool from different quadrants and allowed to freely search for a hidden platform, with a maximum search time of 60 seconds. If a mouse found a platform within the allotted time, its escape latency was recorded; if it did not find a platform, it was guided to the platform and remained there for 10 seconds, with the latency recorded as 60 seconds. On the sixth day, the probe trial was conducted. The hidden platform was removed, and the mice were placed into the pool from the quadrant opposite the original platform and allowed to swim freely for 60 seconds. The mice's movements were recorded using a video tracking system (e.g., EthoVisionXT, Noldus), and indicators such as time spent in the target quadrant and the number of times the original platform was crossed were analyzed. Experimental data are expressed as mean ± standard deviation, with at least 6–8 animals per group. By comparing the escape latency and time spent in the target quadrant among different experimental groups, the impact of the treatment on cognitive function recovery was assessed.
[0167] The results showed that the escape latency was significantly shortened in the C-PITPa treatment group, indicating improved learning ability (see...). Figure 3 In the spatial memory detection experiment, the treatment group showed a significant increase in time spent in the target quadrant (see G and H in the text). Figure 3(I) Quantitative results showed that the time spent in the target quadrant increased by approximately 45% in the treatment group compared to the control group, suggesting that C-PITPa can improve learning and memory function after ischemic brain injury.
[0168] VII. Summary of Beneficial Effects
[0169] This embodiment demonstrates that in an animal model of ischemic brain injury, a single injection of PITPα mRNA-LNP targeting OPC can: (1) reduce neurological deficits and promote early recovery; (2) promote oligodendrocyte maturation and remyelination, increasing the density of myelinated axons; and (3) improve cognitive functions such as learning and memory. These results indicate that this technical approach is suitable for drug preparation and therapeutic applications in white matter repair and functional recovery after ischemic brain injury / stroke.
[0170] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. Application of PITPα modulators in the preparation of drugs for white matter remyelination repair and / or neurological function recovery.
2. Application of PITPα modulators in the preparation of drugs for the treatment and / or improvement of ischemic brain injury.
3. The application according to claim 2, characterized in that: The ischemic brain injury mentioned includes ischemic stroke or ischemia-reperfusion brain injury.
4. The application according to any one of claims 1 to 3, characterized in that: The PITPα regulator is PITPα mRNA or a pharmaceutical preparation containing PITPα mRNA; The nucleotide sequence of the PITPα mRNA is shown in SEQ ID NO.
1.
5. The application according to claim 4, characterized in that: The pharmaceutical formulation containing PITPα mRNA is at least one of lipid nanoparticles encapsulating PITPα mRNA and lipid nanoparticles containing PITPα mRNA with a targeting ligand for oligodendrocyte precursor cells attached to their surface. The targeting ligand is an antibody or a functional fragment thereof targeting platelet-derived growth factor receptor PDGFRα.
6. The application according to claim 5, characterized in that: The lipid nanoparticles loaded with PITPα mRNA were prepared by the following method: (1) PITPα mRNA was dissolved in a buffer solution to form an aqueous phase; at the same time, ionizable cationic lipids, structural phospholipids, cholesterol and polyethylene glycol modified lipids were dissolved in an organic solvent to form a lipid phase; (2) The aqueous phase and lipid phase are mixed by microfluidic method to form lipid nanoparticles loaded with PITPα mRNA.
7. The application according to claim 6, characterized in that: The ionizable cationic lipid mentioned in step (1) is DLin-MC3-DMA; The structural phospholipid mentioned in step (1) is distearylphosphatidylcholine; The polyethylene glycol-modified lipid mentioned in step (1) is DMG-PEG2000; The molar ratio of the ionizable cationic lipids, structural phospholipids, cholesterol and polyethylene glycol modified lipids mentioned in step (1) is 50:10:38.5:1.
5.
8. The application according to claim 6, characterized in that: The buffer solution mentioned in step (1) is sodium acetate buffer solution; The final concentration of PITPα mRNA in the aqueous phase described in step (1) is 0.05–0.2 mg / mL; The total lipid concentration in the lipid phase described in step (1) is 10 mg / mL; The volume ratio of the aqueous phase to the lipid phase in step (2) is 3:
1.
9. The application according to claim 5, characterized in that: The lipid nanoparticles with PITPα mRNA, a targeting ligand for oligodendrocyte precursor cells, attached to their surface were prepared by the following method: (I) Dissolve the anti-CD140a monoclonal antibody in a buffer solution, then add Traut's Reagent, and react at room temperature to introduce thiol groups onto the surface of the antibody molecules. After the reaction is complete, use a Zeba desalting column to remove excess reagents to obtain thiolized antibody. (II) The lipid nanoparticles containing PITPα mRNA as described in any one of claims 5 to 8 are added to a buffer solution, and then DSPE-PEG(2000)-maleimide is added for incubation. After the surface modification is completed, the thiolized antibody obtained in step (I) is added for coupling reaction. After the reaction is completed, the mixture is purified by ultrafiltration to obtain the final product.
10. The application according to claim 9, characterized in that: The buffer solution described in steps (I) and (II) is PBS buffer; The amount of DSPE-PEG(2000)-maleimide used in step (II) is 1.5% of the total molar amount of lipids in PITPα mRNA-LNP; The molar ratio of the anti-CD140a monoclonal antibody to Traut's Reagent described in step (I) is 1:20; The mass ratio of the thiolized antibody to the total lipids in the lipid nanoparticles carrying PITPα mRNA described in step (II) is 1:50.