Xylanase mutant with improved thermostability, engineered bacteria and application thereof
By genetically modifying the Lacrimisporaxylanisolvens strain and expressing it in a Pichia pastoris vector, a xylanase mutant with improved heat resistance was constructed, solving the problem of insufficient enzyme activity of xylanase in high-temperature industrial processes and realizing efficient industrial application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JINAN TIANTIANXIANG
- Filing Date
- 2026-04-16
- Publication Date
- 2026-06-09
AI Technical Summary
The industrial application of existing xylanases faces problems such as low yield, high raw material cost, insufficient enzyme activity and poor heat resistance, making it difficult to meet the requirements of high-temperature industrial processes.
The Lacrimisporaxylanisolvens strain was genetically modified using irrational directed evolution technology to construct a xylanase mutant with improved heat resistance. This mutant was then expressed heterologously using a Pichia pastoris vector to obtain an engineered strain with excellent heat resistance.
The mutant retains more than 90% of its enzyme activity even at 90°C, making it suitable for high-temperature industrial processes and simplifying industrial procedures. Its enzyme activity can reach 7000~9000 U/mL, making it applicable to feed processing, cellulose conversion, and paper bleaching.
Smart Images

Figure CN122168574A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, and specifically relates to a heat-resistant xylanase mutant, engineered bacteria, and their applications. Background Technology
[0002] Xylanase (EC 3.2.1.8) is a complex enzyme system containing both endonucleases and exonucleases. Its core functional enzyme is β-1,4-endoxylanase, which specifically hydrolyzes the β-1,4-glycosidic bonds of the xylan backbone, degrading it into products such as xylooligosaccharides and xylose. Belonging to the class of hydrolases, it plays a crucial role in the degradation of hemicellulose in nature. This enzyme is widely distributed, and enzyme-producing microorganisms include bacteria, Streptomyces, and Trichoderma. In particular, Bacillus, yeasts, and Trichoderma are the main strains for industrial xylanase production due to their excellent fermentation performance.
[0003] Xylanase, a highly efficient, green, and safe plant cell wall hydrolase, has a wide range of applications. In the feed industry, it can degrade xylan-like anti-nutritional factors, reduce feed viscosity, and improve the activity of digestive enzymes and nutrient absorption efficiency in animals. The degradation product, xylooligosaccharides, can also promote the growth of bifidobacteria and regulate the intestinal microecology. In the field of resource and environmental protection, it can convert hemicellulose in agricultural lignocellulose raw materials such as corn cobs and rice straw into useful products, realizing the utilization of straw for feed and energy. Furthermore, this enzyme also has significant application value in the food, pulp and paper, pharmaceutical, and chemical industries.
[0004] However, the industrial application of xylanase still faces the following key challenges: wild-type strains suffer from low yields, high raw material costs, and insufficient enzyme activity, making large-scale production difficult; natural xylanases have poor adaptability in terms of enzymatic properties, and the activity of most enzymes drops to 20%-30% at 70-80℃, making them unable to withstand high-temperature granulation, pulp bleaching, and other processes; at the same time, existing molecular modifications mostly focus on improving heat resistance, which is often accompanied by a decrease in enzyme activity, and the related results are difficult to fully meet the requirements for industrial application.
[0005] To address the aforementioned pain points, this invention employs irrational directed evolution technology to produce xylanase. Lacrimispora xylanisolvens Using *Bacillus xylanatus* as the starting strain, a thermostable xylanase mutant was obtained through mutagenesis screening and gene cloning. A *Pichia pastoris* vector was further constructed to achieve efficient heterologous expression of the mutant enzyme, ultimately yielding a high-activity engineered strain with excellent heat resistance. This mutant effectively overcomes the bottleneck of insufficient heat resistance in natural enzymes, exhibiting excellent thermal stability and meeting the application requirements of cellulose bioconversion industrial production and feed enzyme preparations. This lays the foundation for reducing production costs and promoting the industrial application of xylanase. Summary of the Invention
[0006] To address the above technical problems, this invention proposes a heat-resistant xylanase mutant, an engineered strain, and its applications.
[0007] The technical solution provided by this invention is as follows:
[0008] A xylanase mutant with improved heat resistance, the amino acid sequence of which is shown in SEQ ID No: 3, is obtained by simultaneously modifying a wild-type xylanase (nucleotide sequence shown in SEQ ID No: 2) having the amino acid sequence shown in SEQ ID No: 1 with G38P, D160R, and E263R.
[0009] Furthermore, the gene encoding the xylanase mutant described above is also a key technical content protected by this invention, and the nucleotide sequence of the heat-resistant xylanase mutant gene is shown in SEQ ID No: 4.
[0010] Furthermore, the present invention also provides a recombinant expression vector containing the above-mentioned gene. Preferably, the vector is a pPICZAα plasmid, and the recombinant expression vector can drive the efficient expression of the xylanase mutant.
[0011] Furthermore, the present invention also provides a recombinant engineered strain, wherein the recombinant engineered strain is Pichia pastoris GS115 containing the recombinant expression vector described above.
[0012] In addition, the present invention also provides a fermentation broth containing a heat-resistant xylanase mutant, specifically obtained by inoculating the recombinant engineered bacteria into YPD medium containing bleomycin for activation, then transferring it to BMGY medium and culturing it at 25-30°C and 100-250 rpm for 48-96 h.
[0013] This invention also provides the application of one or more of the above-mentioned xylanase mutants, recombinant engineered bacteria, and fermentation broth in the hydrolysis of xylan.
[0014] Preferably, the applications include food processing, paper bleaching, textile fiber modification, and other fields, with a particular focus on the application of xylan components in high-temperature hydrolysis treatment within these fields.
[0015] In addition, the present invention provides a feed additive, wherein, preferably, the feed additive comprises one or a combination of the xylanase mutant, the recombinant engineered bacteria, and the fermentation broth.
[0016] The present invention has the following advantages and effects compared with the prior art:
[0017] (1) By modifying wild-type xylanase, this invention has obtained a series of xylanase mutants with improved heat resistance, especially the triple mutant G38P / D160R / E263R, which exhibits the best heat resistance. After being treated at a high temperature of 90℃ for 2 hours, the enzyme activity residual rate is still greater than 90%, which is far greater than that of wild type (less than 30%). It can be fully adapted to high-temperature industrial processes of 80~100℃, effectively solving the problem of high-temperature inactivation of traditional xylanase.
[0018] (2) By constructing a recombinant Pichia pastoris GS115 containing the xylanase mutant gene, the enzyme protein can be directly released into the fermentation broth through a simple fermentation process. The obtained fermentation broth containing crude enzyme can be used directly, which is beneficial to simplify the industrial process. Moreover, the enzyme activity of shake-flask fermentation can reach 7000~9000 U / mL, which has great potential for large-scale production. Therefore, it can be widely used in many technical fields such as high-temperature granulation of feed processing, cellulose conversion, and paper bleaching, with broad application prospects. Attached Figure Description
[0019] Figure 1 This invention uses PCR to obtain a nucleic acid gel image of the xylanase gene xyn;
[0020] Figure 2 This invention uses colony PCR to verify the nucleic acid gel image of GS / pPICZAα-xyn;
[0021] Figure 3 This is a comparison chart showing the residual enzyme activity of the xylanase mutant provided by this invention after high-temperature treatment. Detailed Implementation
[0022] To enable those skilled in the art to better understand the present invention, the present invention will now be further described in conjunction with specific embodiments.
[0023] I. Culture medium used in this invention
[0024] LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L;
[0025] Solid LB medium: 15-20 g / L agar powder needs to be added to the LB medium.
[0026] YPD medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L;
[0027] Solid YPD medium: Add 15-20 g / L agar powder to the YPD medium.
[0028] BMGY culture medium composition: yeast extract 10 g / L, peptone 20 g / L, glycerol 10 mL / L, YNB (amino acid-free yeast nitrogen source) 13.4 g / L, biotin 4 × 10⁻⁶ -4 g / L.
[0029] II. Methods for detecting xylanase activity
[0030] 1. Definition of enzyme activity: In a reaction system at 55°C and pH 5.5, the amount of enzyme that releases 1 μmol of reducing sugar (calculated as xylose) per minute from a 10 mg / mL birch xylan substrate solution is defined as one unit of xylanase activity, denoted by U.
[0031] 2. Sample pretreatment: The fermentation broth of the recombinant engineered bacteria after 72 h of shake-flask fermentation was centrifuged at 12000 rpm and 4℃ for 5 min, and the supernatant was collected as crude enzyme solution. The crude enzyme solution was serially diluted with acetate-sodium acetate buffer at pH 5.5 to ensure that the amount of reducing sugar generated by the diluted enzyme solution in the detection system was within the linear response range of the standard curve (0.1~1.0 μmol). The diluted enzyme solution was prepared and used immediately.
[0032] 3. Required reagents: Acetic acid-sodium acetate buffer (0.2 mol / L, pH 5.5), xylose standard stock solution (10 mmol / L), and a series of standard solutions of xylose standard working solution (concentrations of 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 mmol / L).
[0033] Substrate solution (10 mg / mL birch xylan): Using 0.2 mol / L acetate-sodium acetate buffer (pH 5.5) as solvent, accurately weigh 1.0 g of birch xylan, place it on a magnetic stirrer and stir at room temperature until completely dissolved, transfer to a 100 mL volumetric flask and make up to volume. Prepare fresh before use.
[0034] DNS reagent (3,5-dinitrosalicylic acid colorimetric reagent): Weigh 10.0 g of 3,5-dinitrosalicylic acid, 20.0 g of sodium hydroxide, 300.0 g of potassium sodium tartrate, 1.0 g of phenol, and 0.2 g of sodium sulfite. Add them sequentially to 800 mL of deionized water. Heat gently in a 50°C water bath and stir until completely dissolved. Cool to room temperature and bring the volume up to 1000 mL. Seal and let stand for 7 days in the dark, then filter. Store the filtrate in the dark. Shelf life is 1 month.
[0035] 4. Enzyme activity detection steps
[0036] Standard curve plotting: Take 6 clean colorimetric tubes, add 1.0 mL of a series of xylose standard working solutions to each, add 0.5 mL of 0.2 mol / L acetate-sodium acetate buffer (pH 5.5) to each, then add 2.0 mL of DNS reagent, heat in a boiling water bath for 5 min, quickly transfer to an ice water bath to cool to room temperature, and make up to 10 mL with deionized water; use 0.1 mL of deionized water + 0.5 mL of buffer + 2.0 mL of DNS reagent as a blank control, measure the absorbance (A) of each tube at a wavelength of 540 nm, plot the standard curve with xylose concentration (mmol / L) as the x-axis and absorbance as the y-axis, and fit the regression equation Y = aX + b (Y is absorbance, X is xylose concentration, a is the slope, and b is the intercept);
[0037] System preheating: Take 1.0 mL of serially diluted crude enzyme solution and 1.0 mL of 0.2 mol / L acetate-sodium acetate buffer (pH 5.5) and place them in a colorimetric tube. Place the tube in a 55℃ constant temperature water bath for 5 min to preheat the system to the set reaction temperature.
[0038] Blank control setup: The blank control group was prepared by replacing the diluted enzyme solution with 1.0 mL of 0.2 mol / L acetate-sodium acetate buffer (pH 5.5), and the rest of the operation was exactly the same as the experimental group;
[0039] Enzymatic reaction: Add 1.0 mL of 10 mg / mL birch xylan substrate solution rapidly to the preheated reaction system, shake vigorously to mix, and react precisely in a 55℃ constant temperature water bath for 20 min.
[0040] Reaction termination and color development: Add 2.0 mL of DNS reagent at the right time, immediately invert and mix well, heat in a boiling water bath for 5 min to terminate the enzymatic reaction and complete the color development, and then quickly place it in an ice water bath to cool to room temperature;
[0041] Absorbance measurement: The colorimetric reaction solution was diluted to 10 mL with deionized water, shaken well, and the absorbance values of the blank control group (A0) and the experimental group (A) were measured at a wavelength of 540 nm. The measured absorbance value ΔA = A - A0 was calculated.
[0042] Activity calculation: Substitute ΔA into the standard curve regression equation to calculate the amount of reducing sugar (calculated as xylose) produced in the reaction system (μmol); calculate the total enzyme activity of the crude enzyme solution using the following formula:
[0043] Total enzyme activity (U / mL) = (amount of xylose produced × dilution factor) / (reaction time × enzyme volume); where: the reaction time is 20 min and the enzyme volume is 1.0 mL.
[0044] Example 1 Screening of thermostable xylanase mutants
[0045] 1.1 Construction of mutant libraries
[0046] (a) Cloning and recovery of the xylanase gene (xyn): Genewiz Biotechnology Co., Ltd. synthesized the recombinant plasmid pUC-xyn containing the xylanase gene xyn. Using this plasmid as a template, the target gene xyn fragment was specifically amplified by PCR technology. The specific procedures are as follows:
[0047] PCR reaction system (50 μL): template plasmid pUC-xyn 2 μL (concentration 97 ng / μL, purity verified by Nanodrop), upstream primer xyn-F 2 μL, downstream primer xyn-R 2 μL (primer sequences detailed in Table 1, synthesized by Sangon Biotech Co., Ltd.), 2×Prime STAR Max DNA polymerase (containing dNTPs) 25 μL, sterile deionized water 19 μL. PCR amplification program: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, 30 cycles; final extension at 72℃ for 5 min to ensure complete extension of the target fragment. Product verification and recovery: 3 μL of PCR amplification product was verified by 1% agarose gel electrophoresis. The results showed that the target band size was 1233 bp (consistent with expectations, see table below). Figure 1 The target fragment was purified and recovered using the CWBIO agarose gel extraction kit. The concentration of the eluent was measured to be 103 ng / μL, and it was stored at -20℃ for later use.
[0048] Table 1 Primers and Sequences Primer name Sequence (5'-3') xyn-F <![CDATA[ GGTACC ATGGAAGCGAGCGTGGCG]]> xyn-R <![CDATA[ GCGGCCGC TTAGCTCAGGCCGGTCAC]]>
[0049] Note: The underlined bases are the Kpn I and Not I enzyme cleavage sites.
[0050] (b) Construction of recombinant expression plasmid pET27b-xyn
[0051] The recombinant plasmid pET27b-xyn was constructed using a double enzyme digestion-ligation method. The specific procedure is as follows:
[0052] Double digestion: Restriction endonucleases Kpn I and Not I (purchased from TaKaRa) were used to double digest the xyn gene fragment and pET27b vector, respectively. Target gene digestion system (30 μL): 10 μL xyn gene fragment, 1 μL Kpn I, 1 μL Not I, 3 μL 10×M digestion buffer, 15 μL sterile deionized water; reaction at 37℃ for 2 h. Vector digestion system (30 μL): 10 μL pET27b plasmid, 1 μL Kpn I, 1 μL Not I, 3 μL 10×M digestion buffer, 15 μL sterile deionized water; reaction at 37℃ for 2 h. Product verification: 5 μL of the digestion product was subjected to agarose gel electrophoresis to confirm that both the target gene and the vector were completely linearized, with no residual circular bands.
[0053] Purification and ligation: The double-digested xyn gene fragment and linearized pET27b vector were purified using a CWBIO nucleic acid purification kit to remove enzyme and buffer impurities. Subsequently, T4 DNA ligation was performed. The ligation system (10 μL) consisted of 4 μL of purified xyn fragment, 4 μL of linearized pET27b vector, 1 μL of T4 DNA ligase, and 1 μL of 10×T4 ligation buffer. The mixture was incubated at 16℃ for 4 h to achieve directional ligation of the target gene and the vector.
[0054] Transformation and Validation: The ligation product was introduced into *E. coli* DH5α competent cells (purchased from TransGen) using a heat shock transformation method. The specific procedure was as follows: after heat shock at 42℃ for 60 s, the cells were rapidly cooled in an ice bath for 2 min, 1 mL of sterile LB broth was added, and the cells were incubated at 37℃ with shaking at 200 rpm for 45 min to allow the cells to recover and express the resistance gene. 200 μL of the recovered bacterial culture was evenly spread onto LB agar plates containing 50 μg / mL kanamycin and incubated upside down overnight at 37℃. Single colonies were picked and inoculated into LB broth for expansion. Recombinant plasmids were extracted using a plasmid miniprep kit and sent to a sequencing company for sequence validation. After confirming that the *xyn* gene had no base mutations, frameshifts, or reverse ligation, the recombinant expression plasmid pET27b-xyn was obtained.
[0055] (c) Error-prone PCR construction of xylanase mutant gene library
[0056] By adding Mn to the PCR reaction system 2+ To reduce DNA polymerase fidelity, random mutations in the xyn gene are achieved, and a mutant library is constructed. The specific steps are as follows:
[0057] Error-prone PCR reaction system (50 μL): upstream primer xyn-F 2 μL, downstream primer xyn-R 2 μL, 2×PrimeSTAR Max DNA polymerase 25 μL, recombinant plasmid pET27b-xyn 1 μL (template concentration 50 ng / μL), 0.1 mM MnCl2 solution 5 μL (final concentration 0.01 mM, to induce random mutations through base mismatch), and sterile deionized water 15 μL. Error-prone PCR amplification program: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; final extension at 72℃ for 5 min to ensure complete extension of the amplified product.
[0058] Construction and transformation of mutant plasmids: The mutant gene fragment xyn* (xyn* represents the xylanase gene with random mutations) obtained by error-prone PCR amplification and the pET27b vector were used to construct the recombinant mutant plasmid pET27b-xyn* by Kpn I / Not I double digestion, purification and T4 DNA ligation as described above. The recombinant plasmid was introduced into Escherichia coli BL21(DE3) competent cells by heat shock transformation, plated on LB solid medium plates containing 50 μg / mL kanamycin, and incubated overnight at 37°C inverted to obtain a xylanase mutant gene library composed of a large number of random mutants (the recombinant strain was named BL21 / pET27b-xyn*).
[0059] 1.2 High-throughput screening method for thermostable xylanase (XYN) mutants in 96-well plates
[0060] Activation of recombinant strains: Single colonies of recombinant strain BL21 / pET27b-xyn* containing the xylanase mutant gene were picked from the plate with a sterile toothpick and inoculated into a 96-well plate containing 200 μL LB medium (containing 50 μg / mL kanamycin). The plates were incubated at 37°C and 200 rpm for 12 hours to obtain activated bacterial solution.
[0061] Fermentation for enzyme production: Using a multichannel pipette, aspirate 10 μL of activated bacterial culture and transfer it to a 96-well plate containing 500 μL LB medium (containing 50 μg / mL kanamycin). Incubate at 37°C and 200 rpm for 2 hours until OD reaches 50%. 600 ≈0.6-0.8; Add IPTG to a final concentration of 0.1mM to induce xylanase secretion, and continue culturing at 30℃ and 200 rpm for 16 hours.
[0062] Heat stress test: Centrifuge the deep well plate at 4000 rpm and 4℃ for 10 min, and carefully transfer 50 μL of supernatant enzyme solution to a new 96-well plate; place the plate in a constant temperature metal bath and incubate at 90℃ for 2 h to simulate industrial heat stress, and then quickly place it on ice to cool.
[0063] Enzyme activity assay (modified DNS colorimetric method): Add 100 μL of 1% birch xylan substrate (prepared with pH 6.0 acetate-sodium acetate buffer) to the heat-stressed enzyme solution, and react at 75℃ for 20 min; immediately add 150 μL of DNS reagent to stop the reaction, incubate in a dry oven at 100℃ for 20 min to complete color development, and cool to room temperature. Measure the absorbance (OD) at 540 nm using a microplate reader. 540 Set up a blank control (50 μL pH 6.0 buffer + 100 μL substrate + 150 μL DNS reagent, treated in the same steps).
[0064] Mutant screening: Based on the enzyme activity of the wild-type strain BL21 / pET-27b-xyn after heat resistance, the enzyme activity retention rate of each mutant was calculated (enzyme activity after heat resistance / enzyme activity before heat resistance × 100%). Strains with a retention rate significantly higher than that of the wild type (≥30%) were screened and marked as heat-resistant dominant candidate mutants.
[0065] Mutant identification: Plasmids of candidate strains were extracted using a plasmid miniprep kit, and mutation sites were verified by Sanger sequencing to confirm the thermostable dominant mutants of xylanase XYN (such as G38P, D160R, and E263R).
[0066] Example 2 Construction of thermostable xylanase combinatorial mutants
[0067] Based on the heat-resistant dominant single mutants (G38P, D160R, E263R) obtained in Example 1, double mutants and triple mutant combinations were constructed using site-directed mutagenesis to explore the synergistic heat-resistant effect of different mutation sites. The specific construction process is as follows:
[0068] Construction of the double mutant recombinant plasmid (pET27b-G38P / D160R)
[0069] Template and primer preparation: The recombinant plasmid pET27b-G38P (concentration 84 ng / μL), corresponding to the single mutant G38P verified by enzyme activity and thermostability, was extracted and used as the template for site-directed introduction of the D160R mutation. Specific primers D160R-F and D160R-R targeting the D160R mutation site were designed (primer sequences are detailed in Table 2). The middle region of the primers contains the base substitution corresponding to the mutation site to ensure the accuracy of site-directed mutagenesis. Site-directed mutagenesis PCR amplification: Using pET27b-G38P as a template, the complete plasmid containing the D160R mutation was amplified by PCR. The reaction system (50 μL) consisted of: 2 μL template plasmid pET27b-G38P, 2 μL primer D160R-F, 2 μL primer D160R-R, 25 μL 2×Prime STAR Max DNA polymerase, and 19 μL sterile deionized water. The PCR amplification program was optimized as follows: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 6 min, for 30 cycles; and finally 72℃ extension for 5 min to ensure smooth ends of the amplification product.
[0070] Template plasmid degradation and product processing: Since the PCR template is a methylated original plasmid, Dpn I restriction endonuclease (which recognizes methylated DNA) was used to specifically degrade the template plasmid and eliminate background interference. Reaction system (10 μL): 5 μL PCR amplification product, 1 μL Dpn I endonuclease, 1 μL 10×Cutsmart buffer, 3 μL sterile deionized water, incubated at 37℃ for 1 h; after enzyme digestion, the reaction solution was placed in a 65℃ water bath for 10 min to inactivate Dpn I and avoid residual enzyme affecting subsequent transformations.
[0071] Transformation and Validation: 10 μL of the PCR product treated with Dpn I was introduced into *E. coli* DH5α competent cells (purchased from TransGen) using the heat shock transformation method: heat shock at 42℃ for 60 s, followed by cooling on ice for 2 min, adding 1 mL of LB liquid medium, and incubating at 37℃ with shaking at 200 rpm for 45 min; 200 μL of the revived bacterial culture was plated on LB solid medium plates containing 50 μg / mL kanamycin and incubated upside down at 37℃ overnight. Single colonies were picked for colony PCR validation. After amplification of positive clones, plasmids were extracted and sent to a sequencing company for full-length sequence validation. After confirming that the G38P mutation site was preserved and the D160R mutation site was accurately introduced, without other random mutations or frameshifts, the double mutant recombinant plasmid pET27b-G38P / D160R was obtained.
[0072] Using the same site-directed mutagenesis strategy as described above, the remaining double mutants and triple mutants were constructed respectively.
[0073] Using pET27b-G38P as a template, PCR amplification, Dpn I treatment, transformation, and sequencing verification were performed using specific primers E263R-F / R (containing E263R mutation site base substitution) to obtain the double mutant recombinant plasmid pET27b-G38P / E263R.
[0074] Using pET27b-D160R as a template, site-directed mutagenesis was performed using primers E263R-F / R to construct and validate the double mutant recombinant plasmid pET27b-D160R / E263R.
[0075] Using the constructed double mutant recombinant plasmid pET27b-G38P / D160R as a template, the E263R mutation was introduced using primers E263R-F / R. After PCR amplification, Dpn I template degradation, transformation, and sequence verification, the triple mutant recombinant plasmid pET27b-G38P / D160R / E263R was obtained.
[0076] The sequence information of all the above site-directed mutagenesis primers is detailed in Table 2.
[0077] Table 2 Primers and Sequences Primer name Sequence (5'-3') G38P-F CTGATTCGCGGCTATCCCGGCATTAACCATCCG G38P-R CGGATGGTTAATGCCGGGATAGCCGCGAATCAG D160R-F GTGCAGAACGAACCGCGTTATGCGCATACCTG D160R-R CAGGTATGCGCATAACGCGGTTCGTTCTGCAC E263R-F GCGGATCTGTGGCCGCGTGCGCTGGAAGTGAG E263R-R CTCACTTCCAGCGCACGCGGCCACAGATCCGC
[0078] Example 3 Construction of recombinant engineered bacteria with xylanase mutant
[0079] 3.1 Construction of recombinant plasmid pPICZAα-xyn
[0080] (1) Vector and target gene preparation: The commercial Pichia pastoris vector pPICZAα was purchased from Invitrogen (catalog number: V19520). This vector contains a bleomycin (Zeocin) resistance selection marker and an AOX1 promoter, which is adapted for efficient expression of exogenous genes. The target gene xyn is a codon-optimized xylanase gene, obtained from previous cloning (see Example 1 for details).
[0081] (2) Double digestion and purification: The xyn gene fragment and pPICZAα vector were double-digested using restriction endonucleases Kpn I and Not I (purchased from TaKaRa) to achieve directional cloning. The specific operation is as follows:
[0082] Target gene enzyme digestion system (30 μL): xyn gene fragment 10 μL, Kpn I 1 μL, Not I 1 μL, 10×M enzyme digestion buffer 3 μL, 10×BSA (bovine serum albumin) 3 μL, sterile deionized water 12 μL, incubated at 37℃ for 2 h.
[0083] Vector digestion system (30 μL): 10 μL pPICZAα plasmid, 1 μL Kpn I, 1 μL Not I, 3 μL 10×M digestion buffer, 3 μL 10×BSA, 12 μL sterile deionized water, and reacted at 37℃ in a water bath for 2 h.
[0084] Validation and purification of enzyme digestion products: 5 μL of enzyme digestion products were subjected to 1% agarose gel electrophoresis to confirm that the xyn gene fragment (expected size 1233 bp) and pPICZAα vector were completely linearized, with no circular vector or undigested fragments remaining.
[0085] The enzyme digestion products were purified and recovered using the CWBIO nucleic acid purification kit to remove impurities such as enzymes, buffer, and BSA. The products were eluted with 30 μL of sterile deionized water, and the concentration of the purified product was 89 ng / μL as determined by Nanodrop. The products were stored at -20℃ for later use.
[0086] (3) T4 DNA ligation reaction: The purified xyn gene fragment and the linearized pPICZAα vector were directionally ligated using T4 DNA ligase to construct the recombinant plasmid pPICZAα-xyn. Ligation system (10 μL): 4 μL of purified xyn gene fragment, 4 μL of linearized pPICZAα vector, 1 μL of T4 DNA ligase (purchased from Thermo Scientific), and 1 μL of 10×T4 ligation buffer. The mixture was incubated at 16℃ for 4 h to achieve covalent ligation of the target gene and the vector.
[0087] (4) Transformation and sequencing verification: Take 10 μL of the ligation product and introduce it into E. coli DH5α competent cells using the heat shock method: After heat shock treatment at 42℃ for 60 seconds, quickly transfer to an ice bath for 2 min; add 1 mL of sterile LB liquid medium and culture in a constant temperature shaking incubator at 37℃ and 200 rpm for 45 min to revive the cells and express the Zeocin resistance gene; take 200 μL of the revived bacterial solution and spread it evenly on a YPD solid medium plate containing 100 μg / mL Zeocin, and incubate it upside down at 37℃ overnight. Pick a single colony with a regular morphology and a diameter of 1~2 mm from the plate and inoculate it into LB liquid medium containing 100 μg / mL Zeocin for expansion culture. Use a plasmid mini-prep kit to extract the recombinant plasmid and send it to a sequencing company for full-length sequence verification. After confirming that the xyn gene has no base mutations, frameshifts, and reverse ligation, the recombinant plasmid pPICZAα-xyn is obtained.
[0088] 3.2 Construction of recombinant plasmids containing xylanase mutants
[0089] Based on the construction method of the recombinant plasmid pPICZAα-xyn, using the validated xylanase single mutant genes (G38P, D160R, E263R) and combined mutant genes (G38P / D160R, G38P / E263R, D160R / E263R, G38P / D160R / E263R) as target fragments, after Kpn I / Not I double digestion, purification, T4 DNA ligation, transformation into DH5α competent cells, and sequence verification, seven mutant recombinant plasmids were constructed, as follows:
[0090] Single mutant plasmids: T1: pPICZAα-G38P, T2: pPICZAα-D160R, T3: pPICZAα-E263R; Double mutant plasmids: T4: pPICZAα-G38P / D160R, T5: pPICZAα-G38P / E263R, T6: pPICZAα-D160R / E263R; Triple mutant plasmid T7: pPICZAα-G38P / D160R / E263R.
[0091] 3.3 Construction of Pichia pastoris GS115 recombinant engineered strain
[0092] (1) Linearization, purification and concentration of integrative plasmid pPICZAα-xyn
[0093] Directed linearization digestion: pPICZAα-xyn plasmid (concentration 230 ng / μL) was digested with Sal I restriction endonuclease. The reaction system (50 μL) consisted of 20 μL plasmid, 5 μL 10× restriction enzyme buffer, 2 μL restriction endonuclease, and 23 μL sterile deionized water. The plasmid was digested at 37℃ for 3 h. After digestion, 5 μL was subjected to 1% agarose gel electrophoresis to confirm complete linearization. The linearized plasmid was purified using a DNA gel extraction kit to remove enzymes, buffer, and other impurities. It was eluted with 30 μL sterile deionized water at a concentration of 152 ng / μL. 3 μL of 3 mol / L sodium acetate (pH 5.2) and 90 μL of pre-chilled anhydrous ethanol were added to the 30 μL purified linearized plasmid. The mixture was gently inverted and incubated at -20℃ for 30 min. The mixture was centrifuged at 12000 rpm and 4℃ for 15 min, and the supernatant was discarded. The precipitate was washed with 100 μL of pre-chilled 70% ethanol and centrifuged at 12000 rpm and 4℃ for 5 min. min, discard the supernatant; invert and air dry the precipitate in a clean bench, add 10 μL of sterile deionized water to dissolve, store at 4℃ for short-term use or at -20℃ for long-term use.
[0094] (2) Electroporation of Pichia pastoris GS115 competent cells
[0095] Remove the 0.2 cm electroporation cup pre-stored at -20℃ and soak it in 75% sterile ethanol for 10 min; pour out the ethanol in a laminar flow hood, rinse three times with sterile deionized water, and finally blot the inner wall dry with sterile filter paper, then pre-cool it in ice for 30 min; prepare 1 mol / L sorbitol solution and YPD liquid culture medium in advance, mix them at a 1:1 (v / v) ratio before use to prepare sorbitol resuscitation solution; take 100 μL (OD) of freshly prepared Pichia pastoris GS115 competent cells. 600 =0.4~0.6 (optimal viability), add 10 μL of the above linearized plasmid solution (total plasmid 2 μg), gently mix by pipetting, incubate on ice for 10 min, and slowly transfer the mixture into a pre-cooled electroporation cuvette, avoiding the formation of air bubbles; wipe the outer wall of the electroporation cuvette dry with sterile filter paper, place it in the electroporator, set the electroporation parameters: voltage 2300 V, capacitance 25 μF, resistance 200 Ω, start the electroporation, and record the electroporation time. After the electroporation is completed, immediately add 1 mL of sorbitol-YPD resuscitation solution preheated to 28℃ to the electroporation cuvette, gently mix by pipetting with a sterile pipette tip, transfer to a 1.5 mL sterile centrifuge tube, and incubate at 28℃ and 200 rpm for 2.5 h with constant temperature shaking. Take 100 μL, 200 μL, and 500 μL of the incubated bacterial solution and spread them on a plate containing 100 μg / mL... Zeocin YPD solid culture medium plates were evenly spread using a sterile spreader; the plates were then inverted and incubated at 28°C in the dark for 48 h. Three single colonies were selected and colony PCR was performed using primers xyn-F and xyn-R for verification. The results are as follows. Figure 2 As shown, the size of the xyn gene in the PCR product is as expected, which is GS / pPICZAα-xyn.
[0096] Other xylanase mutant recombinant plasmids T1, T2, T3, T4, T5, T6, and T7 were obtained by electroporation using the same methods and steps as described above, thus obtaining recombinant engineered bacteria GS / T1, GS / T2, GS / T3, GS / T4, GS / T5, GS / T6, and GS / T7 with the target gene xyn integrated into their genome.
[0097] Example 4: Fermentation and Enzyme Expression of Recombinant Engineered Bacteria
[0098] This embodiment focuses on the fermentation of recombinant Pichia pastoris engineered strains GS / T1~GS / T7 to systematically examine the expression efficiency of the fermentation enzyme solution of the recombinant engineered strains. The specific operation is as follows:
[0099] Resuscitation and activation of recombinant strains: The cryovials of recombinant engineered bacteria GS / T1, GS / T2, GS / T3, GS / T4, GS / T5, GS / T6, and GS / T7 were taken out from the -80℃ ultra-low temperature freezer. Under aseptic conditions, they were inoculated onto YPD solid medium plates containing 100 μg / mL Zeocin resistance using the streak plating method. The plates were then inverted and placed in a 28℃ constant temperature incubator for 48 h to ensure the purity and viability of the strains and obtain single colonies.
[0100] Seed culture preparation: For each recombinant engineered bacterium, select morphologically uniform single colonies with a diameter of 1-2 mm, and inoculate them into test tubes containing 5 mL of YPD liquid medium containing 100 μg / mL Zeocin. Incubate at 28℃ and 200 rpm for 48 h until the bacterial culture OD reaches the target value. 600 A value of 2.0 to 3.0 indicates the availability of highly active seed liquid.
[0101] Shake-flask fermentation and recombinase expression: 1 mL of seed culture in the logarithmic growth phase was aspirated using a sterile pipette and transferred to 500 mL Erlenmeyer flasks containing 100 mL of BMGY medium (filling the flasks to 20% of their capacity to ensure adequate aeration). 1% (v / v) methanol was added every 24 h, and the flasks were continuously cultured at 28℃ and 200 rpm in a constant temperature shaking incubator for 72 h. During this period, samples were taken regularly to monitor the growth status of the bacterial culture.
[0102] Strain growth status detection: After fermentation, the OD of the fermentation broth of each strain was measured using a UV-Vis spectrophotometer. 600 The test results showed that the OD values of the recombinant engineered bacteria from GS / T1 to GS / T7 were... 600 The values ranged from 16.2 to 16.8, with an intra-group difference of less than 5%, indicating that the recombinant engineered bacteria had basically the same proliferation capacity in BMGY medium, thus eliminating the interference of growth differences on enzyme expression levels.
[0103] Fermentation broth treatment and crude enzyme solution preparation: The fermentation broth of each strain was dispensed into 1.5 mL sterile centrifuge tubes. 1 mL of fermentation broth was taken from each tube and centrifuged at 12000 rpm and 4℃ for 5 min. The supernatant was carefully aspirated, which is the crude enzyme solution containing xylanase. It was stored at 4℃ for later use in subsequent detection of enzyme activity, heat resistance and other indicators.
[0104] Example 5: Test of the heat resistance of xylanase mutants
[0105] After centrifugation, the fermentation broth of each of the above recombinant engineered bacteria (GS / T1~GS / T7) was centrifuged to obtain the supernatant containing crude xylanase for experiments.
[0106] Experimental group: 0.5 mL of crude enzyme solution was placed in a centrifuge tube and precisely treated in a constant temperature water bath at 0℃, 80℃, 90℃, and 100℃ for 2 h, then transferred to an ice bath for rapid cooling to room temperature; 0℃ served as the control group. The xylanase activity of the experimental and control groups was measured using the optimized enzyme activity assay method described above. The residual enzyme activity of the experimental group was calculated (residual enzyme activity = experimental group enzyme activity / control group enzyme activity × 100%). The thermostability differences of xylanase expressed by the recombinant engineered bacteria GS / T1~GS / T7 were compared using the residual enzyme activity values. The results are shown in Table 3. Figure 3 As shown.
[0107] Table 3. Thermoresistance of different xylanases
[0108] Table 3 and Figure 3 The results showed that the xylanase solutions obtained from fermentation by recombinant strains containing different xylanase mutant genes exhibited significant differences in their thermostable properties. Specifically, after treatment at 80℃ for 2 h, the residual enzyme activity of xylanase from single-point mutants (G38P, D160R, E263R) was greater than 90%, while the residual enzyme activity of xylanase from two-point and three-point combination mutants (G38P / D160R, G38P / E263R, D160R / E263R, G38P / D160R / E263R) was greater than 95%, whereas the residual enzyme activity of wild-type xylanase was only 54.4%. The residual enzyme activity of each enzyme solution after treatment at 90℃ for 2 h was significantly higher than that of wild-type xylanase. After 2 hours of treatment at 100°C, the residual activity of xylanase in single-point mutants was greater than 70%, in double-point mutants it was greater than 80%, and in triple-point mutants it was greater than 90%, while the wild type was only 27.6%.
[0109] In summary, the xylanase mutant provided by this invention has significantly improved heat resistance compared to wild-type xylanase, which helps to reduce the production cost of the enzyme and promote its widespread application in the industrial field.
[0110] The above are merely preferred embodiments of the present invention and do not limit the scope of the patent. All equivalent changes and modifications made within the scope of the present invention should still fall within the scope of the present invention.
Claims
1. A xylanase mutant with improved heat resistance, characterized in that, The amino acid sequence of the xylanase mutant is shown in SEQ ID No:
3.
2. The method for preparing the heat-resistant xylanase mutant according to claim 1, characterized in that, It was obtained by simultaneously modifying wild-type xylanase with the amino acid sequence shown in SEQ ID No: 1 with G38P, D160R, and E263R.
3. The gene encoding the xylanase mutant with improved heat resistance as described in claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID No:
4.
4. A recombinant expression vector containing the gene of claim 3, characterized in that, The vector is the pPICZAα plasmid, and the recombinant expression vector can drive the efficient expression of the xylanase mutant.
5. A recombinant engineered bacterium, characterized in that, Pichia pastoris GS115 containing the recombinant expression vector of claim 4.
6. A fermentation broth containing a heat-resistant xylanase mutant, characterized in that, After the recombinant engineered bacteria described in claim 5 were activated by inoculating them into YPD medium containing bleomycin, they were transferred to BMGY medium and cultured at 25-30°C and 100-250 rpm for 48-96 h.
7. The application of one or more of the xylanase mutant of claim 1, the recombinant engineered bacteria of claim 5, and the fermentation broth of claim 6 in the hydrolysis of xylan.
8. The application as described in claim 7, characterized in that, This includes fields such as food processing, paper bleaching, and textile fiber finishing.
9. A feed additive, characterized in that, It contains one or a combination of the xylanase mutant of claim 1, the recombinant engineered bacteria of claim 5, and the fermentation broth of claim 6.