Tomato leafminer lethal gene chitinase ta chi and dsrna based on silencing technology

Abstract

The application discloses a tomato leaf roller lethal gene fragment chitinase TaChi and dsRNA based on a gene silencing technology, and relates to the field of agricultural biotechnology; the application provides an isolated nucleic acid molecule, wherein the nucleic acid molecule comprises a nucleotide sequence shown in SEQ ID NO.1, or a nucleotide sequence having at least 90% identity with the sequence shown in SEQ ID NO.1 and capable of being used for preparing a nucleotide sequence for inhibiting expression of a tomato leaf roller chitinase gene. The application can make the mortality of the tomato leaf roller reach 73.33% by applying the dsRNA prepared by using the tomato leaf roller lethal gene fragment chitinase TaChi shown in SEQ ID NO.1 to the tomato leaf roller, so that a new strategy for controlling pests by using RNA interference technology is established.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to the chitinase TaChi and its dsRNA, a lethal gene fragment of the tomato leafminer moth based on gene silencing technology. Background Technology

[0002] The tomato leafminer (Tuta absoluta) is a significant international quarantine pest with a wide host range, feeding on various Solanaceae plants such as tomatoes, eggplants, peppers, and tobacco. It possesses a high reproductive potential with multiple overlapping generations per year and a strong ability to spread, causing large-scale tomato yield reductions during outbreaks and seriously threatening the healthy and sustainable development of the global tomato industry. Currently, the control of the tomato leafminer mainly relies on chemical pesticides, which can lead to environmental pollution and agricultural product safety issues. Therefore, identifying new targets for tomato leafminer control using molecular biology techniques is urgently needed to control its spread.

[0003] RNAi-based pest control measures show great promise for development. Currently, significant progress has been made in the feasibility of applying RNAi to pest control, such as RNAi-resistant transgenic plants and RNAi pest interference agents. However, many factors need to be considered, such as insect RNAi efficiency, dsRNA safety, and dsRNA persistence in the environment. Selecting highly effective target genes and ensuring the environmental safety of dsRNA are key factors for the successful application of RNA interference technology in pest control. This invention aims to identify RNAi target genes with high lethality against the tomato leafminer and utilize dsRNA expressing the target gene in bacterial culture to control the tomato leafminer, providing a new control strategy for establishing new pest control methods using RNA interference technology. Summary of the Invention

[0004] The purpose of this invention is to address the aforementioned shortcomings of existing technologies by providing a new solution for the control of the tomato leafminer (Tuta absoluta) by offering a chitinase TaChi and its dsRNA. Specifically, this invention provides the following technical solution:

[0005] On one hand, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence as shown in SEQ ID NO.1.

[0006] In another aspect, the present invention provides a dsRNA that can inhibit the expression of a nucleotide sequence as shown in SEQ ID NO.1.

[0007] Specifically, the sequence of the dsRNA is shown in SEQ ID NO.2.

[0008] In another aspect, the present invention provides a recombinant expression vector comprising a nucleic acid molecule operatively linked to the expression regulation.

[0009] In another aspect, the present invention provides a host cell comprising the recombinant expression vector described above.

[0010] In another aspect, the present invention provides the application of the aforementioned nucleic acid molecule, the aforementioned dsRNA, the aforementioned recombinant expression vector, and the aforementioned host cell in the preparation of an insecticide for controlling tomato leafminer.

[0011] In another aspect, the present invention provides a composition for controlling tomato leafminer, comprising an effective amount of the dsRNA and an agriculturally acceptable vector.

[0012] In another aspect, the present invention provides a method for controlling tomato leafminer by applying an effective amount of the composition to the tomato leafminer.

[0013] In another aspect, the present invention provides a method for preparing the dsRNA, characterized by comprising the following steps:

[0014] (1) Design and synthesize specific primer pairs to amplify the sequence shown in SEQ ID NO.1;

[0015] (2) Using DNA containing the sequence shown in SEQ ID NO.1 as a template, PCR amplification was performed using the primer pair from step (1) to obtain a DNA template with T7 promoters at both ends;

[0016] (3) Using the DNA template obtained in step (2), dsRNA was synthesized by in vitro transcription;

[0017] (4) Recover and purify the dsRNA obtained in step (3).

[0018] The primer pair sequences described in step (1) are shown in SEQ ID NO.3 and 4.

[0019] The beneficial effects of this invention are:

[0020] This invention utilizes RNAi technology to silence the chitinase TaChi gene, which has a significant lethal effect on the tomato leafminer, indicating that this gene can serve as an effective target for controlling the tomato leafminer pest using RNA interference technology.

[0021] The chitinase TaChi gene dsRNA synthesized in this invention can effectively silence the chitinase TaChi gene, better resist RNase degradation, and has a low synthesis cost, making it convenient for large-scale experiments or commercial use. Attached Figure Description

[0022] Figure 1 This is an electrophoresis image of the PCR product of the Tachi gene.

[0023] Figure 2 This is a statistical graph showing the expression levels of the TaChi gene in the tomato leafminer at different time points after dsRNA administration.

[0024] Figure 3 This is a statistical chart showing the mortality rate of the Tachi gene against the tomato leafminer moth. Detailed Implementation

[0025] To make the above-mentioned objectives, features and advantages of this application more apparent and understandable, the present invention will be further described in detail below with reference to specific embodiments.

[0026] The lethal gene fragment TaChi of the tomato leafminer is shown in SEQ ID NO.1.

[0027] The dsRNA sequence of the chitinase TaChi, a lethal gene fragment of the tomato leafminer moth, is shown in SEQ ID NO.2.

[0028] Example 1: Cloning method for Tachi gene fragments

[0029] 1. Cloning method for the Tachi gene fragment:

[0030] (1) Collect mixed samples of different developmental stages of the tomato leafminer moth and extract total RNA using the TRIzol method;

[0031] (2) Synthesis of the first strand of cDNA;

[0032] (3) Gene fragment sequences were obtained from the transcriptome of the tomato leafminer. After homology comparison at http: / / www.ncbi.nlm.nih.gov / , the sequence was predicted to be the Tachi gene. P1 and P2 were designed using Primer Premier 5.0 software and amplified by RT-PCR.

[0033] Upstream primer (P1): CTTTTCCGTGGTGCCTCTTG (SEQ ID NO.3);

[0034] Downstream primer (P2): GTACAGCCCTCTGAGCACG (SEQ ID NO.4);

[0035] PCR conditions were: denaturation at 94℃ for 2 min, 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 30 sec, 35 cycles, extension at 72℃;

[0036] PCR reaction system (50 μL): 5 μL reaction buffer, Mg2+ 4 μL of dNTPs, 2 μL of cDNA template, 1 μL of upstream primer P1, 1 μL of downstream primer P2, 0.5 μL of R-Tag enzyme, and 32.5 μL of ddH2O; total volume 50 μL.

[0037] (4) The PCR products were separated by agarose gel electrophoresis, and the target DNA fragments were recovered;

[0038] (5) The recovered target fragment was inserted into the pEASY-T3 vector under the action of T3 ligase, transformed into Escherichia coli T1, plated on LB medium containing X-gal 0.02 g / ml, IPTG 0.2 g / ml and ampicillin 50 ng / ml, and cultured at 37°C overnight;

[0039] (6) Positive recombinants were screened by selecting white single colonies;

[0040] (7) The recombinant was amplified using LB medium containing ampicillin, and the cloning plasmid was extracted;

[0041] (8) Sequencing was performed using a fully automated sequencer (completed by Shanghai Sangon Biotech Co., Ltd.) to obtain the Tachi gene fragment with the nucleotide sequence shown in Tabs018541.1 TaChi.

[0042] like Figure 1 As shown, the full cDNA sequence of the chitinase TaChi gene of the tomato leafminer was obtained by PCR technology. The amplified product was detected by 1.5g agarose gel electrophoresis. The results showed that the band of the chitinase TaChi gene was about 500bp, with the left lane being the marker and the right lane being TaChi.

[0043] Example 2: dsRNA Synthesis and Recovery

[0044] (1) Based on the validated TaChi gene fragment sequence, upstream and downstream primers P3 and P4 were designed using Primer Premier 5.0 software;

[0045] Upstream primer (P3): TAATACGACTCACTATAGGG CTTTTCCGTGGTGCCTCTTG

[0046] Downstream primer (P4): TAATACGACTCACTATAGGG GTACAGCCCTCTGAGCACG

[0047] Note: Underlined sections indicate the T7 RNA polymerase promoter sequence. Primers without underlined sections are used to amplify the target gene sequence, while primers with underlined sections are used for in vitro synthesis of dsRNA.

[0048] The PCR system consisted of: 5 μL reaction buffer, Mg 2+ 4 μL of dNTPs, 2 μL of cDNA template, 2 μL of upstream primer P3, 2 μL of downstream primer P4, 0.25 μL of Ex Tap enzyme, and 0.75 μL of ddH2O; total volume 50 μL.

[0049] PCR conditions: denaturation at 94℃ for 2 min, followed by 38 cycles of denaturation at 94℃ for 30 sec, 60℃ for 30 sec, and 72℃ for 30 sec, and extension at 72℃.

[0050] (2) The PCR products were separated by 1% low-melting-point agarose gel electrophoresis and observed under ultraviolet light. The results are shown in the figure. Figure 1 Its sequence can be found in dsRNA Tachi.

[0051] (3) Recovery was performed using the Promega Wizard® SV Gel and PCR Clean-Up System kit, as follows:

[0052] ① The separated target fragment is cut into pieces and placed into a 1.5 ml microcentrifuge tube that has been weighed (a). It is then weighed again (b). The weight of the cut gel is calculated from ba.

[0053] ② Add 10 μL of Membrane Binding Solution for every 10 mg of gel. The gel weight should not exceed 350 mg.

[0054] ③ Place the gel in a water bath at 50–65℃ for 10 minutes or until the gel is completely melted;

[0055] ④ Place the filter tube from the kit into the matching collection tube, transfer the melted gel liquid into the filter tube, and let it stand at room temperature for 1 minute;

[0056] ⑤ Centrifuge at 16,000 xg (14,000 rpm) for 1 min, and discard the liquid in the collection tube;

[0057] ⑥ Add 700µl of Membrane Wash Solution (with 95% ethanol added), centrifuge at 16,000 xg (14,000rpm) for 1 min, and discard the liquid in the collection tube;

[0058] ⑦ Add 500µl of Membrane Wash Solution (with 95% ethanol added), centrifuge at 16,000 xg (14,000rpm) for 5 min, and discard the liquid in the collection tube;

[0059] ⑧ Run the machine idle for 1 minute without adding liquid;

[0060] ⑨ Transfer the filter tube to a 1.5 ml microcentrifuge tube, add 50 µl of Nuclease-Free Water, incubate at room temperature for 1 min, and centrifuge at 16,000 x g (14,000 rpm) for 1 min;

[0061] ⑩ The collected DNA product should be stored at 4℃ or –20℃. This will allow for the recovery of the synthesized dsRNA.

[0062] Example 3: Lethal effect of dsRNA on tomato leafminer

[0063] (1) After installing the oil-filled injection needle at the designated position on the Nanoliter 2010 fully automated microinjector (WPI, USA), start the device to draw up the dsRNA solution containing a trace amount of artificial pigment bromophenol blue;

[0064] (2) Randomly select 3rd instar larvae of tomato leafminer that are of uniform size and development and place them on your fingertip. Use your thumb and forefinger to gently fix them in place. Use a magnifying glass to inject 500 ng dsRNA into the insect body. The specific injection point is the dorsal blood vessel in the second intersegment of the back.

[0065] (3) The negative control group was injected with an equal amount of dsRNA containing the GFP gene of the tomato leafminer. Each of the treatment and control groups was injected with 30 test insects, and three biological replicates were set up.

[0066] (4) After the test insects have been injected, they should be immediately transferred to a small plastic box with holes punched in it. Sterile soil should be laid in the box and an appropriate amount of water should be sprayed on it before placing it in an artificial climate chamber for normal rearing.

[0067] (6) Twenty tomato leafminer moths were randomly selected and injected with dsRNA for 24 h, 48 h and 72 h for RNA extraction and first-strand cDNA synthesis. The interference efficiency of the target gene was detected by qPCR.

[0068] like Figure 2 As shown, RNAi technology was used to silence the TaChi gene. It was found that after injection of dsTaChi, the expression level of the TaChi gene decreased by 71.13%, 86.37%, and 52.34% at 24, 48, and 72 h, respectively, compared with the control.

[0069] Mortality rates were recorded every 24 hours for three consecutive days. Results are shown below. Figure 3 Injecting the dsRNA of the lethal chitin gene TaChi can achieve a very good lethal effect.

[0070] In summary, the corrected mortality rates at various concentrations obtained after three independent replicates of dsRNA application to the tomato leafminer are as follows: Figure 3 As shown, injecting the tomato leafminer with dsRNA from this gene fragment can reduce the mortality rate of the tomato leafminer to 53.33%, 58.33%, and 73.33% at 24, 48, and 72 hours, respectively. The sequence information and toxicity data provided by this invention lay an important foundation for constructing a green control system for tomato leafminers based on RNA interference. Compared with traditional chemical pesticides, RNAi biopesticides based on this gene fragment have the following advantages: high species specificity, designed for specific gene sequences of tomato leafminers, and high safety for non-target organisms; environmental friendliness, as dsRNA is easily degraded in the natural environment without residual pollution; and low risk of resistance development, as it acts on essential genes of pests and has a relatively low risk of resistance evolution.

Claims

1. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule contains a nucleotide sequence as shown in SEQ ID NO.

1.

2. A dsRNA, characterized in that, The dsRNA can suppress the expression of the nucleotide sequence shown in SEQ ID NO.

1.

3. The dsRNA according to claim 2, characterized in that, The sequence of the dsRNA is shown in SEQ ID NO.

2.

4. A recombinant expression vector, characterized in that, The vector comprises a nucleic acid molecule operatively linked to expression regulation as described in claim 1.

5. A host cell, characterized in that, The host cell comprises the recombinant expression vector of claim 4.

6. The use of the nucleic acid molecule of claim 1, the dsRNA of claim 2 or 3, the recombinant expression vector of claim 4, or the host cell of claim 5 in the preparation of an insecticide for controlling tomato leafminer.

7. A composition for controlling tomato leafminer, characterized in that, It contains an effective amount of the dsRNA as described in claim 2 or 3, and an agriculturally acceptable vector.

8. A method for controlling tomato leafminer, characterized in that, Apply an effective amount of the composition of claim 7 to the tomato leafminer.

9. A method for preparing the dsRNA of claim 2 or 3, characterized in that, Includes the following steps: (1) Design and synthesize specific primer pairs to amplify the sequence shown in SEQ ID NO.1; (2) Using DNA containing the sequence shown in SEQ ID NO.1 as a template, PCR amplification was performed using the primer pair from step (1) to obtain a DNA template with T7 promoters at both ends; (3) Using the DNA template obtained in step (2), dsRNA was synthesized by in vitro transcription; (4) Recover and purify the dsRNA obtained in step (3).

10. The method according to claim 9, characterized in that, The primer pair sequences described in step (1) are shown in SEQ ID NO. 3 and 4.

Images