Use of sodium-calcium transporter slncl2.2 in tomato salt stress and method

By overexpressing or knocking out the SlNCL2.2 gene in tomatoes, salt tolerance of tomatoes was regulated, which solved the problem of unclear role of sodium-calcium transporters in tomatoes under salt stress in existing technologies, and significantly improved the salt tolerance and growth capacity of tomatoes.

CN122168680APending Publication Date: 2026-06-09FOSHAN UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FOSHAN UNIVERSITY
Filing Date
2026-05-06
Publication Date
2026-06-09

Smart Images

  • Figure CN122168680A_ABST
    Figure CN122168680A_ABST
Patent Text Reader

Abstract

This invention provides an application and method for the sodium-calcium transporter SlNCL2.2 in tomato salt stress. The invention involves constructing an SlNCL2.2 gene overexpression vector [pBWA(V)HS-TS-21 OE-N2.2] and an SlNCL2.2 gene knockout editing vector [zmpl-LACas-2]. These vectors are then introduced into Agrobacterium-mediated transformation into Agrobacterium strain GV3101. Tomato cotyledons are used as explants to transform the GV3101 strain into salt-tolerant tomato TS-21, thereby obtaining SlNCL2.2 transgenic overexpression and gene knockout materials. The role of the sodium-calcium transporter SlNCL2.2 in tomato salt stress is comprehensively analyzed by measuring phenotypic indicators such as plant height and root length, and physiological and biochemical indicators such as proline, POD, and ion content. Under salt stress, overexpression of the SlNCL2.2 gene significantly promoted tomato growth and enhanced the tolerance of tomato seedlings to salt stress compared with wild-type TS-21. Conversely, under salt stress, knocking out the SlNCL2.2 gene led to tomatoes being more sensitive to salt stress and having reduced salt tolerance compared with wild-type TS-21.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application and method of a sodium-calcium transporter SlNCL2.2 in tomato salt stress. Background Technology

[0002] Salt stress is one of the major abiotic stressors that limit plant growth and development and reduce crop yield and quality. With the increasing severity of global soil salinization, breeding salt-tolerant crop varieties has become an important direction for sustainable agricultural development. Tomato (Solanum lycopersicum) is a moderately salt-sensitive crop; when grown in saline soils, its root activity, photosynthesis, and fruit yield are significantly inhibited. Therefore, identifying and utilizing key salt-tolerant genes in tomatoes has significant theoretical and applied value.

[0003] Sodium-calcium exchangers (NCXs) belong to the cation / calcium reverse transport group. 2+ The inverse transporter (CaCA) superfamily is a class of transmembrane transport proteins widely found in animals and plants. These proteins mediate Na+ transport... + and Ca 2+ Transmembrane flow maintains intracellular Ca2+. 2+ Homeostasis and ion balance. In plants, AtNCL in Arabidopsis thaliana has been shown to possess NCX functional characteristics and participate in salt stress response; its expression level is induced by salt stress and regulates Na+. + and Ca 2+ Salt damage can be mitigated through differentiation or efflux. However, the specific mechanisms by which NCX family members regulate salt tolerance in plants remain unclear, especially in tomatoes, an important economic crop, where functional studies of related genes are still very limited.

[0004] Application number 202410470125.4 specifically discloses the application of the sodium-calcium transporter SlNCL12 in tomato salt stress, showing that SlNCL12 positively regulates tomato salt tolerance. This invention constructs an SlNCL12 gene overexpression vector [pBWA(V)HS]. TS 21OE [N12], and constructed the SlNCL12 gene knockout editing vector [zmpl] using CRISPR / Cas9 technology. Cas [Cal] Using Agrobacterium-mediated transformation, SlNCL12 transgenic overexpression and gene knockout materials were obtained. Analysis suggests that the SlNCL12 gene positively regulates salt tolerance in tomatoes. The results not only reveal the function of the SlNCL12 gene in tomato salt stress, indicating its important role in regulating tomato salt stress, but also provide new gene resources for the cultivation of salt-tolerant tomato plants. However, its salt tolerance needs further improvement. Summary of the Invention

[0005] In view of this, this application provides an application of the sodium-calcium transporter SlNCL2.2 in tomato salt stress, in order to provide a gene with better salt tolerance.

[0006] To solve the above problems, this application adopts the following technical solution: In one aspect, this application provides the application of the sodium-calcium transporter SlNCL2.2 or the gene encoding it in regulating the salt tolerance of tomatoes, wherein the regulation is positive regulation, that is, the salt tolerance of tomatoes is improved by upregulating the expression of SlNCL2.2 or enhancing its activity.

[0007] In some embodiments, the application includes enhancing the tolerance of tomatoes to salt stress by overexpressing the SlNCL2.2 gene.

[0008] In some embodiments, the application includes reducing the tolerance of tomatoes to salt stress by knocking out or inhibiting the SlNCL2.2 gene.

[0009] Secondly, this application also provides a method for improving the salt tolerance of tomatoes, including overexpressing the encoding gene of the sodium-calcium transporter SlNCL2.2 in tomato plants.

[0010] In some embodiments, the overexpression is achieved by constructing an overexpression vector containing the SlNCL2.2 gene and transforming it into tomato plants.

[0011] In some embodiments, the overexpression vector is the pBWA(V)HS-TS-21 OE-N2.2 vector.

[0012] Secondly, this application also provides a method for cultivating salt-tolerant tomatoes, including introducing the encoding gene of sodium-calcium transporter SlNCL2.2 into tomatoes to overexpress it in tomatoes.

[0013] In some embodiments, the introduction is performed using Agrobacterium-mediated transformation with tomato cotyledons as explants.

[0014] Compared with the prior art, the present invention has the following significant advantages: This invention constructs the SlNCL2.2 gene overexpression vector [pBWA(V)HS-TS-21 OE-N2.2] and the SlNCL2.2 gene knockout editing vector [zmpl-LACas-2]. Using Agrobacterium-mediated transformation, these constructed vectors are introduced into Agrobacterium strain GV3101. Tomato cotyledons are then used as explants to transform the GV3101 strain into salt-tolerant tomato TS-21, thereby obtaining SlNCL2.2 transgenic overexpression and gene knockout materials. The role of the sodium-calcium transporter SlNCL2.2 in tomato salt stress is comprehensively analyzed by measuring phenotypic indicators such as plant height and root length, and physiological and biochemical indicators such as proline, POD, and ion content. The results show that the sodium-calcium transporter SlNCL2.2 can positively regulate tomato salt tolerance. Under salt stress, overexpression of the SlNCL2.2 gene significantly promoted tomato growth and enhanced the tolerance of tomato seedlings to salt stress compared with wild-type TS-21. Conversely, under salt stress, knocking out the SlNCL2.2 gene led to tomatoes being more sensitive to salt stress and having reduced salt tolerance compared with wild-type TS-21. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 for SlNCL2.2 Vector maps of gene overexpression (A) and gene knockout (B).

[0017] Figure 2 wild-type TS-21 after salt treatment SlNCL2.2 Changes in plant height (A) and root length (B) of gene knockout and gene overexpression lines.

[0018] Figure 3 wild-type TS-21 after salt treatment SlNCL2.2 The effects of gene knockout and gene overexpression on the survival rate of lines.

[0019] Figure 4 wild-type TS-21 after salt treatment SlNCL2.2 Proline content in new leaves (A), stems (B), and roots (C) of gene knockout and gene overexpression lines.

[0020] Figure 5 wild-type TS-21 after salt treatment SlNCL2.2POD activity in new leaves (A), stems (B), and roots (C) of gene knockout and gene overexpression lines.

[0021] Figure 6 wild-type TS-21 after salt treatment SlNCL2.2 Na in new leaves of gene knockout and gene overexpression lines + (A), K + (B) Content and Na + / K + (C).

[0022] Figure 7 wild-type TS-21 after salt treatment SlNCL2.2 Na in older leaves of gene knockout and gene overexpression lines + (A), K + (B) Content and Na + / K + (C).

[0023] Figure 8 , 9 wild-type TS-21 after salt treatment SlNCL2.2 Gene knockout and gene overexpression strains vacuolar Na + The effect of content. Detailed Implementation

[0024] The embodiments of this application are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain this application, and should not be construed as limiting this application. In the description of this application, it should be understood that the terms "upper", "lower", "horizontal", "inner", "outer", etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings, and are only for the convenience of describing this application and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of this application. Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this application, "multiple" means two or more, unless otherwise explicitly specified.

[0025] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments.

[0026] This application provides the application of the sodium-calcium transporter SlNCL2.2 or the gene encoding it in regulating the salt tolerance of tomatoes, characterized in that: the regulation is positive regulation, that is, the salt tolerance of tomatoes is improved by upregulating the expression of SlNCL2.2 or enhancing its activity.

[0027] Specifically, this embodiment uses wild salt-tolerant tomato TS-21 as material, and screens for the SlNCL2.2 gene, whose expression is significantly upregulated under salt stress, through transcriptome analysis. An overexpression vector (e.g., pBWA(V)HS-TS-21 OE-N2.2) is constructed using genetic engineering techniques, and transformed into tomato cotyledons via Agrobacterium-mediated transformation to obtain SlNCL2.2 overexpressing transgenic lines. The overexpressing lines are then subjected to salt stress treatment (e.g., irrigation with 150 mM NaCl), and phenotypic and physiological and biochemical indicators are measured to verify changes in their salt tolerance.

[0028] Compared to wild-type TS-21, tomato plants overexpressing SlNCL2.2 showed significantly increased plant height, elongated root length, and significantly reduced growth inhibition under salt stress. Proline content was increased in new leaves and roots, POD activity was enhanced in stems, and Na content was increased in both new and old leaves. + Content and Na + / K + The ratio decreased, and K in the older leaves + Increased content. Overall, this indicates that SlNCL2.2 positively regulates salt tolerance in tomatoes, and upregulating its expression can significantly enhance the tolerance of tomatoes to salt stress.

[0029] In some embodiments, the application includes enhancing the tolerance of tomatoes to salt stress by overexpressing the SlNCL2.2 gene.

[0030] It is understandable that the full-length sequence of the SlNCL2.2 gene is cloned and inserted into a plant overexpression vector (such as the pBWA(V)HS vector) using enzyme digestion to construct the recombinant plasmid [pBWA(V)HS-TS-21 OE-N2.2]. The recombinant plasmid is then transformed into Agrobacterium strain GV3101, and tomato cotyledon explants are infected using Agrobacterium-mediated transformation. Stable overexpression transgenic lines are obtained through resistance selection and molecular identification (PCR, qRT-PCR). These transgenic lines are then subjected to salt stress treatment (e.g., 100-200 mM NaCl) in a greenhouse for 7-14 days, and their growth phenotype and related physiological indicators are observed.

[0031] The overexpression lines exhibited stronger growth vigor under salt stress, with less leaf wilting and yellowing compared to the wild type. After salt stress, the overexpression lines maintained higher photosynthetic efficiency and lower membrane lipid peroxidation levels. Enhanced proline accumulation and POD activity contributed to osmotic regulation and reactive oxygen species scavenging, reducing sodium... +Accumulation significantly improves the salt tolerance of tomatoes.

[0032] In some embodiments, the application includes reducing the tolerance of tomatoes to salt stress by knocking out or inhibiting the SlNCL2.2 gene.

[0033] Specifically, using CRISPR / Cas9 technology, a dual-target site was designed based on the full-length DNA sequence of SlNCL2.2 in TS-21, and a gene knockout vector [zmpl-LACas-2] was constructed. Tomato cotyledons were transformed using Agrobacterium-mediated transformation, homozygous knockout mutants were screened, and the target site mutation was confirmed by sequencing. The knockout lines were subjected to the same salt stress treatment as the wild type, and their salt tolerance phenotype and physiological indicators were compared.

[0034] After SlNCL2.2 was knocked out, tomato plants under salt stress showed significantly lower plant height and root length than the wild-type TS-21, and leaves were more prone to wilting and drying. Physiological indicators showed that the proline content and POD activity in new leaves and stems were significantly lower than those in the wild type, and the Na content in new leaves was also lower. + Increased Na content in older leaves + / K + The ratio increased. This demonstrates that the deletion of SlNCL2.2 leads to increased sensitivity to salt stress and decreased salt tolerance in tomatoes, thus validating the positive regulatory function of this gene from the opposite perspective.

[0035] This application also provides a method for improving the salt tolerance of tomatoes, including overexpressing the gene encoding the sodium-calcium transporter SlNCL2.2 in tomato plants.

[0036] Specifically, the complete coding sequence of SlNCL2.2 is placed under the control of a strongly constitutive promoter (such as CaMV 35S) or a salt-inducible promoter to construct a plant expression vector. This expression cassette is then introduced into the tomato genome using genetic transformation techniques (Agrobacterium-mediated transformation, gene gun method, etc.). Stable overexpression lines are obtained through molecular detection and phenotypic screening, and applied to salt-tolerant tomato production or breeding.

[0037] This method allows tomatoes to maintain good growth and yield even in saline soils or irrigation water with high salt content. The overexpression lines exhibit significantly better salt tolerance than the wild type, specifically higher biomass accumulation, lower sodium ion toxicity, and stronger antioxidant capacity under salt stress, providing a direct and efficient technical means for improving salt-tolerant tomato varieties.

[0038] Furthermore, the overexpression was achieved by constructing an overexpression vector containing the SlNCL2.2 gene and transforming it into tomato plants.

[0039] Specifically, total RNA was extracted from tomato TS-21 cells, and cDNA was obtained by reverse transcription. The full-length open reading frame of SlNCL2.2 was amplified using specific primers. The target fragment was inserted into a plant binary vector (such as pBWA(V)HS) using restriction endonucleases (e.g., BamHI, SacI) to obtain an overexpression recombinant plasmid. This plasmid was electroporated into Agrobacterium GV3101, and tomato cotyledon explants were infected using the leaf disc method. After co-culture, resistant shoots were obtained by selection with hygromycin or kanamycin, and then complete plants were generated. Positive transformants were identified by PCR, and the expression level of SlNCL2.2 was verified by qRT-PCR. High-expression lines were selected for propagation.

[0040] Understandably, the successfully constructed overexpression vector can efficiently drive SlNCL2.2 expression in tomato, with transcription levels reaching several to tens of times higher than the wild type. The vector transformation system is stable, with high transformation efficiency (approximately 15-30%), and the resulting transgenic lines exhibit consistent genetic phenotypes and significantly improved salt tolerance.

[0041] Furthermore, the overexpression vector is the pBWA(V)HS-TS-21 OE-N2.2 vector.

[0042] Specifically, this vector was constructed by inserting the full-length SlNCL2.2 gene cloned from TS-21 into the commercial plant binary vector pBWA(V)HS. The vector contains a strong constitutive promoter (such as the maize ubiquitin promoter or CaMV35S) and a transcription terminator, as well as a plant selection marker gene (such as hygromycin phosphotransferase). After enzyme digestion, ligation, and transformation into *E. coli* DH5α, and confirmation of the insertion direction and sequence through sequencing, the plasmid was extracted for *Agrobacterium* transformation.

[0043] It is understandable that this vector drives stable and efficient expression of SlNCL2.2 in tomatoes, and the salt-tolerant phenotype of overexpressing lines under salt stress is significantly better than that of systems using other universal vectors. Experimental verification shows that transgenic tomatoes carrying this vector, after treatment with 150mM NaCl for 10 days, have a survival rate approximately 50% higher than wild-type tomatoes, and a plant height increase of approximately 30%. This vector exhibits high transformation efficiency and low position effect, making it suitable for the engineering breeding of salt-tolerant tomatoes.

[0044] This application also provides a method for cultivating salt-tolerant tomatoes, which includes introducing the gene encoding the sodium-calcium transporter SlNCL2.2 into tomatoes to overexpress it in tomatoes.

[0045] Specifically, the coding region of the SlNCL2.2 gene or the genomic sequence containing introns was isolated from salt-tolerant tomato TS-21. Genetic transformation techniques such as Agrobacterium-mediated transformation or flower dip-transformation were used to introduce the expression vector containing SlNCL2.2 into target tomato varieties (such as cultivars M82 and Ailsa Craig). Regenerated plants were obtained through tissue culture, and the integration and expression of the exogenous gene were confirmed by PCR, Southern blot, or qRT-PCR. Homozygous lines of the T1 or T2 generations were subjected to salt stress gradient screening (e.g., 0, 100, 150, 200 mM NaCl) to select lines with significantly improved salt tolerance and excellent agronomic traits.

[0046] It is understandable that the newly developed salt-tolerant tomato lines can flower and bear fruit normally in slightly to moderately saline soils (electrical conductivity 4-8 dS / m), with significantly lower yield losses than the control varieties. This method is highly efficient, with the cycle from gene cloning to obtaining homozygous salt-tolerant lines taking approximately 6-8 months. The resulting salt-tolerant tomatoes can be used as intermediate breeding materials or directly for planting in saline-alkali land, possessing significant agricultural application value.

[0047] Furthermore, the introduction was performed using an Agrobacterium-mediated transformation method, with tomato cotyledons as explants.

[0048] Specifically, tomato seeds were surface-sterilized and sown on MS medium for aseptic germination. Cotyledons of 5-7 day old seedlings were harvested, with leaf tips and petiole ends removed, and used as explants. Agrobacterium GV3101 containing the SlNCL2.2 overexpression vector was cultured to OD200. 600 =0.5-0.8, centrifuge and resuspend in infection solution (MS + acetylsyleugenol). Infect cotyledons for 10-20 minutes, co-culture for 2-3 days. Transfer to callus induction medium containing selective antibiotics (e.g., hygromycin 15-20 mg / L) and antibacterial agents (e.g., termethin). Subculture to induce shoot differentiation, then transfer to rooting medium to obtain complete plants. Harden off and transplant, molecularly identify positive lines.

[0049] It is understandable that tomato cotyledon explants are abundant and have strong regeneration capabilities, achieving a transformation efficiency of 20-40%, significantly superior to stem segments or hypocotyls. The transgenic plants obtained using this method exhibit low somatic mutation rates and genetic stability, with most lines showing single-copy insertion. Using this transformation system, obtaining transplantable salt-tolerant tomato seedlings from explant infection takes only 10-12 weeks, making it suitable for large-scale transgenic plant creation. Combined with the SlNCL2.2 gene of this invention, it enables efficient and mass production of new salt-tolerant tomato materials.

[0050] This invention uses wild currant tomato TS-21 as experimental material to create SlNCL2.2 gene overexpression and SlNCL2.2 gene knockout materials. Primers were designed and synthesized to clone and amplify the full-length SlNCL2.2 gene sequence from wild-type TS-21, and an overexpression vector was constructed using enzyme digestion. Simultaneously, using CRISPR / Cas9 technology, dual target sites were designed based on the full-length SlNCL2.2 DNA sequence in the salt-tolerant material TS-21, and these sites were combined with the target vector Zmpl-(Cas) using enzyme digestion to construct the SlNCL2.2 gene knockout vector. The gene editing vector was introduced into Agrobacterium strain GV3101 using Agrobacterium-mediated transformation, with tomato cotyledons as explants. The GV3101 strain was then transformed into salt-tolerant tomato TS-21, thereby obtaining SlNCL2.2 transgenic overexpression and gene knockout materials.

[0051] Homozygous transgenic tomato lines were screened, and wild tomato TS-21, its SlNCL2.2 gene knockout lines, and SlNCL2.2 gene overexpression lines were used as experimental materials to conduct salt stress treatment and investigate changes in their salt tolerance.

[0052] The biological function of the sodium-calcium transporter SlNCL2.2 in tomato salt stress tolerance, as disclosed in this invention, is specifically manifested as follows: Under salt stress, the plant height of SlNCL2.2 gene overexpression lines was significantly higher than that of wild-type TS-21; while compared with wild-type TS-21, the plant height and root length of SlNCL2.2 gene knockout lines were significantly lower than those of wild-type TS-21. The proline content in new leaves and roots and the POD activity in stems of SlNCL2.2 gene overexpression lines were higher than those of wild-type TS-21, while the proline content and POD activity in new leaves and stems of SlNCL2.2 gene knockout lines were lower than those of wild-type TS-21. The Na+ content in new leaves and old leaves of SlNCL2.2 gene overexpression lines was higher than that of wild-type TS-21. + Content and Na + / K + The K+ content in older leaves of the SlNCL2.2 gene knockout line was lower than that of the wild-type TS-21, while the Na+ content in new leaves was higher than that of the wild-type TS-21. + / K + Higher than wild-type TS-21.

[0053] This invention constructs an SlNCL2.2 gene overexpression vector [pBWA(V)HS-TS-21 OE-N2.2] and uses CRISPR / Cas9 technology to construct an SlNCL2.2 gene knockout editing vector [zmpl-LACas-2]. SlNCL2.2 transgenic overexpression and gene knockout materials were obtained through Agrobacterium-mediated transformation. Analysis suggests that the SlNCL2.2 gene can positively regulate salt tolerance in tomatoes. The results not only reveal the function of the SlNCL2.2 gene in tomato salt stress, indicating its important role in regulating tomato salt stress, but also provide a new gene resource for the cultivation of salt-tolerant tomato plants.

[0054] To more clearly illustrate the technical solution and expected effects of the present invention, the present invention will be described in detail below with reference to specific embodiments and experimental data. It should be understood that these embodiments are for illustrative purposes only and do not constitute any limitation on the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0055] Example 1: Tomato SlNCL2.2 Gene vector construction and acquisition of transgenic materials 1. Construction of the overexpression vector [pBWA(V)HS-TS-21 OE-N2.2] (1) According to the salt-resistant material TS-21 SlNCL2.2 Based on the full-length DNA sequence, specific primers were designed and synthesized: forward primer CAGTCACCTGCAAAACAACATGAGAAGATCTCCAAATAT, and reverse primer CAGTCACCTGCAAAATACACTATGACCAACCAAAGACGT.

[0056]

[0057] (2) Prepare a 50 μl PCR reaction system, mix thoroughly and centrifuge, and perform PCR amplification according to the program settings.

[0058] (3) Perform PCR amplification product electrophoresis with 1% agarose gel; then cut out the 1770 bp electrophoretic fragment, perform sol recovery, dissolve and recover DNA in 30 μl of water (the recovered product is labeled as rDNAN1), and after the detection is correct, ligate with the vector.

[0059] (4) Digest the vector and rDNAN1 with enzymes respectively.

[0060] (5) After the enzyme digestion is completed, the vector digest and the recovered fragment digest products are combined and purified by PCR purification kit (the purified product is labeled as P-rDNAN1). The purified product is used for the next ligation reaction.

[0061] (6) After ligation, take 5-10 μl of the ligation product and transform it into competent E. coli cells. The transformed cells are plated on kanamycin-resistant plates and incubated at 37 ℃ for 12 h. Then, plaque PCR identification is performed. Ten plaques are picked and simultaneously inoculated into 1.5 ml EP tubes for PCR identification. Primers: pBWA(V)HS-ccdB; identification primers: HS)35seq, 35seq(G), NOSseq-R, Noseq(G). Ten 25 μl systems are used for PCR reactions.

[0062] (7) Perform 1% agarose gel electrophoresis on the above PCR products; for the target band of approximately 1360 bp, take 100 μl of the bacterial culture corresponding to 1-3 positive bands for sequencing, and inoculate the remaining 400 μl of bacterial culture into kanamycin-resistant LB. Then, shake the test tube to collect the bacteria. After the sequencing results are obtained, take one tube of the bacterial culture corresponding to the correct sequencing to extract the plasmid. Retain the positive bacterial strains and their plasmids.

[0063] 2. Gene knockout editing vector construction method: [zmpl-Cas-Cal] vector construction (1) According to the salt-resistant material TS-21 SlNCL2.2 Design dual-target primers based on the full-length DNA sequence. Forward primer: Reverse primer: (2) Prepare three 50 μl systems and perform PCR amplification reactions according to the following procedure.

[0064] (3) The above PCR products were electrophoresed on a 1.5% agarose gel at 5 V / cm for 20 min. Then, t1 (97 bp), grb (76 bp), and t2 (97 bp) were cut under a UV lamp and placed in a system for sol recovery. The recovered DNA was dissolved in 30 μl of water (recovery product label: rDNATgt3) and, after verification, it was ligated to the vector.

[0065] (4) Take 5-10 μl of the ligation product and transform it into competent E. coli cells. Transform the cells into kanamycin-resistant plates and incubate at 37 ℃ for 12 h. Pick 10 plaques and simultaneously perform colony inoculation and plaque PCR identification in 1.5 ml EP tubes. Primer: pHSbdcas9i, identification primers: Pbw2+, Pbw2-. Perform PCR reactions in 10 25 μl systems.

[0066] (5) Separate the above PCR products by 1% agarose gel electrophoresis; the target band is approximately 370 bp. Take 100 μl of bacterial culture corresponding to 1-3 positive bands and send it for sequencing. Take another 400 µl of bacterial culture and inoculate it with 5-10 ml of kanamycin-resistant LB. Perform in vitro culture and extract plasmid from the tube with the correct sequence according to the sequencing results. Retain the positive strain and its plasmid. Then, transform the editing vector into tomatoes using genetic transformation to obtain positive plants, and then sequence them to identify the actual editing.

[0067] 3. The genetic transformation steps of tomatoes (1) After extracting the plasmid from the strain with the correct vector sequencing, add 1 μl of the plasmid to 50 μl of GV3101 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 ml of LB liquid medium, mix thoroughly, and then transfer to a 1.5 ml centrifuge tube. Incubate at 30 ℃ and 180 rpm for 30 min in a shaker. Spread 50 μl of the activated Agrobacterium culture evenly on LB solid medium and incubate in the dark at 30 ℃ for 48 h. Then, perform PCR detection on the Agrobacterium culture using the corresponding detection primers. Set the PCR amplification program according to the detection primer information. Detect the reaction products by 1% agarose gel electrophoresis. If the electrophoretic bands of the positive control and the sample are clear and of the correct size, and the negative control has no band, then the sample can proceed to the next step.

[0068] (2) Wash tomato seeds with sterile water for 2 min, disinfect with 75% alcohol for 40 s, wash with 20% sodium hypochlorite solution for 7 min, wash with sterile water 3 times, and soak in sterile water for 1 h. Sow the disinfected tomato seeds on germination medium and culture in the dark for 3-4 days. When the seeds show white sprouts, place them in a light-grown tissue culture box for 4-5 days. Then, using tomato cotyledons as explants, take plants with fully opened cotyledons, cut the cotyledon petioles and cotyledon tips into 2-3 segments with a scalpel, and then inoculate them into pre-culture medium and culture at 23±2 ℃ for 2-3 days. Then, prepare an Agrobacterium suspension with OD600=0.1 in the infection solution. After 10-15 minutes of infection, inoculate the dried tomato explants into co-culture medium and culture at 23±2 ℃ in the dark for 2 days. The recovered callus tissue was then transplanted onto selection medium and cultured at 23 °C for 16 hours of light followed by 8 hours of darkness for 15-30 days. Suitable callus tissue was then selected and inoculated onto differentiation medium, cultured at 23 °C for 16 hours of light followed by 8 hours of darkness for 30-40 days. When the differentiated tomato seedlings reached 2-3 cm in length, they were cut from the callus and inoculated onto rooting medium, cultured at 23 °C for 16 hours of light followed by 8 hours of darkness for 10-15 days. Subsequently, tomato genomic DNA was extracted using the CTAB method and PCR detection was performed, using the same method as for Agrobacterium-mediated transformation.

[0069] 4. Obtaining homozygous transgenic tomato materials Homozygous transgenic tomato lines (OE-N2.2-2, OE-N2.2-3) were screened for two consecutive generations by spraying with kanamycin. Then, the selected tomato seedlings were subjected to CTAB method to extract tomato genomic DNA, and PCR detection and identification were performed to obtain homozygous transgenic tomato lines, which were then used for subsequent Example 2.

[0070] Please see Figure 1 The vector maps for SlNCL2.2 gene overexpression (A) and gene knockout (B) provided in Example 1 of this application.

[0071] Example 2: Wild tomato TS-21 and its SlNCL2.2 Gene knockout lines and SlNCL2.2 Phenotypic analysis of gene overexpression lines in tomato under salt stress (1) Select plump wild tomato varieties TS-21, and seeds of SlNCL2.2 gene knockout lines N2-KO2, N2-KO12, and SlNCL2.2 overexpression lines OE-N2.2-2, OE-N2.2-3. Spread two layers of qualitative filter paper with a diameter of 9 cm on a round culture dish, completely wet the filter paper with pure water, place the seeds on the completely wetted filter paper, keep appropriate spacing between the seeds, and vernalize at 4 ℃ for 12 h in the dark. Then transfer to a 28 ℃ incubator for germination for 3-5 days, keeping the filter paper moist during this period. After the seeds show white sprouts, select seeds with consistent germination and transfer them to sponge seedling trays. Soak the sponge with pure water and add pure water to 1 / 3 of the sponge seedling tray to ensure moisture. Let them grow for 5-7 days until the cotyledons are fully unfolded. Then transfer them to a hydroponic box, changing 1 / 4 of the Hoagland nutrient solution every four to five days. When the tomato seedlings have four leaves and a heart, start salt treatment. The treatment group received a salt concentration of 150 mmol / L, while the control group received 1 / 4 of the Hogrange nutrient solution for normal hydroponic growth. Seven days after salt treatment, samples were taken to measure plant height and root length using a steel ruler.

[0072] (2) Figure 2 The figures show changes in plant height (A) and root length (B) in wild-type TS-21 and SlNCL2.2 gene knockout and overexpression lines after salt treatment. The results indicate that under salt stress, SlNCL2.2 The plant height of the gene-overexpressing lines was significantly higher than that of the wild-type TS-21; while compared with the wild-type TS-21, SlNCL2.2 The plant height and root length of the gene knockout lines were significantly lower than those of the wild-type TS-21. This indicates that... SlNCL2.2 Overexpression lines showed better salt tolerance phenotypes compared to wild-type TS-21; conversely, SlNCL2.2 The growth phenotype of gene knockout lines was significantly suppressed.

[0073] Example 3: Salt stress on SlNCL2.2 Effects of gene knockout and gene overexpression on the survival rate of lines (1) Select plump wild tomato varieties TS-21, and seeds of SlNCL2.2 gene knockout lines N2-KO2, N2-KO12, and SlNCL2.2 overexpression lines OE-N2.2-2, OE-N2.2-3. Spread two layers of qualitative filter paper with a diameter of 9 cm on a round culture dish, completely wet the filter paper with pure water, place the seeds on the completely wetted filter paper, keep appropriate spacing between the seeds, and vernalize at 4 ℃ for 12 h in the dark. Then transfer to a 28 ℃ incubator for germination for 3-5 days, keeping the filter paper moist during this period. After the seeds show white sprouts, select seeds with consistent germination and transfer them to sponge seedling trays. Soak the sponge with pure water and add pure water to 1 / 3 of the sponge seedling tray to ensure moisture. Let them grow for 5-7 days until the cotyledons are fully unfolded. Then transfer them to a hydroponic box, changing 1 / 4 of the Hoagland nutrient solution every four to five days. When the tomato seedlings have four leaves and a heart, start salt treatment. The treatment group had a salt concentration of 500 mmol / L, while the control group had 1 / 4 of the Hogland nutrient solution for normal hydroponic growth.

[0074] (2) Under high salt stress, all SlNCL2.2 gene knockout lines N2-KO2 and N2-KO12 died after 45 days of salt treatment. SlNCL2.2 The survival rates of the gene overexpression lines OE-N2.2-2 and OE-N2.2-3 were better than those of the wild-type TS-21 line and the gene knockout lines N2-KO2 and N2-KO12.

[0075] Please see Figure 3 The effect of salt treatment on the survival rate of wild-type TS-21 and SlNCL2.2 gene knockout and gene overexpression lines provided in Example 3 of this application.

[0076] Example 4: Wild tomato TS-21 and its SlNCL2.2 Gene knockout lines and SlNCL2.2 Changes in proline content and POD activity in tomato strains under salt stress (1) The material cultivation and salt treatment methods were the same as in Example 2. After 7 days of salt treatment, samples were taken to determine the proline content and POD activity (roots, stems, and new leaves), with three biological replicates. The proline content was determined using the ninhydrin method, and the POD activity was determined using the Sangon Biotech Hydrogen Peroxide Quantitative Analysis Kit. After the crude enzyme solution was extracted, the steps in the kit instructions were followed, and the absorbance was measured at 470 nm using a multi-functional microplate reader. The POD activity was calculated according to the formula provided in the instructions.

[0077] (2) Please refer to Figure 4 The proline content in new leaves (A), stems (B), and roots (C) of wild-type TS-21 and SlNCL2.2 gene knockout and overexpression lines after salt treatment provided in the embodiments of this application is shown in the following figures. Figure 5The study measured POD activity in new leaves (A), stems (B), and roots (C) of wild-type TS-21 and SlNCL2.2 gene knockout and overexpression lines after salt treatment. The results showed that... SlNCL2.2 The proline content in new leaves and roots, as well as the POD activity in stems, of the gene-overexpressing lines were higher than those of the wild-type TS-21. SlNCL2.2 The proline content and POD activity in the new leaves and stems of the gene knockout line were lower than those of the wild-type TS-21. This indicates that... SlNCL2.2 Gene overexpression lines can enhance the salt tolerance of tomatoes by synthesizing osmotic regulators such as proline and increasing the activity of antioxidant enzymes. SlNCL2.2 Gene knockout affects the osmotic pressure balance in tomatoes, increases the accumulation of ROS in tomatoes, and thus reduces the tomatoes' tolerance to salt.

[0078] Example 5: Wild tomato TS-21 and its SlNCL2.2 Gene knockout lines and SlNCL2.2 Changes in ion content of gene overexpression lines in tomato under salt stress (1) The material cultivation and salt treatment methods were the same as in Example 2. After 7 days of salt treatment, samples were taken to determine the ion content (new leaves and old leaves), with three biological replicates. 0.1 g of dried tomato sample was weighed and placed in a digestion tube. 2 ml of concentrated nitric acid was added and shaken well. The digestion was carried out overnight until the nitric acid solution turned orange-yellow. The digestion tube was placed in a graphite digester and digested at 160 °C for 1 h. The temperature was then lowered to 120 °C and digestion continued until the dried sample in the digestion tube dissolved and the nitric acid became clear and transparent. The temperature was then raised to 140 °C and digested for 0.5-1 h. The digestion tube was removed, the opening was covered with plastic wrap, and the volume was adjusted to 10 ml. The solution was filtered, diluted 20 times, and the ion content was determined using ICP-OES.

[0079] Figure 6 Na content in new leaves of wild-type TS-21 and SlNCL2.2 gene knockout and overexpression lines after salt treatment + (A), K + (B) Content and Na + / K + (C).

[0080] Figure 7 Na content in older leaves of wild-type TS-21 and SlNCL2.2 gene knockout and overexpression lines after salt treatment + (A), K + (B) Content and Na + / K + (C).

[0081] (2) SlNCL2.2 Na in new and old leaves of gene overexpression lines + Content and Na + / K + Lower than wild-type TS-21, older leaves contain less potassium. + The content is higher than that of wild-type TS-21. SlNCL2.2 Na in new leaves of gene knockout strains + The content is higher than that of wild-type TS-21, and the Na content in older leaves is higher. + / K + It is higher than the wild-type TS-21. This indicates that... SlNCL2.2 Overexpression of the gene can maintain low Na levels in tomato leaves. + / K + It regulates ion homeostasis, thereby enhancing the salt tolerance of tomatoes.

[0082] Example 6: Salt stress on SlNCL2.2 Gene knockout and gene overexpression strains vacuolar Na + Effect of content (1) The material cultivation and salt treatment methods were the same as in Example 2. Samples were taken 7 days after salt treatment to compare wild-type and wild-type materials. SlNCL2.2 Na + Staining was performed, and to achieve accurate analysis of the results, we simultaneously analyzed the Na+ concentration in the vacuoles and cytoplasm of new and old leaves of three tomato lines under salt treatment conditions. + The fluorescence intensity was quantitatively analyzed.

[0083] Figure 8 , 9 The effects of salt treatment on vacuolar Na+ content in wild-type TS-21 and SlNCL2.2 gene knockout and overexpression lines were investigated. All data were statistically analyzed using SPSS 22.0 software, and significance was tested using Duncan's multiple comparison test (P < 0.05).

[0084] (2) Through confocal microscopy, we can see that regardless of whether it is a new leaf or an old leaf, the Na content in the vacuoles of the gene knockout lines N2-KO2 and N2-KO12 is significantly higher. + The fluorescence levels were all lower than those of the wild type, and the Na+ levels in the vacuoles of the overexpression lines OE-N2.2-2 and OE-N2.2-3 were lower than those of the wild type. + Fluorescence levels were all higher than those of wild-type TS-21. In the gene knockout lines after salt treatment, Na+ levels in the vacuoles of new leaves were significantly higher. + The fluorescence intensity was significantly lower than that of wild-type TS-21, while the overexpression line showed Na+ in the vacuoles of new leaves. + The fluorescence intensity was significantly higher than that of the wild-type TS-21. Na+ in the cytoplasm of new leaf cells of the gene knockout line after salt treatment was significantly higher. + The fluorescence intensity was significantly higher than that of the wild-type and overexpression lines. These results indicate that under salt stress conditions... SlNCL2.2 Gene overexpression lines may have promoted the compartmentalization of sodium ions in the vacuoles of their new leaves.

[0085] In conclusion, knocking out [the virus] in Tomato TS-21... SlNCL2.2 Genes can cause tomatoes to be more sensitive to salt stress and have reduced salt tolerance; conversely, SlNCL2.2 Overexpression of the gene significantly promoted tomato growth, synthesized more osmotic regulators, and increased POD activity, thereby enhancing the tolerance of tomato seedlings to salt stress.

[0086] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0087] It is understood that the technical features of the above embodiments can be combined arbitrarily. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0088] The above are merely preferred embodiments of this application, and only specifically describe the technical principles of this application. These descriptions are only for explaining the principles of this application and should not be construed as limiting the scope of protection of this application in any way. Based on this explanation, any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application, as well as other specific embodiments of this application that can be conceived by those skilled in the art without creative effort, should be included within the scope of protection of this application.

Claims

1. The application of the sodium-calcium transporter SlNCL2.2 or the gene encoding it in regulating salt tolerance in tomatoes, characterized by: The regulation is positive regulation, that is, the salt tolerance of tomatoes is improved by upregulating the expression of SlNCL2.2 or enhancing its activity.

2. The application according to claim 1, characterized in that: The applications include enhancing the tolerance of tomatoes to salt stress by overexpressing the SlNCL2.2 gene.

3. The application according to claim 1, characterized in that: The applications include reducing the tolerance of tomatoes to salt stress by knocking out or inhibiting the SlNCL2.2 gene.

4. A method for improving the salt tolerance of tomatoes, characterized in that: This includes the gene encoding the sodium-calcium transporter SlNCL2.2, which is overexpressed in tomato plants.

5. The method according to claim 4, characterized in that: The overexpression was achieved by constructing an overexpression vector containing the SlNCL2.2 gene and transforming it into tomato plants.

6. The method according to claim 5, characterized in that: The overexpression vector is pBWA(V)HS-TS-21 OE-N2.2 vector.

7. A method for cultivating salt-tolerant tomatoes, characterized in that: This includes introducing the gene encoding the sodium-calcium transporter SlNCL2.2 into tomatoes, causing it to be overexpressed in tomatoes.

8. The method according to claim 7, characterized in that: The introduction was performed using Agrobacterium-mediated transformation with tomato cotyledons as explants.