Compositions and methods for inhibiting microtubule-associated protein tau (mapt) expression

Abstract

The present invention provides compositions and methods useful for reducing MAPT gene expression and treating MAPT-associated diseases and disorders. The present invention provides MAPT dsRNA agents, MAPT antisense polynucleotide agents, compositions comprising MAPT dsRNA agents, and compositions comprising MAPT antisense polynucleotide agents, which are useful for reducing MAPT expression in cells and subjects.

Description

Technical Field

[0001] This invention relates in part to compositions and methods that can be used to suppress the expression of the microtubule-associated protein tau (mapt) gene. Technical Background

[0002] Microtubule-associated protein tau (MAPT) is encoded by the MAPT gene located on chromosome 17q21. The MAPT gene consists of 16 exons. Alternative splicing of the mRNA produces six MAPT isoforms, totaling 352–441 amino acids. In three of the six MAPT isoforms, the microtubule-binding domain of MAPT contains three repeating segments, while in the other three MAPT isoforms, the corresponding domain contains four repeating segments.

[0003] MAPT transcripts are differentially expressed throughout the body, primarily in the central nervous system (i.e., the brain and spinal cord) and the peripheral nervous system. Wild-type tau is involved in stabilizing microtubules in neuronal axons, maintaining dendritic spines, and regulating axonal transport, microtubule dynamics, and cell division. Approximately 10% of patients with primary tau protein disorders have pathogenic MAPT variants. These variants are primarily missense mutations located in exons 9-13 (microtubule-binding domain), many of which affect alternative splicing in exon 10. The main function of tau is to bind and stabilize microtubules, which are essential structural components of the cytoskeleton involved in mitosis, cytokinesis, and vesicle transport. Microtubules are crucial for maintaining cell integrity, facilitating intracellular and intercellular transport, and cell division. Therefore, microtubules are vital for axonal transport and maintaining cellular structural integrity. Tau protein is located within neurons, primarily within axons. Tau protein is also present in other neuronal cells, such as astrocytes and oligodendrocytes, where it plays a similar role.

[0004] Tauopathies are a heterogeneous group of progressive neurodegenerative diseases characterized by the presence of Tau aggregates in the brain. Phenotypic, tauopathies manifest as varying degrees of motor, cognitive, and behavioral impairments. Tauopathies include, but are not limited to, Alzheimer's disease, frontotemporal dementia (FTD), and progressive supranuclear palsy (PSP). Tau is a major component of neurofibrillary tangles in the cytoplasm of neurons and is a hallmark of Alzheimer's disease. Tau aggregation and deposition have also been observed in the brains of approximately 50% of Parkinson's disease patients.

[0005] Therefore, this article discloses a MAPT gene RNAi agent for the treatment of diseases, symptoms and conditions associated with tau protein diseases, and the treatment is intended solely to alleviate symptoms and improve the quality of life of patients, such as subjects with MAPT-related conditions (e.g., Alzheimer's disease, FTD, PSP or other tau protein diseases) who can receive effective treatment. Summary of the Invention

[0006] In general, this disclosure describes novel MAPT gene-specific RNAi agents, compositions comprising MAPT RNAi agents, and methods for inhibiting MAPT gene expression in vitro and / or in vivo using the MAPT RNAi agents and compositions comprising MAPT RNAi agents described herein. The MAPT RNAi agents described herein can selectively and effectively reduce, inhibit, or silence MAPT gene expression in subjects (e.g., human or animal subjects).

[0007] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 1 or 3 by no more than 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 2 or 4 by no more than 1, 2, or 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary.

[0008] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region complementary to a MAPT RNA transcript, the complementary region containing at least 15 consecutive nucleotides differing from any antisense sequence listed in Tables 1-3 by no more than 1, 2, or 3 nucleotides.

[0009] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 in the antisense strand include a region complementary to the MAPT RNA transcript, wherein the complementary region includes at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally includes a targeting ligand.

[0010] In some embodiments, a double-stranded RNA (dsRNA) agent for inhibiting MAPT expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, said consecutive nucleotides being associated with SEQ ID NO: Nucleotides of 1: 165-195, 166-196, 167-197, 165-197, 257-287, 1495-1525, 1525-1555, 1528-1558, 1529-1559, 1525-1559, 1532-1562, 2234-2264, 2235-2265, 2236-2266, 2237-2267, 2238-2268, 2235-2268, 2326-2356, 2327-235 7, 2328-2358, 2329-2359, 2330-2360, 2331-2361, 2333-2363, 2334-2364, 2336-2366, 2342-2372, 2326-2372, 2359-2389, 2364-2394, 2359-2394, 2412-2442, 2414-2444, 2412-2444, 2426-2456, 2688-2718, 2775-2805, 2 805-2835, 2811-2841, 2835-2865, 2836-2866, 2837-2867, 2838-2868, 2839-2869, 2840-2870, 2841-2871, 2842-2872, 2843-2873, 2845-2875, 2835-2875, 2868-2898, 1577-1607, 2263-2293, 2332-2362, 2338-2368, 2339 The sense strand and the antisense strand may differ by 0, 1, 2 or 3 nucleotides from any of the nucleotide sequences of -2369, 2338-2369, 2706-2736, 2753-2783, 2754-2784, 2757-2787, 2352-2387, 2761-2791, 2778-2808, 2817-2847, 2818-2848, 2819-2849, 2717-2849, 2826-2856, 2833-2863, and the antisense strand may contain at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides that differ by 0, 1, 2 or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2, wherein the sense strand and the antisense strand may be partially, substantially or completely complementary.

[0011] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, said consecutive nucleotides being associated with SEQ ID NO: Nucleotides of 1: 170-190, 171-191, 172-192, 170-192, 262-282, 1497-1517, 1500-1520, 1530-1550, 1533-1553, 1534-1554, 1530-1554, 1537-1557, 2239-2259, 2240-2260, 2241-2261, 2242-2262, 2243-2263, 2239-2263, 2331-2351, 233 2-2352, 2333-2353, 2334-2354, 2335-2355, 2336-2356, 2338-2358, 2339-2359, 2341-2361, 2347-2367, 2331-2361, 2331-2367, 2364-2384, 2369-2389, 2364-2389, 2417-2437, 2419-2439, 2417-2439, 2431-2451, 2693-2713, 2 780-2800, 2810-2830, 2816-2836, 2840-2860, 2841-2861, 2842-2862, 2843-2863, 2844-2864, 2845-2865, 2846-2866, 2847-2867, 2848-2868, 2850-2870, 2840-2870, 2873-2893, 1582-1602, 2268-2288, 2337-2357, 2343-2363 The antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the corresponding nucleotide sequence of SEQ ID NO:2 by 0, 1, 2, or 3 nucleotides.

[0012] In some implementations, the MAPT RNA transcript is SEQ ID NO: 1.

[0013] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO: 1 and is provided in any of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is completely complementary to any of the target regions of SEQ ID NO: 1 and is provided in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence as described in any of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence as described in any of Tables 1-3, wherein the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence as described in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a sequence listed as a double-stranded sequence in any of Tables 1-3.

[0014] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In some embodiments, all or substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse debased nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, nucleotide containing a 5'-thiophosphate group, 5'-phosphate modified nucleotide, or terminal nucleotide linked to a cholesterol derivative or dodecanoic acid bis(decylamide) group, 2'-amino modified nucleotide, phosphoramide, or nucleotide containing a non-natural base.

[0015] In some embodiments, the dsRNA agent further comprises a phosphate ester or a phosphate ester mimic. In some embodiments, a 5'-phosphate ester or a 5'-phosphate ester mimic is introduced into the 5' terminal nucleotide of the antisense strand. In some embodiments, the phosphate ester mimic is 5'-vinylphosphonate (VP).

[0016] In some embodiments, the phosphate mimicry of the 5'-terminal nucleotide contains a fragment represented by the following structural formula:

[0017]

[0018] Where: Q8 is O, S, SO, SO2, PR16 R 17 Or NR 11 ; R 16 and R 17 Independently selected from (=O), (=S), OH, SH, C1-C6 alkyl and NR 18 R 19 ;R 16 and R 17 Independently, it can be (=O), (=S), OH, SH, C1-C6 alkyl, or NR. 18 ;

[0019] Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, mercapto or protected mercapto, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optionally substituted amino, native or modified nucleoside; and R b For O, S, or NR 12 R 12 Protected by hydrogen, C1-C6 alkyl and amino groups;

[0020] The substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl;

[0021] R 11 R 18 and R 19 Independently selected from H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid groups;

[0022] Each substituent group comprises one or more optional substituents independently selected from the following: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkyl mercapto, and CN;

[0023] “ "" indicates a bond attached to the remainder of the 5'-terminal nucleotide. In some embodiments, Q8 is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar-substituted portion of the 5'-terminal nucleotide.

[0024] In some embodiments, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5' end of the guide strand.

[0025] In some embodiments, the dsRNA reagent comprises a 5'-phosphate mimic nucleotide represented by formula (VIII) or its stereoisomer or racemate at the 5'-end of the guide strand:

[0026] Formula (VIII)

[0027] Where: Q8 represents O, S, SO, SO2, and PR. 16 R 17 or NR 11 ;R 16 and R 17 Independently, it can be (=O), (=S), OH, SH, C1-C6 alkyl, or NR. 18 R 19 Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, mercapto or protected mercapto, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optionally substituted amino, native or modified nucleosides; and R b For O, S, or NR 12 R 12 Protected by hydrogen, C1-C6 alkyl, or amino groups;

[0028] Q1 and Q2 are each independently H, halogen, -CN, or optionally substituted C1-C6 alkyl groups;

[0029] The substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl;

[0030] R 11 R 18 and R 19 Independently, it is H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid groups;

[0031] Z is a nucleoside containing a sugar or a sugar-substituted portion;

[0032] T3 is an internucleotide linker used to link the 5'-terminal nucleotide of formula (VIII) or its stereoisomer to the remaining portion of the 5'-terminus of the guide strand;

[0033] Each substituent comprises one or more substituents, optionally independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkyl mercapto, CN.

[0034] In a specific embodiment, a nucleotide of formula (VIII) is provided, wherein Q8 is S, SO, or SO2. In a specific embodiment, a nucleotide of formula (VIII) is provided, wherein Q1 and Q2 are each independently H. In a specific embodiment, in the nucleotide provided in formula (VIII), the sugar or sugar-substituted nucleoside comprises a 5-membered furanose ring, a non-furanose ring, or a 5-6 membered carbon ring system or an open system. In a specific embodiment, in the nucleotide provided in formula (VIII), the sugar-substituted nucleoside is selected from morpholino, cyclohexenyl, cyclohexyl, cyclopentyl, pyranyl, or cyclohexanol. In a specific embodiment, the sugar or sugar-substituted nucleoside is a furanose. In a specific embodiment, the sugar or sugar-substituted nucleoside comprises an unlocked nucleobase analog (UNA) or a glycerol nucleobase analog (GNA). In specific embodiments, the nucleotide of the sugar or sugar-substitute moiety comprises locked nucleic acid (LNA) or bridging nucleic acid (BNA). In specific embodiments, a nucleotide of formula (VIII) is provided, wherein Q8 is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar-substitute moiety. In specific embodiments, a nucleotide of formula (VIII) is provided, wherein Rb is oxygen. In specific embodiments, a nucleotide of formula (VIII) is provided, wherein Ra and Rc are each independently selected from OH, SH, NH2, or NHSO2CH3.

[0035] In some embodiments, the dsRNA agent includes a 5'-phosphate mimic nucleotide modified at the 5'-end of the guide strand, wherein the 5'-phosphate mimic nucleotide is selected from any of the following structures or their stereoisomers or racemates:

[0036]

[0037] “ "" indicates the portion connected to the remaining portion at the end of the guide chain 5'.

[0038] In some embodiments, the internucleotide linker is independently selected from phosphodiester linkers, phosphotriester linkers, or thiophosphate linkers, dithiophosphate linkers, alkylphosphonates, aminophosphonates, phosphonates, phosphonites, thiophosphamids, or phosphoramides. For example, the 5'-phosphate mimic nucleotide Phos-15-1 When a phosphate diester linker is used instead of a thiophosphate linker, the following structure is obtained: Phos-15-1. In some embodiments, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5'-terminus of the guide strand.

[0039] In some embodiments, the dsRNA agent includes at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the sense strand includes at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the antisense strand includes at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 5' end of the antisense strand includes two phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 3' end of the antisense strand includes two phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 5' end and the 3' end of the antisense strand each include two phosphate-thioester nucleoside internucleotide bonds.

[0040] In some embodiments, the dsRNA agent further comprises a chiral modification occurring at the first terminal nucleotide internucleotide bond at the 3' end of the antisense strand, wherein the internucleotide bond is a phosphate thioester nucleoside bond with its phosphorus atom in the Sp configuration. In some embodiments, the dsRNA agent further comprises a chiral modification occurring at the first terminal phosphate thioester nucleoside bond at the 5' end of the antisense strand, wherein the internucleotide bond is a phosphate thioester nucleoside bond with its phosphorus atom in the Rp configuration. In some embodiments, the dsRNA agent further comprises a chiral modification occurring at the first terminal nucleotide internucleotide bond at the 5' end of the sense strand, wherein the internucleotide bond is a phosphate thioester nucleoside bond with a phosphorus atom, which can be in the Rp or Sp configuration. In other embodiments, the dsRNA agent further comprises chiral modifications occurring at the terminal first and second nucleotide inter-bonds at the 3' end of the antisense strand, wherein the phosphorus atom of the thiophosphate nucleoside inter-bond is in the Sp configuration; chiral modifications occurring at the terminal first nucleotide inter-bond at the 5' end of the antisense strand, wherein the phosphorus atom of the thiophosphate nucleoside inter-bond is in the Sp configuration; and terminal chiral modifications occurring at the first nucleotide inter-bond at the 5' end of the sense strand, wherein the phosphorus atom of the thiophosphate nucleoside inter-bond is in the Rp configuration.

[0041] In some embodiments, one or more lipophilic portions are conjugated to one or more internal locations on at least one chain, for example, via a connector or carrier. In some embodiments, all internal locations are included except for two locations at each end of at least one chain. In other embodiments, all internal locations are included except for three locations at each end of at least one chain. In some embodiments, the internal locations do not include cleavage sites of the sense chain. In some embodiments, the internal locations do not include cleavage sites of the antisense chain. In some embodiments, one or more lipophilic portions are conjugated to one or more internal locations selected from the group consisting of positions 4-8 and 13-18 on the sense chain, measured from the 3' end of the sense chain, and positions 6-10 and 15-18 on the antisense chain, measured from the 5' end of the antisense chain. In other embodiments, the one or more lipophilic portions are conjugated to one or more internal locations selected from the group consisting of positions 5, 6, 15, 16, and 17 on the sense chain, measured from the 3' end of the sense chain, and positions 15 and 17 on the antisense chain, measured from the 5' end of the antisense chain. In some embodiments, the internal positions of the double-stranded region do not include the cleavage site region of the sense strand. In some embodiments, the sense strand is 21 nucleotides long, the antisense strand is 21 nucleotides long, and the lipophilic portion is conjugated to positions 21, 20, 15, 1, 7, 6, or 2 on the sense strand, or position 16 on the antisense strand, starting from the 5' end of the antisense strand. In some embodiments, the lipophilic portion binds to positions 1, 2, 7, 21, or 15 on the sense strand, starting from the 3' end of the sense strand. In other embodiments, the lipophilic portion binds to positions 1, 2, or 7 on the sense strand, starting from the 3' end of the sense strand. In still other embodiments, the lipophilic portion binds to positions 2 or 7 on the sense strand, starting from the 3' end of the sense strand. In some embodiments, the lipophilic portion binds to position 16 on the antisense strand, starting from the 5' end of the antisense strand.

[0042] In some embodiments, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound. In some embodiments, the lipophilic moiety is selected from the group consisting of lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-hexadecylglycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl, or phenoxazine. In some embodiments, the lipophilic moiety comprises saturated or unsaturated C4-C... 30The hydrocarbon chain, and optionally substituted functional groups, said functional groups being selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In some embodiments, the lipophilic moiety comprises a saturated or unsaturated C6-C group. 18 Hydrocarbon chain. In some embodiments, the lipophilic moiety comprises saturated or unsaturated C atoms. 16 Hydrocarbon chain. In some implementations, saturated or unsaturated C... 16 The hydrocarbon chain is conjugated to the 15th or 16th position, counting from the 5' end of the chain. In some embodiments, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotides in an internal position or double-stranded region. In some embodiments, the carrier is a cyclic group selected from pyrrolidinyl, pyrazolinyl, pyrazolinyl, imidazolinyl, imidazolinyl, piperidinyl, piperazinyl, [1,3]dioxacyclopentyl, oxazolinyl, isoxazolinyl, morpholinyl, thiazolinyl, isothiazolinyl, quinoxolinyl, pyridazinone, tetrahydrofuranyl, and decahydronaphthyl; or based on the acyclic moiety of serine, the lipophilic moiety is conjugated to the double-stranded iRNA agent via a linker comprising an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide bond, click reaction product, or carbamate. In some embodiments, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or nucleoside internucleotide bond. In some embodiments, the lipophilic portion is conjugated by a bioconnector selected from DNA, RNA, disulfides, amides, galactosamine, glucosamine, glucose, galactose, mannose, or combinations thereof.

[0043] In some embodiments, all or substantially all nucleotides of the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, wherein fewer than 6 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoronucleotides; preferably, the antisense strand comprises 5 2'-fluoronucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein fewer than 4 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the sense strand comprises 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modifying nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein at least 14 of the modifying nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 2, 5, 7, 11, 12, 14, 16, and / or 18, counting from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA modifying nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA modifying nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16, counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises one UNA modifying nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 18, counting from the first matching position at the 5' end, and the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises a UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16 counting from the first matching position at the 5' end, plus the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16 counting from the first matching position at the 5' end, plus the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 11, 14, and 16 counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides each at positions 2, 5, 12, 14, and 16 counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some implementations, the antisense strand contains five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16, starting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides.In some embodiments, the sense strand comprises 15 or more modifying nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoronucleotides, preferably, wherein at least 18 modifying nucleotides are 2'-O-methyl nucleotides, and the nucleotides at positions 9, 11, and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the sense strand comprises at least 18 modifying nucleotides are 2'-O-methyl nucleotides, and the nucleotides at positions 8, 11, and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the modified sense strand is a modified sense strand sequence shown in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence shown in one of Tables 2-3.

[0044] In some embodiments, the dsRNA reagent comprises at least one modified nucleotide and further comprises one or more targeting or linking groups. In some embodiments, one or more targeting or linking groups are conjugated to a sense strand. In some embodiments, the targeting or linking group comprises N-acetylgalactosamine (GalNAc).

[0045] In some implementations, the targeting group comprises the following structure:

[0046] Formula 1

[0047] Each n'' is independently selected from 1 or 2.

[0048] In some implementations, the targeting group has the following structure:

[0049]

[0050]

[0051]

[0052]

[0053] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3' end of the sense strand.

[0054] In some implementations, the antisense strand includes a reverse debasing residue at the 3' end.

[0055] In some embodiments, the sense chain includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, each end of the sense chain includes one reverse debase residue. In some embodiments, each end of the sense chain includes one imann residue. In some embodiments, one or more reverse debase residues or one or more imann residues are attached to either or both ends of the sense chain via a thiophosphate bond. In some embodiments, a targeting group is further attached to either end of the sense chain via a thiophosphate bond. In some embodiments, a targeting group is further attached to the 5' end of the sense chain via a thiophosphate bond. In some embodiments, there is a reverse debase residue or imann residue at the 5' end of the sense chain, wherein the reverse debase residue or imann residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense chain via a thiophosphate bond. In some embodiments, a reverse debasement residue or imann residue is located at the 3' end of the sense strand, wherein the reverse debasement residue or imann residue is linked to an adjacent nucleotide at the 3' end of the sense strand nucleotide sequence via a thiophosphate bond. In some embodiments, the sense strand also includes a targeting group linked to a reverse debasement residue or imann residue at the 5' end of the sense strand, wherein the targeting group is linked to an adjacent reverse debasement residue or imann residue via a thiophosphate bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc).

[0056] In some embodiments, the dsRNA reagent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least one strand contains a 3' overhang of at least two nucleotides.

[0057] In some embodiments, the dsRNA comprises a double strand selected from the following: AV03732, AV03733, AV03734, AV03736, AV03739, AV03741, AV03750, AV03751, AV03752, AV03754, AV03768, AV03770, AV03771, AV03791, AV03792, AV03793, AV03794, AV03795, AV03796, AV03797, AV03798, AV03799, AV03800, AV03804, AV03805, AV03806, AV03807. AV03809, AV03817, AV03826, AV03827, AV03829, AV03831, AV03832, AV03833, AV03834, AV03835, AV03836, AV03837, AV03838, AV03839, AV03840, AV03842, and wherein the bistranded form optionally includes a targeting ligand.

[0058] According to another aspect of the invention, a double-stranded RNA (dsRNA) agent for inhibiting MAPT expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to a portion of the MAPT RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, and wherein the sense strand contains a sequence that can be represented by formula (I):

[0059]

[0060] Where: each N′ F Represents nucleotides with 2'-fluorine modification; each N′ N1 and N′ N2 Independently representing modified or unmodified nucleotides; each N′ L The nucleotides are independently represented as modified or unmodified nucleotides, but not as nucleotides with 2'-fluorine modification, and m′ and n′ are each independently integers from 0 to 7.

[0061] In some embodiments, N′ N1 and N′ N2 It includes only one 2'-fluorinated nucleotide.

[0062] In some embodiments, N′ N1 Independently represents a nucleotide with 2'-fluorine modification, optionally, N′ N2 Independently represents nucleotides modified with 2'-O-methyl.

[0063] In some embodiments, N' N2 Independently represents a nucleotide with 2'-fluorine modification, optionally, N′ N1 Independently represents nucleotides modified with 2'-O-methyl.

[0064] In some embodiments, m′ is 2 and n′ is 4, or m′ is 2 and n′ is 2. In some embodiments, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2. In some embodiments, m′ is 0 and n′ is 4, or m′ is 0 and n′ is 2.

[0065] In some implementations, each N' L Independently represents 2'-O-methyl nucleotide.

[0066] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand, preferably, the targeting group being selected from GLO-1 to GLO-16 and GLS-1. To GLS-16 Any of the above, more preferably, the targeting group is the aforementioned GLS-15 In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes a reverse debasement residue at the 3' end. In some embodiments, the sense strand includes one or two reverse debasement residues and / or one or two Imann residues at the 3' and / or 5' ends. In some embodiments, each 3' and 5' end of the sense strand independently includes a reverse debasement residue. In some embodiments, each 3' and 5' end of the sense strand independently contains an Imann residue. In some embodiments, the sense strand includes two reverse debasement residues at the 3' and 5' ends, and the residues at the 3' or 5' ends further bind to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the sense strand contains two imann residues at the 3' and 5' ends, and the residues at the 3' or 5' end further bind to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the 5' end of the sense strand includes a reverse debase residue or an imann residue, wherein the reverse debase residue or imann residue is linked to an adjacent nucleotide at the 5' end of the sense strand nucleotide sequence via a thiophosphate bond. In some embodiments, the 3' end of the sense strand includes a reverse debase residue or an imann residue, wherein the reverse debase residue or imann residue is linked to an adjacent nucleotide at the 3' end of the sense strand nucleotide sequence via a thiophosphate bond. In some embodiments, the sense strand further includes a targeting group linked to the reverse debase residue or imann residue at the 5' end of the sense strand, wherein the targeting group is linked to an adjacent reverse debase residue or imann residue via a thiophosphate bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc). In some embodiments, the 5' end of the sense strand includes a reverse debase residue, wherein the reverse debase residue is linked to an adjacent nucleotide at the 5' end of the sense strand nucleotide sequence via a thiophosphate bond. In some embodiments, the sense strand further includes a targeting group attached to a reverse debasement residue at the 5' end of the sense strand, wherein the targeting group is attached to an adjacent reverse debasement residue via a thiophosphate bond, and optionally the targeting group is N-acetylgalactosamine (GalNAc), each strand being independently 21 nucleotides in length. In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO: 1, and is provided in any of Tables 1-3.

[0067] According to another aspect of the present invention, a double-stranded RNA (dsRNA) agent for inhibiting MAPT expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to the MAPT RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, and wherein the sequence contained in the antisense strand can be represented by formula (II):

[0068]

[0069] Where: each N F Represents nucleotides with 2'-fluorine modification; each N M1 N M2 N M3 N M4 N M5 and N M6 Each N represents a modified or unmodified nucleotide independently; L Each nucleotide can independently represent a modified or unmodified nucleotide but not a 2'-fluorinated nucleotide, and n is an integer from 0 to 7.

[0070] In some embodiments, N M1 N M2 N M3 N M4 N M5 and N M6 It contains only three 2'-fluorine modified nucleotides. In some embodiments, N M1 N M2 N M3 N M4 N M5 and N M6 Independently representing a 2'-fluorine modified nucleotide, a 2'-O-methyl nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic. In some embodiments, the modified nucleotide is the modified nucleotide as defined above. In some embodiments, each N L Independently represents 2'-O-methyl nucleotide.

[0071] In some embodiments, N M2 N M3 and N M5 Each independently represents a 2'-fluorinated nucleotide, optionally, N M1 N M4 and N M6 Independently represents nucleotides modified with 2'-O-methyl.

[0072] In some embodiments, N M2 N M4 and N M5 Each independently represents a 2'-fluorinated nucleotide, optionally, N M1 N M3 and N M6 Independently represents nucleotides modified with 2'-O-methyl.

[0073] In some embodiments, N M1 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, optionally, N M2 N M4 and N M5 Independently represents nucleotides modified with 2'-O-methyl.

[0074] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, optionally, N M1 N M4 and N M5 Independently represents nucleotides modified with 2'-O-methyl.

[0075] In some embodiments, N M2 N M4 and N M6 Each independently represents a 2'-fluorinated nucleotide, optionally, N M1 N M3 and N M5 Independently represents nucleotides modified with 2'-O-methyl.

[0076] In some embodiments, N M1 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 Nucleotides that represent UNA modifications, optionally, N M2 and N M4 Independently represents nucleotides modified with 2'-O-methyl.

[0077] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 Nucleotides that represent UNA modifications, optionally, N M1 and N M4 Independently represents nucleotides modified with 2'-O-methyl.

[0078] In some embodiments, N M2 N M4 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 Nucleotides that represent UNA modifications, optionally, N M1 and N M3 Independently represents nucleotides modified with 2'-O-methyl.

[0079] In one embodiment, the first N L Nucleotides (counting from the 5' end) are VPU It has the following structure: .

[0080] In one embodiment, the first N L Nucleotides (starting from the 5' end) are selected from the following groups:

[0081]

[0082] , or its stereoisomers or racemates.

[0083] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0084] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO:1 and is provided in any of Tables 1-3.

[0085] According to another aspect of the present invention, a double-stranded RNA (dsRNA) agent for inhibiting MAPT expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand contains a region complementary to the MAPT RNA transcript, wherein the complementary region contains at least 15 consecutive nucleotides, and wherein the dsRNA duplex contains a sequence represented by formula (III):

[0086]

[0087] Wherein: each chain is approximately 18 to 30 nucleotides in length; each N F and N′ F Independently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4 N M5 N M6 、N′ N1 and N′ N2 Each N independently represents a modified or unmodified nucleotide; L and N′ L Each nucleotide represents a modified or unmodified nucleotide independently, but not a nucleotide with 2'-fluorine modification, and m′, n′, and n are each an independent integer from 0 to 7.

[0088] In some embodiments, N M1 N M2 N M3 N M4 N M5 and N M6 There are only three 2'-fluorinated nucleotides, N′ N1 and N′ N2 It includes only one 2'-fluorinated nucleotide. In some embodiments, each N′ L and N L Independently represents 2'-O-methylnucleotide. In some embodiments, N M1 N M2 N M3 N M4 N M5 and N M6Independently represents a 2'-fluorine modified nucleotide, a 2'-O-methyl nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate mimic. In some embodiments, N′ N1 and N′ N2 Independently referred to as 2'-fluorine modified nucleotides and 2'-O-methyl nucleotides. In some embodiments, the modified nucleotide is the modified nucleotide as defined above.

[0089] In some embodiments, m′ is 2 and n′ is 4, m′ is 2 and n′ is 6, or m′ is 2 and n′ is 2. In some embodiments, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2. In some embodiments, m′ is 0 and n′ is 4, or m′ is 0 and n′ is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0090] In some embodiments, N′ N1 Independently represents nucleotides modified with 2'-fluorine.

[0091] In some embodiments, N' N2 Independently represents nucleotides modified with 2'-fluorine.

[0092] In some embodiments, N M2 N M3 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0093] In some embodiments, N M2 N M4 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0094] In some embodiments, N M1 N M3 and N M6 Each of them independently represents a nucleotide modified with 2'-fluorine.

[0095] In some embodiments, N M2 N M3 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0096] In some embodiments, N M2 N M4 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0097] In some embodiments, N M1 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and NM5 This indicates a nucleotide modified with UNA.

[0098] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 This indicates a nucleotide modified with UNA.

[0099] In some embodiments, N M2 N M4 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 This indicates a nucleotide modified with UNA.

[0100] In one embodiment, the first N L Nucleotides (counting from the 5' end) are VPU It has the following structure: .

[0101] In one embodiment, the first N L Nucleotides (starting from the 5' end) are selected from the following groups:

[0102]

[0103] , or its stereoisomers or racemates.

[0104] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand, preferably, the targeting group being selected from GLO-1 to GLO-16 and GLS-1. To GLS-16 Any of the above, more preferably, the targeting group is the aforementioned GLS-15 In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the antisense strand includes a reverse debasement residue at the 3' end. In some embodiments, the sense strand includes one or two reverse debasement residues and / or one or two Imann residues at the 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently include a reverse debasement residue. In some embodiments, the 3' and 5' ends of the sense strand each independently contain an Imann residue. In some embodiments, the sense strand contains two reverse debasement residues at the 3' and 5' ends, and the residue at the 3' or 5' end further binds to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the sense strand contains two imann residues at the 3' and 5' ends, and the residues at the 3' or 5' end further bind to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments, at least one strand includes a 3' overhang of at least two nucleotides. In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO:1 and is provided in any of Tables 1-3.

[0105] According to one aspect of the invention, a composition is provided comprising any of the embodiments described above regarding the dsRNA agents of the invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration, intrathecal administration, or intravenous (IV) administration.

[0106] According to another aspect of the invention, a cell is provided comprising any embodiment of the dsRNA agent described above. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0107] According to another aspect of the present invention, a method for inhibiting MAPT gene expression in cells is provided, the method comprising: (i) preparing cells containing an effective amount of any embodiment of the dsRNA agent of the present invention described above or any embodiment of the composition of the present invention described above. In some embodiments, the method further comprises: (ii) maintaining the prepared cells for a sufficient time to allow degradation of the mRNA transcript of the MAPT gene, thereby inhibiting the expression of the MAPT gene in the cells. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intravenously. In some embodiments, the cells are located in a subject, and the dsRNA agent is administered to the subject intrathecally. In some embodiments, the method further comprises assessing the inhibition of the MAPT gene after administration of the dsRNA agent to the subject, wherein the assessment method comprises: (i) determining one or more physiological characteristics of a MAPT-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the MAPT-related disease or condition and / or control physiological characteristics of the MAPT-related disease or condition, wherein the comparison indicates the presence or absence of one or more of the subject's MAPT gene expression inhibition. In some embodiments, the physiological characteristic is one or more of the following: MAPT mRNA levels and MAPT protein levels in blood, serum, or cerebrospinal fluid samples. Decreased MAPT expression can also be indirectly assessed by measuring a reduction in MAPT biological activity, for example, in other pathologies associated with elevated MAPT levels, preferably a decrease in one or more of the MAPT mRNA and MAPT protein levels in blood, serum, or cerebrospinal fluid samples.

[0108] According to another aspect of the present invention, a method for inhibiting MAPT gene expression in a subject is provided, the method comprising administering to the subject an effective amount of an embodiment of the above-described dsRNA agent of the present invention or an embodiment of the above-described composition of the present invention. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In some embodiments, the method further comprises: assessing MAPT gene inhibition after administration of the dsRNA agent, wherein the assessment method comprises: (i) determining one or more physiological characteristics of a MAPT-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the MAPT-related disease or condition and / or control physiological characteristics of the MAPT-related disease or condition, wherein the comparison indicates the presence or absence of one or more of MAPT gene expression inhibition in the subject. In some embodiments, MAPT gene expression may be assessed based on the level or level change of any variable associated with MAPT gene expression, such as MAPT mRNA level, MAPT protein (tau) level. Decreased MAPT expression can also be indirectly assessed by measuring reduced MAPT bioactivity, for example, in other pathological conditions associated with elevated MAPT levels, preferably in blood, serum, or cerebrospinal fluid samples. Phenotypic, Tauopathies present with varying degrees of motor, cognitive, and behavioral impairments. Tauopathies are a heterogeneous group of progressive neurodegenerative diseases characterized by the presence of Tau aggregates in the brain.

[0109] According to another aspect of the present invention, a method for treating a disease or condition associated with the presence of the MAPT protein (tau) is provided, the method comprising: administering to a subject an effective amount of any of the above-described embodiments of the dsRNA agent of the present invention or any of the above-described compositions of the present invention to inhibit MAPT gene expression. In some embodiments, the disease is a MAPT-related disorder. In some embodiments, the disorder is associated with an abnormality in the Tau protein encoded by the MAPT gene. In some embodiments, the abnormality in the Tau protein encoded by the MAPT gene leads to Tau accumulation in the subject's brain. In some embodiments, the MAPT-related disorder is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is a familial disease. In some embodiments, the neurodegenerative disease is a sporadic disease. In some embodiments, the diseases, symptoms, or conditions associated with MAPT are selected from the group consisting of: tau proteinosis, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), FTLD with MAPT mutation, FTD with motor neuron disease, non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantics (PPA-S), primary progressive aphasia-language reduction (PPA-L), and Parkinson's disease-related frontotemporal dementia associated with chromosome 17 (FTDP-17). Pick's disease (PiD), argyrophilic cereal disease (AGD), corticobasal degeneration (CBD), multisystem tauinopathy with Alzheimer's disease (MSTD), white matter tauinopathy with glial cell inclusions (FTLD with GGIs), neurofibrillary tangles (NFT) dementia, amyotrophic lateral sclerosis (ALS), corticobasal ganglia syndrome (CBS), progressive supranuclear palsy (PSP), Parkinson's disease, post-encephalitis Parkinson's disease, Down syndrome (DS), Huntington's disease, myotonic dystrophy type 1, and Niemann-Pick disease.

[0110] In some embodiments, the method further includes administering an additional treatment regimen to the subject. In some embodiments, the additional treatment regimen includes treating MAPT-related diseases or conditions. In some embodiments, the additional treatment regimen includes administering one or more MAPT antisense polynucleotides of the present invention to the subject, administering a non-MAPT dsRNA therapeutic agent to the subject, and inducing behavioral modification in the subject. In some embodiments, the additional therapeutic agent is selected from the group consisting of oligonucleotides, small molecules, monoclonal antibodies, polyclonal antibodies, and peptides. Exemplary additional therapeutic agents include, for example, monoamine inhibitors, such as xenazine, deuterated benzodiazepine, and reserpine; anticonvulsants, such as valproic acid (Depakote, Depakene, Depacon) and clonazepam (Klonopin); antipsychotics, such as risperidone and haloperidol; and antidepressants, such as paroxetine (Paxil).

[0111] In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In still other embodiments, the dsRNA agent is administered to the subject intracisionally. Non-limiting examples of intracisional administration include injection into the cerebellomedullary cistern (cerebellomedullary cistern) via suboccipital puncture. In some embodiments, the method further includes determining the efficacy of the administered double-stranded RNA (dsRNA) agent in the subject.

[0112] In some embodiments, the method for determining the treatment effect on a subject includes: (i) determining one or more physiological characteristics of the subject’s MAPT-related disease or condition, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the MAPT-related disease or condition, wherein the comparison results indicate one or more of the presence, absence and effect level of administration of a double-stranded RNA (dsRNA) agent to the subject.

[0113] In some embodiments, MAPT gene expression can be assessed based on the level or level changes of any variable associated with MAPT gene expression, such as MAPT mRNA levels in subjects, MAPT(tau) protein levels, or symptoms and features including memory loss, motor dysfunction, and / or an increase in the number and / or volume of neurofibrillary inclusions.

[0114] In another aspect of the invention, a method is provided to reduce the level of MAPT protein in a subject compared to a pre-treatment baseline level, comprising administering to the subject an effective amount of any of the above-described dsRNA agents of the invention or any of the above-described compositions of the invention to reduce MAPT gene expression levels. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or intravenously. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In some embodiments, the dsRNA agent is administered to the subject intracisionally. Non-limiting examples of intracisional administration include injection into the cerebellomedullary cistern via suboccipital puncture.

[0115] According to another aspect of the invention, a method is provided to alter the physiological characteristics of a subject's MAPT-related disease or condition compared to baseline pre-treatment physiological characteristics, the method comprising administering to the subject an effective amount of any of the above-described embodiments of the dsRNA agent of the invention or any of the above-described compositions of the invention to alter the physiological characteristics of the subject's MAPT-related disease or condition. In some embodiments, the dsRNA agent is administered subcutaneously or intravenously to the subject. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In still other embodiments, the dsRNA agent is administered to the subject intracisionally. Non-limiting examples of intracisional administration include injection into the cisternamagna via suboccipital puncture. In some embodiments, the physiological characteristics and symptoms are one or more of the following: the subject's MAPT mRNA level, MAPT protein level, or varying degrees of motor, cognitive, and behavioral impairments in the subject, or symptoms and characteristics of the subject including memory loss, motor dysfunction, and / or an increase in the number and / or volume of neurofibrillary inclusions. In some embodiments, administration of dsRNA resulted in a reduction of MAPT gene mRNA in one or more of the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, and spinal cord.

[0116] According to another aspect of the invention, the above-described dsRNA agent is provided for a method of treating a disease or condition associated with the presence of the MAPT protein. In some embodiments, the disease or condition is one or more of the following: tau proteinosis, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), FTLD with MAPT mutation, FTD with motor neuron disease, non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantics (PPA-S), primary progressive aphasia-reduction (PPA-L), Parkinson's disease associated with chromosome 17 with frontotemporal dementia (FTDP-17), Pickle Dementia PiD, argyrophilic cereal disease (AGD), corticobasal ganglia degeneration (CBD), multisystem tauinopathy with Alzheimer's disease (MSTD), white matter tauinopathy with globular inclusions (FTLD with GGIs), neurofibrillary tangles (NFT) dementia, amyotrophic lateral sclerosis (ALS), corticobasal ganglia syndrome (CBS), progressive supranuclear palsy (PSP), Parkinson's disease, post-encephalitis Parkinson's disease, Down syndrome (DS), Huntington's disease, myotonic dystrophy type 1, and Niemann-Pick disease.

[0117] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting MAPT protein expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one consecutive nucleotide is a modified nucleotide, and wherein the nucleotide sequence of the agent is approximately 80% complementary over its entire length to an equivalent region of the nucleotide sequence of SEQ ID NO:1. In some embodiments, the equivalent region is any of the target regions of SEQ ID NO:1, and the complementary sequence is a sequence provided in one of Tables 1-3. In some embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1-3.

[0118] According to another aspect of the invention, a composition comprising any of the above-described antisense polynucleotide agents is provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating MAPT-related diseases or conditions. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous injection, intrathecal administration, or intravenous administration.

[0119] According to another aspect of the invention, a cell comprising any of the aforementioned antisense polynucleotide agents is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0120] According to another aspect of the present invention, a method for inhibiting MAPT gene expression in cells is provided, the method comprising: (i) preparing cells containing an effective amount of the antisense polynucleotide agent of any of the above embodiments. In some embodiments, the method further comprises (ii) maintaining the cells prepared in (i) for a sufficient time to allow degradation of the mRNA transcript of the MAPT gene, thereby inhibiting the expression of the MAPT gene in the cells.

[0121] According to another aspect of the present invention, a method for inhibiting MAPT gene expression in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described antisense polynucleotide agents.

[0122] According to another aspect of the present invention, a method for treating a disease or condition associated with the presence of the MAPT protein is provided, the method comprising administering to a subject an effective amount of any of the above-described antisense polynucleotide agents or any of the above-described compositions of the present invention to inhibit MAPT gene expression. In some embodiments, the disease or condition is one or more of the following: tau proteinopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), FTLD with MAPT mutation, FTD with motor neuron disease, non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantics (PPA-S), primary progressive aphasia-reduction (PPA-L), Parkinson's disease associated with chromosome 17 with frontotemporal dementia (FTDP-17), Pick's disease (PiD), argyrophilic cereal disease (AGD), corticobasal degeneration (CBD), multisystem tau proteinopathy with Alzheimer's disease (MSTD), and white matter tau disease with glial cell inclusions (with GGI). The diseases mentioned include FTLD, neurofibrillary tangles (NFT) dementia, amyotrophic lateral sclerosis (ALS), corticobasal ganglia syndrome (CBS), progressive supranuclear palsy (PSP), Parkinson's disease, post-encephalitis Parkinson's disease, Down syndrome (DS), Huntington's disease, myotonic dystrophy type 1, and Niemann-Pick disease.

[0123] According to another aspect of the invention, a method is provided to reduce MAPT protein levels in a subject compared to baseline pre-treatment levels. This method includes administering to the subject an effective amount of any of the above-described antisense polynucleotide agents of the invention or any of the above-described compositions of the invention to reduce MAPT gene expression levels. In some embodiments, the antisense polynucleotide agent is administered subcutaneously or intravenously to the subject. In some embodiments, the antisense polynucleotide agent is administered to the subject intrathecally. In still other embodiments, the antisense polynucleotide agent is administered to the subject intracisionally. A non-limiting example of intracisional administration includes injection into the cerebellomedullary cistern via suboccipital puncture.

[0124] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting MAPT gene expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is complementary to about 80% or about 85% of the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length.

[0125] According to another aspect of the invention, a method is provided to alter the physiological characteristics of a subject's MAPT-related disease or condition compared to baseline pre-treatment physiological characteristics, the method comprising administering to the subject an effective amount of any of the above-described embodiments of the antisense polynucleotide agent or any of the above-described compositions of the invention to alter the physiological characteristics of the subject's MAPT disease or condition. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously or intravenously. In some embodiments, the antisense polynucleotide agent is administered to the subject intrathecally. In still other embodiments, the antisense polynucleotide agent is administered to the subject intracisionally. Non-limiting examples of intracisional administration include injection into the cerebellomedullary cistern via suboccipital puncture. In some embodiments, the physiological characteristics and symptoms are one or more of the following: the subject's MAPT mRNA level, MAPT protein level, or varying degrees of motor, cognitive, and behavioral impairments in the subject, or symptoms and characteristics of the subject including memory loss, motor dysfunction, and / or an increase in the number and / or volume of neurofibrillary inclusions.

[0126] Brief description of the sequence

[0127] SEQ ID NO:1 and SEQ ID NO:2 (reverse complementary sequences) are human MAPT mRNA [NCBI reference sequence: NM_001377265.1].

[0128] SEQ ID NO:3 and SEQ ID NO:4 (reverse complementary sequences) are human MAPT mRNA [NCBI reference sequence: NM_016841.5].

[0129] SEQ ID NO:5 and SEQ ID NO:6 (reverse complementary sequences) are mouse MAPT mRNA [NCBI reference sequence: NM_001038609.3].

[0130] SEQ ID NO:7 and SEQ ID NO:8 (reverse complementary sequences) are Macacamulatta (rhesus monkey) MAPT mRNA [NCBI reference sequence: XM_015119954.2].

[0131] SEQ ID NO:9-500, 1839-1842, 2137-2281, and 2427-2571, as shown in Table 1, are sense chain sequences.

[0132] As shown in Table 1, SEQ ID NO:501-992, 1843-1846, 2427-2426, and 2572-2716 are antisense sequences.

[0133] Table 2 shows the chemically modified sequence of SEQ ID NO:993-1484.

[0134] As shown in Table 3, SEQ ID NO:1485-1596, 1597-1838, 1847-2136 are represented by “GLX-__” at the 3' or 5' end of each sense strand. Detailed Implementation

[0135] This invention also includes RNAi agents that inhibit MAPT gene expression, such as, but not limited to, double-stranded (ds) RNAi agents. This invention also includes compositions comprising a MAPT RNAi agent and methods of using the composition. The MAPT RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including hepatocytes. Pharmaceutical compositions of the present invention may comprise at least one dsRNA MAPT agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a GalNAc-containing delivery compound. MAPT RNAi agents delivered to cells can inhibit MAPT gene expression, thereby reducing the activity of the MAPT protein product of this gene in cells. The dsRNAi agents of the present invention can be used to treat MAPT-related diseases and conditions.

[0136] In some embodiments of the invention, reducing MAPT expression in cells or subjects treats diseases or conditions associated with MAPT expression in cells or subjects. Non-limiting examples of diseases and conditions that can be treated by reducing MAPT activity include: alleviating or improving one or more symptoms associated with unwanted or excessive MAPT expression, or alleviating or improving varying degrees of motor, cognitive, and behavioral impairments. "Treatment" may also mean extended survival compared to expected survival without treatment.

[0137] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it should be understood that the term “ribonucleotide” or “nucleotide” can also refer to modified nucleotides (described further below) or substitutional portions. Those skilled in the art will understand that guanine, cytosine, adenine, and uracil can be substituted with other portions without significantly altering the base-pairing properties of the oligonucleotide containing such substituted portions. For example, but not limited to, nucleotides containing inosine as a base can pair with nucleotides containing adenine, cytosine, or uracil. Therefore, in the nucleotide sequences of this invention, nucleotides containing uracil, guanine, or adenine can be substituted with nucleotides containing, for example, inosine. Sequences containing such substitutional portions are embodiments of this invention.

[0138] As used herein, the “MAPT” gene, also known as “DDPAC,” “FTDP-17,” “MAPTL,” “MSTD,” “MTBT1,” “MTBT2,” “PPND,” “PPP1R1O3,” “TAU,” “Tau-PHF6,” “tau-40,” and “microtubule-associated protein tau,” refers to the gene encoding a protein called microtubule-associated protein tau (MAPT) from any vertebrate or mammalian source, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise stated. As used herein, the terms “MAPT protein” and “tau protein” are used interchangeably. The term also refers to fragments and variants of natural MAPT that retain at least one in vivo or in vitro activity of natural MAPT. The reference sequence of the human MAPT gene and its complete coding sequence can be found, for example, in GenBank Ref Seq Accession No. NM_001377265.1 (Homo sapiens MAPT isoform 9, SEQ ID NO: 1; reverse complement sequence, SEQ ID NO: 2); GenBank Accession No. NM_016841.5 (human MAPT isoform 4, SEQ ID NO: 3; reverse complement sequence, SEQ ID NO: 4); GenBank Accession No. NM_001038609.3 (mouse MAPT, SEQ ID NO: 5; reverse complement sequence, SEQ ID NO: 6); and GenBank Accession No. XM_015119954.2 (rhesus monkey (Macaca mulatta) isoform 1, SEQ ID NO: 7; reverse complement sequence, SEQ ID NO: 8). More instances of MAPT mRNA sequences are readily available through public databases such as GenBank, UniProt, Ensembl, and OMIM.

[0139] As described in this article, MAPT refers to the gene encoding microtubule-associated tau protein. The MAPT gene, encoding tau protein, is located on chromosome 17q21 and contains 16 exons. The major tau protein in the human brain is encoded by 11 exons. Exons 2, 3, and 10 can be alternately spliced, resulting in six tau isoforms ranging in size from 352 to 441 amino acids. Tau protein can be divided into four domains: an N-terminal domain, a proline-rich domain, a microtubule-binding domain, and a C-terminal domain. The N-terminal domain plays a role in providing spacers between microtubules. The proline-rich domain plays a role in cell signaling and interaction with protein kinases. The microtubule-binding domain is important for binding to microtubules. The C-terminal domain is crucial in regulating microtubule polymerization. Under normal conditions, tau is in an unfolded and phosphorylated state. In the abnormal form found in the brains of patients with primary tau protein disorders, tau protein is hyperphosphorylated and aggregates, forming a β-sheet conformation. The binding of tau to microtubules is regulated by the phosphorylation / dephosphorylation balance of tau. Excessive phosphorylation of tau leads to the loss of tau-microtubule interaction, resulting in microtubule dysfunction, impaired axonal transport, and tau fibrosis.

[0140] This article describes how to prepare and use compositions containing MAPT single-stranded (ssRNA) and dsRNA to inhibit MAPT gene expression, as well as compositions and methods for treating diseases and conditions caused by or regulated by MAPT gene expression. The term "RNAi" is also known in the art and may be referred to as "siRNA".

[0141] As used herein, the term "RNAi" refers to an agent that contains RNA and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region is a contiguous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA), which is the product of primary transcription of RNA processing. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-guided cleavage in or near that portion. The length of the target sequence can be 8-30 nucleotides (including end values), 10-30 nucleotides (including end values), 12-25 nucleotides (including end values), 15-23 nucleotides (including end values), 16-23 nucleotides (including end values), or 18-23 nucleotides (including end values), including all shorter lengths within each of these ranges. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the target sequence is 9 to 26 nucleotides in length (including end values), encompassing all subranges and integers therebetween. For example, although not intended to be limiting, in some embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, and this sequence is completely complementary or at least substantially complementary to at least a portion of the RNA transcript of the MAPT gene. Some aspects of the invention include pharmaceutical compositions comprising one or more MAPT dsRNA agents and a pharmaceutically acceptable carrier. In some embodiments of the invention, MAPT RNAi, as described herein, inhibits the expression of the MAPT protein.

[0142] As used herein, "dsRNA agents" refers to compositions containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. While not wishing to be limited to a particular theory, the dsRNA agents of this invention may function through RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC)) or through any alternative mechanisms or pathways. Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, for example, (Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the contents of which are incorporated herein by reference in their entirety]. Gene silencing procedures known in the art can be used in conjunction with the disclosures provided herein to suppress MAPT expression.

[0143] The dsRNA agents disclosed herein consist of a sense strand and an antisense strand, including but not limited to: short interfering RNA (siRNA), RNAi agents, microRNAs (miRNAs), short hairpin RNAs (shRNAs), and cleavage enzyme substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. dsRNA double-stranded structures of varying lengths are known in the art for the purpose of inhibiting target gene expression. For example, dsRNAs with double-stranded structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). Shorter or longer RNA double-stranded structures are also known in the art to effectively induce RNA interference. In some embodiments, the sense and antisense strands may be the same or different in length. In some embodiments, the length of each strand does not exceed 40 nucleotides. In some embodiments, the length of each strand does not exceed 30 nucleotides. In some embodiments, the length of each strand does not exceed 25 nucleotides. In some embodiments, the length of each strand does not exceed 23 nucleotides. In some embodiments, the length of each strand does not exceed 21 nucleotides. In some embodiments, the lengths of the sense and antisense strands of the RNAi agent can be 15 to 49 nucleotides, respectively. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, the length of both the sense and antisense strands is 21 nucleotides. In some embodiments, the sense strand and antisense strand are complementary or substantially complementary, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The MAPT dsRNA in some embodiments of the present invention may comprise at least one strand of at least 21 nt in length, or may have a shorter double strand based on one of the sequences listed in any of Tables 1-3, but it may also be effective to reduce one, two, three, or four nucleotides at one or both ends compared to the dsRNA sequences listed in Tables 1-3.In some embodiments of the present invention, the MAPT dsRNA agents may have partial sequences of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one or more sequences in Tables 1-3, and their ability to inhibit MAPT gene expression differs from the inhibition level produced by dsRNA containing the complete sequence by no more than 5%, 10%, 15%, 20%, 25% or 30%. The sense sequences, antisense sequences and duplexes disclosed in Tables 1-3 may be referred to herein as “parental” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, lengthened, or, including substitutions, as described herein, and the resulting sequences retain all or at least a portion of the efficacy of their parental sequences in the methods and compositions of the present invention. The sense and antisense strands included in the dsRNA of the present invention are independently selected. The term “independently selected” as used herein means that each of two or more similar elements can be selected independently of the selection of other elements. For example, although not intended to be limiting, the “elements” of the two strands to be included in the duplex may be selected when preparing the dsRNA of the present invention. One selected element, the meaningful sequence, may be SEQ ID NO: 1001 (as shown in Table 2), while the other selected element, the antisense sequence, may be SEQ ID NO: 1247, or may be SEQ ID NO: 1247 modified, shortened, lengthened, and / or including one, two, or three substitutions compared to its parent sequence SEQ ID NO: 1247. It should be understood that the duplexes of the present invention do not necessarily include both the meaningful and antisense sequences shown in pairs in Tables 1-3. Each meaningful and antisense sequence in the table is immediately followed by its SEQ ID NO.

[0144] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or administered to a subject. For example, the antisense strand listed in any of the tables in Tables 1-3 may be a composition or a composition administered to a subject to reduce MAPT peptide activity and / or MAPT gene expression in the subject. Table 1 shows the core extension base sequences of the antisense and sense strands of certain MAPT dsRNA agents. Single-stranded antisense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded antisense agents” or “antisense polynucleotide agents”. Single-stranded sense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded sense agents” or “sense polynucleotide agents”. The term “base sequence” is used herein to refer to a polynucleotide sequence that is not chemically modified or delivers a compound. For example, the sense strand CACACGGACGCUGGCCUGAAA (SEQ ID NO:17) shown in Table 1 is the base sequence of SEQ ID NO:1001 in Table 2 and SEQ ID NO:1486 in Table 3, where SEQ ID NO:1001 and SEQ ID NO:1486 show their chemical modifications and delivery compounds. The sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified as “sense strand SS#”; a single-stranded antisense sequence can be identified as “antisense strand AS#”; and a double-stranded sequence including both sense and antisense strands can be identified as “double-stranded AD# / AV#”.

[0145] Table 1 includes sense and antisense strands and provides identifiers for bistrands formed by sense and antisense strands in the same row of Table 1. In some embodiments of the invention, the antisense sequence includes nucleobase u or nucleobase a at antisense sequence position 1. In some embodiments of the invention, the antisense sequence includes nucleobase u at antisense sequence position 1. As used herein, the term "matching position" in sense and antisense strands refers to the "paired" position in each strand when the two strands are bistranded. For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 21 of the antisense strand are at a "matching position". In yet another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are at a matching position. In yet another non-limiting example, in both the 18-base sense strand and the 18-base antisense strand, the nucleus at position 1 of the sense strand and position 18 of the antisense strand are matched, and the nucleus at position 4 of the sense strand and position 15 of the antisense strand are matched. Those skilled in the art will understand how to identify the matching positions in the sense and antisense strands that are or will be double-stranded and paired.

[0146] The first column in Table 1 represents a bichain AV# containing the meaningful and antisense sequences from the same row. For example, Table 1 discloses a bichain designated as bichain AV03736.um, which contains the meaningful chain SEQ ID NO:17 and the antisense chain SEQ ID NO:509. Therefore, each row in Table 1 identifies a bichain of the present invention, each bichain containing the meaningful and antisense sequences shown in the same row, and the assignment identifier for each bichain is shown in the first column of the row.

[0147] In some embodiments of the methods of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex comprising at least one base sequence listed in Table 1, including sequence modifications of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24. In some embodiments of the methods of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a GalNAc compound or GLS-15. Delivery of compounds.

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174] Table 2 shows the antisense and sense sequences of certain chemically modified MAPT RNAi agents of the present invention. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double strand in the row identified in the first column of Table 2, and includes sequence modifications in the sense and antisense sequences shown in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as "bound to") a compound capable of delivering the RNAi agent to the cells and / or tissues of a subject. Non-limiting examples of delivery compounds that can be used in certain embodiments of the present invention are compounds containing GalNAc or containing GLS-15. The compounds are listed in Table 2. The first column in Table 2 represents the double-stranded AV# of the base sequences shown in Table 1. Table 2 discloses the double-stranded AV# and also shows the chemical modifications contained in the sense and antisense sequences of the double strands. For example, Table 1 shows the single-stranded base sequences SEQ ID NO:17 (sense) and SEQ ID NO:509 (antisense), which together constitute a double-stranded bilayer, identified as: double-stranded AV#AV03736.um. Table 2 lists the double-stranded AV#AV03736, indicating that the double strands of SEQ ID NO:1001 and SEQ ID NO:1247 contain the base sequences of SEQ ID NO:17 and SEQ ID NO:509, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in the third and sixth columns, respectively. The “sense strand SS#” in the second column of Table 2 is the assignment identifier for the sense sequence (including modifications) shown in the third column of the same row. The “Ansense Chain AS#” in the fifth column of Table 2 is the assignment identifier for the ansense sequence (including modifications) shown in the sixth column.

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188] Table 3 shows the antisense and sense strand sequences of certain chemically modified MAPT RNAi agents of the present invention. In some embodiments of the methods of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the methods of the present invention, RNAi agents having the polynucleotide sequences shown in Table 3 are administered to subjects. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double strand in the row identified in the first column of Table 3, and comprises the sequence modification and / or delivery compound shown in the sense and antisense strand sequences, respectively, in the same row of the third and sixth columns of Table 3. These sequences are used in certain in vivo assay studies described elsewhere herein. In some embodiments of the methods of the present invention, the sequences shown in Table 3 may be attached to (also referred to herein as "bound to") a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, wherein the delivery compound is identified as "GLX-n" on the sense strand in the third column of Table 3. As used herein, "GLX-n" is used to represent "GLS-n". The compound is delivered by either "GLO-n" or "GLS-n" (where "X" can be "S" or "O"), and GLX-0 can be any "GLS-n" that can be attached to the 3' end of the oligonucleotide during synthesis. "GLX-n" and "GLO-n" are used to deliver compounds. As used herein and shown in Table 3, "GLX-n" is used to indicate that the attached GalNAc-containing compound is compound GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, wherein the structure of each compound is provided elsewhere herein. Those skilled in the art will be able to prepare and use the dsRNA compounds of the present invention, wherein the linked delivery compound is GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the doublet AD# assigned to the doublets of the meaningful and antisense sequences in that row. For example, doublet AD# AD01564 is a doublet with the meaningful chain SEQ ID NO:1485 and the antisense chain SEQ ID NO:1541. Each row in Table 3 provides one meaningful chain and one antisense chain, and discloses the doublets of the shown meaningful and antisense chains. The “Sensitive Chain SS#” in the second column of Table 3 is the assignment identifier for the meaningful sequence (including modifications) shown in the third column of the same row. The “Ansense Chain AS#” in column 5 of Table 3 is the assignment identifier for the ansense sequence (including modifications) shown in column 6. Some connections contain “GLO-n” or “GLS-n” with GalNAc. The compound's identifier is displayed as GLS-5. GLS-15 Or GLX-0, and it should be understood that another “GLO-n” or “GLS-n” is also possible. "The compound may be substituted for the compound shown as GLO-0, and the resulting compound is included in the embodiments of the methods and / or compositions of the present invention."

[0189] Table 3 provides the antisense and sense strand sequences of the chemically modified MAPT RNAi agents. All sequences are indicated from 5' to 3'. These sequences were used in certain in vivo assays described elsewhere in this document. The delivery molecules used in in vivo studies are indicated as "GLO-n" or "GLS-n" at the 3' or 5' end of each sense strand. ".

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199] L96 refers to the compound GalNAc3 from Jayaprakash, et al., (2014) J. Am. Chem. Soc., 136, 16958−16961.

[0200]

[0201]

[0202]

[0203] In some embodiments of the invention, the dsRNA (also referred to herein as a “double strand”) is the dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a double strand comprising the sense strand sequence and the antisense strand sequence of that row. In addition to the double strands disclosed in Tables 1-3, it should be understood that in some embodiments, the double strand of the invention may comprise the sense and antisense sequences shown in Tables 1-3, which differ from the sequences shown in Tables 1-3 by zero, one, two, or three nucleotides. Thus, by way of non-limiting example, in some embodiments, the antisense strand in the double strand of the invention may be SEQ ID NO: 1542, 1543, 1544, 1545, 1546, 1547, or 1548, wherein it differs from the nucleotide sequences in SEQ ID NO: 1542, 1543, 1544, 1545, 1546, 1547, or 1548 by zero, one, two, or three nucleotides, respectively.

[0204] It should be understood that the sense and antisense sequences in the double strands of the present invention can be selected independently. Therefore, the dsRNA of the present invention may include the sense and antisense strands of the double strands disclosed in one row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense and antisense strands may include the sequences shown in Tables 1-3, but one or both of the sense and antisense strands may include 1, 2, 3, or more nucleobase substitutions from the parental sequence. In some embodiments, the selected sequence may be longer or shorter than its parental sequence. Therefore, the dsRNA agents included in the present invention may, but do not necessarily, include the exact sequences of the sense and antisense strand pairs disclosed as double strands in Tables 1-3.

[0205] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand contain a region complementary to a MAPT RNA transcript, wherein the complementary region contains at least 15 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally contains a targeting ligand. In some cases, the region complementary to the MAPT RNA transcript contains at least 15, 16, 17, 18, or 19 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by no more than 3 nucleotides. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO:1, and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is completely complementary to any target region of SEQ ID NO:1, and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any of Tables 1-3, and the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence shown in any of Tables 1-3. Some embodiments of the dsRNA agent of the present invention comprise the sense and antisense sequences disclosed as duplexes in any of Tables 1-3. As described herein, it should be understood that the sense and antisense strands in the duplexes of the present invention can be selected independently.

[0206] Mismatch

[0207] Those skilled in the art will know that mismatches in dsRNA are tolerable for efficacy, especially mismatches in the terminal regions of dsRNA. Some mismatches are even more tolerable, for example, mismatches with wobble base pairs G:U and A:C are tolerable for efficacy (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. NucleicAcids Res. 2005 Mar 21;33(5):1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the MAPT dsRNA agent may contain one or more mismatches with the MAPT target sequence. In some embodiments, the MAPT dsRNA agent of the present invention does not contain mismatches. In some embodiments, the MAPT dsRNA agent of the present invention contains no more than one mismatch. In some embodiments, the MAPT dsRNA agent of the present invention contains no more than two mismatches. In some embodiments, the MAPT dsRNA agent of the present invention contains no more than three mismatches. In some embodiments of the present invention, the antisense strand of the MAPT dsRNA agent contains mismatches with the MAPT target sequence, which are not located at the center of the complementary region. In some embodiments, the antisense strand of the MAPT dsRNA agent contains 1, 2, 3, 4 or more mismatches, which are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether a MAPT dsRNA agent containing mismatches with the MAPT target sequence effectively inhibits the expression of the MAPT gene.

[0208] Complementarity

[0209] As used herein, unless otherwise stated, the term "complementarity" when used to describe a first nucleotide sequence (e.g., a sense strand of MAPT dsRNA or targeting MAPT mRNA) relative to a second nucleotide sequence (e.g., an antisense strand of MAPT dsRNA or a single-stranded antisense polynucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide comprising the second nucleotide sequence [forming base-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)] and, under certain conditions, to form a double-stranded or double-helix structure. Other circumstances, such as physiologically relevant conditions that may be encountered in vivo, may also apply. Those skilled in the art will be able to determine the set of conditions most suitable for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, including native or modified nucleotides or nucleotide mimics, at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is independent of modification.

[0210] Complementary sequences, for example, within the MAPT dsRNA described herein, comprise an oligonucleotide or polynucleotide containing a first nucleotide sequence that pairs with an oligonucleotide or polynucleotide containing a second nucleotide sequence along the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as “perfectly complementary” to each other. It should be understood that, in embodiments, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered mismatches for the purposes of this complementarity determination. For example, a MAPT dsRNA agent containing one 19-nucleotide oligonucleotide and another 20-nucleotide oligonucleotide, wherein the longer oligonucleotide contains a 19-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, may still be referred to as “perfectly complementary” for the purposes described herein. Thus, “perfectly complementary” as used herein means that all (100%) bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.

[0211] As used herein, the term "substantially complementary" means that in the hybridized nucleotide sequence pairs, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but not all) of the bases in the first polynucleotide sequence will hybridize with the same number of bases in the second polynucleotide sequence. If the two sequences include one or more mismatched base pairs during hybridization, such as at least 1, 2, 3, 4, or 5 mismatched base pairs, forming a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) while maintaining the ability to hybridize under conditions most relevant to its final application, such as repressing MAPT gene expression via the RISC pathway, then the term "substantially complementary" can be used to refer to the first sequence relative to the second sequence.

[0212] The term "partial complementarity" may be used herein to refer to hybridized nucleobase sequence pairs in which at least 75% (but not all) of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. In some embodiments, "partial complementarity" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide.

[0213] As used in this article, the terms “complementary,” “fully complementary,” “fundamentally complementary,” and “partially complementary” refer to base matching between the sense and antisense strands of a MAPT dsRNA agent, between the antisense strand of a MAPT dsRNA agent and the target MAPT mRNA sequence, or between a single-stranded antisense oligonucleotide and the target MAPT mRNA sequence. It should be understood that the term “antisense strand of a MAPT dsRNA agent” can refer to the same sequence as a “MAPT antisense polynucleotide agent.”

[0214] As used herein, the terms "substantially identical" or "substantially identical" when referring to a nucleic acid sequence mean a nucleic acid sequence that has at least about 85% or more sequence identity with a reference sequence, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. The percentage of sequence identity is determined by comparing two best-aligned sequences in a comparison window. The percentage is calculated by determining the number of positions in the two sequences where the same nucleic acid bases occur to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein. For example, in Tables 1-3. In some embodiments, the sequences disclosed herein are identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, the sequences disclosed herein (e.g., Tables 1-3).

[0215] As used herein, the term "chain containing a sequence" refers to an oligonucleotide containing a nucleotide chain described by a sequence indicated using standard nucleotide nomenclature. The term "double-stranded RNA" or "dsRNA" as used herein refers to an RNAi comprising an RNA molecule or molecular complex having a hybrid double-stranded region containing two antiparallel and substantially or completely complementary nucleic acid strands with "sense" and "antisense" orientations relative to the target MAPT RNA. The double-stranded region can be of any length, as long as it allows for specific degradation of the desired target MAPT RNA via the RISC pathway, but is typically in the range of 9 to 30 base pairs, for example, 15–30 base pairs in length. Considering double strands ranging from 9 to 30 base pairs, the length of the double strand can be within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any subranges therein, including but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, etc. Base pairs, 18-22 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. MAPT dsRNA agents produced in cells by processing with Dicer and similar enzymes are typically 19–22 base pairs in length. One strand of the double-stranded region of the MAPT dsRNA agent contains a sequence substantially complementary to the target MAPT RNA region. The two strands forming the double-stranded structure can originate from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. When the double-stranded region is formed from the two strands of a single molecule, the molecule may have a double-stranded region separated by a single-stranded nucleotide chain (referred to herein as a “hairpin loop”) between the 3’ end of one strand and the 5’ end of the other strand forming the double-stranded structure.In some embodiments of the invention, the hairpin structure comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of a MAPT dsRNA agent consist of separate RNA molecules, these molecules do not need to be, but can be, covalently linked. When the two strands are covalently linked in a manner other than a hairpin loop, the linking structure is called a “connector.” The term “siRNA” is also used herein to refer to the dsRNA agent described herein.

[0216] In some embodiments of the present invention, the MAPT dsRNA agent may include sense and antisense sequences without unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. An end without unpaired nucleotides is called a "blunt end," and there are no nucleotide protrusions. If both ends of the dsRNA agent are blunt ends, the dsRNA is referred to as "blunt-end." In some embodiments of the present invention, the first end of the dsRNA agent is blunt-end; in some embodiments, the second end of the dsRNA agent is blunt-end; and in some embodiments of the present invention, both ends of the MAPT dsRNA agent are blunt-end.

[0217] In some embodiments of the dsRNA reagent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the end of the dsRNA reagent strand has at least one unpaired nucleotide. For example, a nucleotide overhang is present when the 3' end of one strand of the dsRNA extends beyond the 5' end of another strand, or vice versa. The dsRNA may contain at least 1, 2, 3, 4, 5, 6 or more nucleotide overhangs. The nucleotide overhangs may comprise or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). It should be understood that in some embodiments, the nucleotide overhang is located on the sense strand of the dsRNA reagent, on the antisense strand of the dsRNA reagent, or at both ends of the dsRNA reagent, and the nucleotide of the overhang may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides in the overhang are replaced by nucleoside phosphate thioesters.

[0218] As used herein, the terms "antisense strand" or "guide strand" refer to the strand of the MAPT dsRNA agent that includes regions substantially complementary to the MAPT target sequence. The terms "sense strand" or "passenger strand" refer to the strand of the MAPT dsRNA agent that includes regions substantially complementary to the antisense strand region of the MAPT dsRNA agent.

[0219] Modification

[0220] The RNA of the MAPT RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in certain embodiments of the invention can be synthesized and / or modified using methods well established in the art, for example, as described in “Current protocols in Nucleic Acid Chemistry,” Beaucage, SL et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may exist in certain embodiments of the MAPT dsRNA agent of the present invention include, for example, (a) terminal modifications, such as 5' end modifications (phosphorylation, binding, reverse linkage, etc.), 3' end modifications (binding, DNA nucleotides, reverse linkage, etc.); (b) base modifications, such as replacement, removal (de-base nucleotides), or binding of bases with stable bases, unstable bases, or bases paired with bases from an expanded library of bases; (c) sugar modifications (e.g., substitution of sugars in modified RNA compounds, including but not limited to modified RNA (e.g., at the 2' or 4' position of modified RNA); and (d) backbone modifications, including modification or replacement of phosphodiester bonds. In the MAPT of the present invention... Specific examples of useful RNA compounds in certain embodiments of dsRNA agents, MAPT antisense polynucleotides, and MAPT sense polynucleotides include, but are not limited to, RNA comprising a modified backbone or RNA without natural nucleoside internucleotide bonds. As a non-limiting example, RNA with a modified backbone may not have a phosphorus atom in its backbone. RNA without a phosphorus atom in its internucleotide backbone may be referred to as an oligonucleotide. In some embodiments of the invention, the modified RNA has a phosphorus atom in its internucleotide backbone.

[0221] It should be understood that the terms "RNA molecule" or "RNA" or "ribonucleic acid molecule" not only cover RNA molecules expressed or found in nature, but also include RNA analogs and derivatives containing one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules may be modified in their nucleobase structure or ribose-phosphate backbone structure, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double strands. As a non-limiting example, RNA molecules may also include at least one modified ribonucleoside, including but not limited to 2'-O-methyl modified nucleosides, nucleosides containing a 5'-thiophosphate group, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluorinated nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, aminophosphates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the invention, the RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more full-length MAPT dsRNA molecule ribonucleotides, which are modified ribonucleotides. The modifications of each of these plurality of modified ribonucleotides in the RNA molecule need not be identical.

[0222] DsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides may contain one or more independently selected modified nucleotides and / or one or more independently selected nonphosphodiester bonds. In this document, the term "independently selected" as used to refer to selected elements (e.g., modified nucleotides, nonphosphodiester bonds, etc.) means that two or more selected elements may, but do not necessarily, be the same as each other.

[0223] As used herein, “nucleotide base,” “nucleotide,” or “nucleobase” refers to a heterocyclic pyrimidine or purine compound, a standard component of all nucleic acids, including the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. Nucleobases may be further modified to include (but are not limited to): universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases. The terms “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, or a substitute moiety. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be substituted with other moieties without significantly altering the base-pairing properties of oligonucleotides containing nucleotides with such substitute moieties.

[0224] As used herein, "optionally" or "optionally" means that the event or situation described below may occur, but is not guaranteed to occur, including the possibility that the event or situation may or may not occur. As used herein, " or" "It can be attached to any one or more groups according to the scope of the invention as described herein. As used herein, in the chemical structure of the compounds of the present invention, the bond..." This indicates an unspecified configuration; that is, if a chiral isomer exists in the chemical structure, then the bond... It can be " "or" "or" "and" "Two configurations."

[0225] In some embodiments, the modified RNA used in the methods and compositions described herein is considered to be a peptide nucleic acid (PNA) capable of forming the desired double-stranded structure and allowing or mediating the specific degradation of the target RNA via a RISC pathway. In some embodiments of the invention, the MAPT RNA disruptor comprises a single-stranded RNA that interacts with the target MAPT RNA sequence to guide the cleavage of the target MAPT RNA.

[0226] The modified RNA backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (including 3'-alkylphosphonates and chiral phosphonates), phosphonates, aminophosphates (including 3'-aminoaminophosphates and aminoalkylaminophosphates), thiophosphates, thioalkylphosphonates, thioalkyl phosphate triesters, and borophosphates having normal 3'-5' bonds, such 2'-5' linker analogs, and those with reverse polarity (where adjacent nucleoside unit pairs are linked in 3'-5' to 5'-3' or 2'-5' to 5'-2' directions). Various salts, mixed salts, and free acid forms are also included. Methods for preparing phosphorus-containing bonds are conventional in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents, certain modified MAPT antisense polynucleotides, and / or certain modified MAPT sense polynucleotides of the present invention.

[0227] The phosphorus-free modified RNA backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These include backbones with morpholine bonds (partially formed by the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formyl and thioformyl backbones; methyleneformyl and thioformyl backbones; olefin-containing backbones; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones with mixed N, O, S, and CH2 components. Methods for preparing phosphorus-free modified RNA backbones are conventional in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents, certain modified MAPT antisense polynucleotides, and / or certain modified MAPT sense polynucleotides of the present invention.

[0228] In some embodiments of the invention, the RNA mimic comprises MAPT dsRNA, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides, for example, but not limited to: replacing the sugar and nucleoside internucleotide bonds, i.e., the backbone, of the nucleotide units with novel groups. In such embodiments, the base units are retained to hybridize with suitable MAPT nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has shown excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the RNA is replaced by an amide-containing backbone (particularly an aminoethylglycine backbone). Nucleobases are retained and bind directly or indirectly to the aza-nitrogen atoms of the amide portion of the backbone. Methods for preparing RNA mimics are conventional practice in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents of the present invention.

[0229] Some embodiments of the present invention include RNAs with a phosphate thioester backbone and oligonucleotides with a heteroatom backbone, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [wherein the native phosphodiester backbone is represented as -OPO-CH2-]. Methods for preparing RNAs with a phosphate thioester backbone and oligonucleotides with a heteroatom backbone are conventional practices in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents, certain MAPT antisense polynucleotides, and / or certain MAPT sense polynucleotides of the present invention.

[0230] The modified RNA may also contain one or more substituted sugar moieties. The MAPT dsRNA, MAPT antisense polynucleotide, and / or MAPT sense polynucleotide of the present invention may contain one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl; wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted C1 to C2 groups. 10 Alkyl or C2 to C 10 Alkenyl and ynyl groups. Exemplary suitable modifications include O[(CH2)] n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, where n and m are 1 to approximately 10. In other embodiments, the dsRNA at the 2' position includes one of the following: C1 to C 10 Lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, aryl alkyl groups, O-alkylaryl or O-aryl alkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl groups, heterocyclic alkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleaving groups, reporter groups, intercalating agents, groups used to improve the pharmacokinetic properties of MAPT dsRNA agents, or groups used to improve the pharmacodynamic properties of MAPT dsRNA agents, MAPT antisense polynucleotides and / or MAPT sense polynucleotides, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for preparing modified RNA (e.g., the modified RNA described above) are conventional practices in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents of the present invention.

[0231] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the RNA of the MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides of the present invention, particularly at the 3' position of the sugar at the 3' end nucleotide or at the 2'-5' linked MAPT dsRNA, MAPT antisense polynucleotide, or MAPT sense polynucleotide, and at the 5' position of the 5' end nucleotide. The MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides may also have a sugar mimic, for example, replacing the pentofuranose with a cyclobutyl moiety. Methods for preparing modified RNA (e.g., the methods described above) are conventional practice in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides of the present invention.

[0232] As used herein, the terms "5'-phosphate ester" or "5'-phosphate ester analogue" refer to a nucleotide whose 5'-carbon is modified or substituted by a phosphate group or a phosphate analogue. In some embodiments of the invention, the dsRNA contains a phosphate or phosphate analogue at the 5'-terminal nucleotide of the guide strand, wherein the 5'-terminal nucleotide is represented by any of the following specific structures or stereoisomers thereof:

[0233]

[0234]

[0235]

[0236]

[0237] MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides may include nucleobase (generally referred to in the art simply as "bases") modifications or substitutions. "Unmodified" or "natural" nucleobases as used herein include purine bases adenine and guanine, and pyrimidine bases thymine, cytosine, and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and Thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogen (especially 5-bromine), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, and 3-deadenine and 3-deadenine. Other nucleobases known in the art that may be included in certain embodiments of the MAPT dsRNA agent of the present invention can be found, for example: Modified nucleosides in biochemistry, biotechnology and medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; Concise Encyclopedia of Polymer Science and Engineering, pp. 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al.; Applied Chemistry, International Edition, 1991, 30, 613, Sanghvi, YS., Chapter 15; dsRNA Research and Applications, pp. 289-302, Crooke, ST. and Lebleu, B., editors, CRC Press, 1993. Methods for preparing dsRNAs, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides containing nucleobase modifications and / or substitutions (such as those described herein) are conventional practices in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents, MAPT sense polynucleotides, and / or MAPT antisense polynucleotides of the present invention.

[0238] Some embodiments of MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides include RNAs modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety containing an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-inner conformation. The addition of locked nucleic acids to the MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides of the present invention increases stability in serum and reduces off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA agents containing locked nucleic acids, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides are conventional practices in the art, and such methods can be used to prepare certain modified MAPT dsRNA agents of the present invention.

[0239] Some embodiments of the MAPT dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention comprise at least one modified nucleotide, wherein said at least one modified nucleotide comprises: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide comprising a 5'-thiophosphate group, or a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) group, 2'-amino-modified nucleotide, aminophosphate, or nucleotide comprising a non-natural base. In some embodiments, the MAPT dsRNA compound comprises an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0240] Some embodiments of the MAPT dsRNA compound of the present invention, the 3' and 5' ends of a sense polynucleotide and / or the 3' end of an antisense polynucleotide, include at least one modified nucleotide, wherein the at least one modified nucleotide includes: abase nucleotide, ribitol, inverse nucleotide, inverse abase nucleotide, inverse 2'-OMe nucleotide, inverse 2'-deoxy nucleotide. Those skilled in the art know that including abase or inverse abase nucleotides at the ends of oligonucleotides can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the MAPT dsRNA compound includes one or more inverse abase residues (invabs) at the 3' or 5' end, or both the 3' and 5' ends. Exemplary inverse abase residues (invabs) include, but are not limited to, the following structural illustration:

[0241]

[0242] Some embodiments of the MAPT dsRNA compound, the 3' and 5' ends of a sense polynucleotide, and / or the 3' end of an antisense polynucleotide of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: isomannitol nucleotide or a stereoisomer of said isomannitol nucleotide. Specific examples of isomannitol nucleotide or stereoisomers of said isomannitol nucleotide include, but are not limited to:

[0243]

[0244]

[0245] The phrase "Olig" in this context refers to a polynucleotide moiety, where each residue represents an independent polynucleotide. Exemplary isomannitol residues (imann) include, but are not limited to, the following:

[0246] .

[0247] In some embodiments, isomannitol nucleotides may be further conjugated to one or more targeting groups or delivery molecules, such as the GalNAc moiety.

[0248] Some embodiments of the MAPT dsRNA compounds and antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes unlocked nucleic acid (UNA) and / or glycol nucleic acid (GNA). It is known to those skilled in the art that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target properties of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723. doi:10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862–70).

[0249] In some embodiments, the MAPT dsRNA compound includes at least one lipophilic moiety containing saturated or unsaturated C2. 16 Hydrocarbon chain (e.g., linear C16 alkyl or alkenyl). The lipophilic moiety is included in any of the positions provided in this application. In some embodiments, the lipophilic moiety is bound to a nucleobase, sugar moiety, or nucleoside bond of the double-stranded iRNA agent. For example, C 16 Some can bind to the 2'-oxygen of ribonucleotides, as shown in the following structure:

[0250] .

[0251] As used herein, “lipophilic” or “lipophilic moiety” broadly refers to any compound or chemical moiety that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is by the octanol-water partition coefficient logKow, where Kow is the ratio of the concentration of a chemical substance in the octanol phase to its concentration in the aqueous phase in a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it can also be predicted by using coefficients attributed to the structural composition of the chemical substance, which are calculated using first-principles or empirical methods (see, for example, Tetko et al., J. Chem. Inf. Comput. Sci. 41:1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measurement of a substance’s tendency to favor a non-aqueous or oily environment over water (i.e., its hydrophilic / lipophilic balance). In principle, a chemical substance is lipophilic when its logKow exceeds 0.

[0252] Another modification that may be included in the RNA of certain embodiments of the MAPT dsRNA agent, MAPT antisense polynucleotide, and / or MAPT sense polynucleotide of the present invention includes chemically linking one or more ligands, portions, or conjugates to the RNA to enhance one or more properties of the MAPT dsRNA agent, MAPT antisense polynucleotide, and / or MAPT sense polynucleotide, respectively. Non-limiting examples of properties that can be enhanced include: activity of the MAPT dsRNA agent, MAPT antisense polynucleotide, and / or MAPT sense polynucleotide; cellular distribution; delivery of the MAPT dsRNA agent; pharmacokinetic properties of the MAPT dsRNA agent; and cellular uptake of the MAPT dsRNA agent. In some embodiments of the present invention, the MAPT dsRNA agent comprises one or more targeting groups or linking groups, which, in certain embodiments of the MAPT dsRNA agent of the present invention, are conjugated to a sense chain. Non-limiting examples of targeting groups are compounds comprising N-acetylgalactosamine (GalNAc). Non-limiting examples of targeting groups are compounds comprising a lipophilic moiety. The terms “targeting group,” “targeting agent,” “linker,” “targeting compound,” “delivery molecule,” “delivery compound,” and “targeting ligand” are used interchangeably herein. In some embodiments of the invention, the MAPT dsRNA agent comprises a targeting compound conjugated to the 5' end of the sense strand. In some embodiments of the invention, the MAPT dsRNA agent comprises a targeting compound conjugated to the 3' end of the sense strand. In some embodiments of the invention, the MAPT dsRNA agent comprises a targeting group containing GalNAc. In some embodiments of the invention, the MAPT dsRNA agent does not include a targeting compound conjugated to one or both of the 3' and 5' ends of the sense strand. In some embodiments of the invention, the MAPT dsRNA agent does not include a GalNAc-containing targeting compound conjugated to one or both of the 5' and 3' ends of the sense strand.

[0253] Other targeting agents and linkers are well known in the art. For example, targeting agents and linkers that can be used in certain embodiments of the present invention include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), bile acids (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as beryl-S-triphenylmethylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 1993, 1994, 1995 ... 20:533-538), aliphatic chains, such as dodecyl glycol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, such as hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamines or polyethylene glycol chains (Manoharan et al.). (Al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexanocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0254] Some embodiments of compositions comprising MAPT dsRNA agents, MAPT antisense polynucleotides, and / or MAPT sense polynucleotides may include ligands that alter the distribution, targeting, etc., of the MAPT dsRNA agent. In some embodiments of compositions comprising the MAPT dsRNA agent of the present invention, the ligand increases affinity for selected targets (e.g., molecules, cells or cell types, compartments, such as cell or organ compartments, tissues, organs, or body regions) compared to species where such ligands are absent. Ligands that can be used in the compositions and / or methods of the present invention can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-ethylene glycol) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphonazine. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide polyamines, peptide mimicry polyamines, dendritic polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.

[0255] The ligands included in the compositions and / or methods of the present invention may contain a targeting group, non-limiting examples of which are cell or tissue targets, such as lectins, glycoproteins, lipids, or proteins, such as antibodies that bind to specific cell types (e.g., kidney cells or hepatocytes). The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0256] Other examples of ligands include dyes, intercalators (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, tecosafrine, safeline), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), and lipophilic molecules such as cholesterol, bile acids, adamantine, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-hexadecylglycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)lithocholic acid, etc. Cholestyric acid, dimethoxytriphenylmethyl or phenoxazine) and peptide conjugates (e.g., tentacledopod peptide, Tat peptide), alkylating agents, phosphates, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraza macrocyclic Eu3+ complexes), dinitrophenyl, HRP or AP.

[0257] The ligands included in the compositions and / or methods of the present invention may be proteins, such as glycoproteins or peptides, molecules having a specific affinity for an accessory ligand, or antibodies, such as antibodies that bind to a specific cell type (e.g., cancer cells, endothelial cells, cardiomyocytes, or osteocytes). Useful ligands in embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Useful ligands in embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, or polyvalent fucose. Useful ligands in embodiments of the compositions and / or methods of the present invention may be substances capable of increasing the entry of MAPT dsRNA agents into cells, for example, by disrupting the cytoskeleton of the cell, such as by disrupting microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of drug are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0258] In some embodiments, the ligand linked to the MAPT dsRNA of the present invention acts as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to: lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acids, lithocholic acids, dialkyl glycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind serum proteins, etc. Oligonucleotides containing a large number of thiophosphate bonds are also known to bind serum proteins; therefore, short oligonucleotides (e.g., oligonucleotides of about 5, 10, 15, or 20 bases) containing multiple thiophosphate bonds in their main chain can also be used as ligands in the compositions and / or methods of the present invention.

[0259] MAPT dsRNA agent composition

[0260] In some embodiments of the invention, a MAPT dsRNA agent is present in the composition. The compositions of the invention may include one or more MAPT dsRNA agents, and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable markers, etc. Non-limiting examples of potentially useful targeting agents in some embodiments of the method of the invention are agents that direct the MAPT dsRNA agent of the invention to cells to be treated and / or to cells to be treated. The choice of targeting agent will depend on factors such as the nature of the MAPT-related disease or condition and the type of cells to be targeted. In non-limiting examples, in some embodiments of the invention, it may be desirable to direct the MAPT dsRNA agent to hepatocytes and / or to hepatocytes. It should be understood that in some embodiments of the method of the invention, the therapeutic agent comprises a MAPT dsRNA agent having only a delivery agent, such as a delivery agent containing N-acetylgalactosamine (GalNAc), without any additional elements. For example, in some aspects of the invention, the MAPT dsRNA agent can be linked to a delivery compound containing GalNAc and contained in a formulation containing a pharmaceutically acceptable carrier, and then administered to cells or subjects without attaching any detectable markers, targeting agents, etc., to the MAPT dsRNA formulation.

[0261] When the MAPT dsRNA agent of the present invention is applied together with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will understand and be able to select and use agents suitable for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to determine the location of the MAPT dsRNA agent in cells and tissues, and can be used to determine the location of cells, tissues, or organs containing a therapeutic composition having been applied in the methods of the present invention. Procedures for attaching and using labeling agents (e.g., enzyme labeling, dyes, radiolabeling, etc.) are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is attached to one or both of the sense polynucleotides and antisense polynucleotides contained in the MAPT dsRNA agent.

[0262] Delivery of MAPT dsRNA drugs and MAPT antisense polynucleotide drugs

[0263] Some embodiments of the method of the present invention involve delivering a MAPT dsRNA agent into cells. As used herein, the term "delivery" refers to facilitating or enabling cellular uptake or absorption. Absorption or uptake of the MAPT dsRNA agent can occur through unassisted diffusion or active cellular processes, or through the use of a delivery agent, targeting agent, etc., that may be associated with the MAPT dsRNA agent of the present invention. Delivery methods suitable for the method of the present invention include, but are not limited to, in vivo delivery, wherein the MAPT dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the present invention, the MAPT dsRNA agent is attached to a delivery agent.

[0264] Non-limiting examples of methods that can be used to deliver MAPT dsRNA agents to cells, tissues, and / or subjects include: MAPT dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of various diseases and conditions, such as, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. Details of the various delivery methods can be found in the following publications: Nicam, RR & KR Gore (2018) Nucleic Acid Ther, 28 (4), 209-224 Aug 2018; Springer AD & SF Dowdy (2018) Nucleic Acid Ther. Jun 1; 28(3):109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, JK et al., (2014) J. Am. Chem. Soc. 136:16958-16961, all of which are incorporated herein by reference.

[0265] Some embodiments of the present invention include the use of lipid nanoparticles (LNPs) to deliver the MAPT dsRNA agents of the present invention to cells, tissues, and / or subjects. LNPs are commonly used for in vivo delivery of MAPT dsRNA agents, including therapeutic MAPT dsRNA agents. One advantage of using LNPs or other delivery agents is that they increase the stability of the MAPT RNA agent when delivering it to a subject. In some embodiments of the present invention, the LNP comprises a cationic LNP carrying one or more MAPT RNAi molecules of the present invention. The LNP containing the MAPT RNAi molecule is administered to a subject, and the LNP and its attached MAPT RNAi molecule are absorbed by cells via endocytosis. Their presence leads to the release of RNAi-triggered molecules, thereby mediating RNAi.

[0266] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the MAPT dsRNA agent of the present invention to cells, tissues, and / or subjects is a drug containing GalNAc, which is linked to the MAPT dsRNA agent of the present invention and delivers the MAPT dsRNA agent to cells, tissues, and / or subjects. Examples of certain additional delivery agents containing GalNAc that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT application: WO2020191183A1 (into the entirety of which is incorporated herein). A non-limiting example of a GalNAc targeting ligand that can be used in the compositions and methods of the present invention to deliver the MAPT dsRNA agent to cells is a cluster of targeting ligands. Examples of targeting ligand clusters presented herein are referred to as: GalNAc ligands having a phosphodiester linkage (GLO) and GalNAc ligands having a thiophosphate linkage (GLS). The term “GLX-n” may be used herein to refer to the linked GalNAc-containing compound, which is the following compound GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, wherein the structure of each compound is shown below, wherein the attachment position of the GalNAc targeting ligand to the RNAi agent of the present invention is on the far right of each ligand (shown as "⸾"). It should be understood that any RNAi and dsRNA molecule of the present invention can be linked to GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 , GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, GLO-1 to GLO-16 and GLS-1 To GLS-16 The structure is shown below.

[0267]

[0268]

[0269]

[0270]

[0271] In some embodiments, the above-described isomannitol nucleotides may be further conjugated to one or more GalNAc targeting ligands. Specific examples of isomannitol nucleotides conjugated to GalNAc targeting ligands include, but are not limited to:

[0272] The phrase “olig” in this context refers to a polynucleotide moiety, where each individual nucleotide independently represents a polynucleotide portion.

[0273] In some embodiments of the invention, in vivo delivery may also be performed using β-glucan delivery systems, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. MAPT RNAi agents can also be introduced into cells in vitro using methods known in the art, such as electroporation and lipid transfection. In some embodiments of the methods of the invention, MAPT dsRNA is delivered without a target agent. These RNAs can be delivered as “naked” RNA molecules. As a non-limiting example, the MAPT dsRNA of the invention may be administered to a subject to treat a subject with MAPT-related diseases or conditions, such as cardiovascular disease, wherein the pharmaceutical composition comprises an RNAi agent but does not include a target agent (e.g., a GalNAc targeting compound).

[0274] In addition to certain delivery methods described herein, it should be understood that RNAi delivery methods (such as, but not limited to, those described herein and those used in the art) may be used in conjunction with embodiments of the MAPT RNAi agents and treatments described herein.

[0275] The MAPT dsRNA agents of the present invention can be administered to subjects in a quantity and manner that effectively reduces the level and activity of MAPT peptides in cells and / or subjects. In some embodiments of the methods of the present invention, one or more MAPT dsRNA agents are administered to cells and / or subjects to treat diseases or conditions associated with MAPT expression and activity. In some embodiments, the methods of the present invention include administering one or more MAPT dsRNA agents to subjects requiring such treatment to alleviate diseases or conditions associated with MAPT expression in the subjects. The MAPT dsRNA agents or MAPT antisense polynucleotide agents of the present invention can be administered to reduce MAPT expression and / or activity in one or more cells in vitro, ex vivo, and in vivo.

[0276] In some embodiments of the invention, the level of MAPT peptides in cells is reduced, thereby decreasing their activity, by delivering (e.g., introducing) a MAPT dsRNA agent or a MAPT antisense polynucleotide agent into cells. Targeting agents and methods can be used to facilitate the delivery of a MAPT dsRNA agent or a MAPT antisense polynucleotide agent to specific cell types, cell subtypes, organs, spatial regions, and / or intracellular subcellular regions within a subject. In some methods of the invention, a MAPT dsRNA agent can be administered alone or in combination with one or more other MAPT dsRNA agents. In some embodiments, two, three, four, or more independently selected MAPT dsRNA agents are administered to the subject.

[0277] In some embodiments of the invention, a MAPT dsRNA agent is administered to a subject in conjunction with one or more additional treatment regimens for treating MAPT-related diseases or conditions. Non-limiting examples of additional treatment regimens include: administration of one or more MAPT antisense polynucleotides of the invention, administration of a non-MAPT dsRNA therapeutic agent, and behavioral modification. The additional treatment regimens may be administered before, simultaneously with, and after administration of the MAPT dsRNA agent of the invention at one or more times. It should be understood that, as used herein, "simultaneously," "within 0.5 minutes," "within 0.10 minutes," "within 0.30 minutes," "within 0.45 minutes," and "within 0.60 minutes," "0" refers to the time at which the MAPT dsRNA agent of the invention is administered to the subject. Non-limiting examples of non-MAPT dsRNA therapeutics include: monoamine inhibitors such as xenazine, deuterated butylazine, and reserpine; anticonvulsants such as valproic acid (Depakote, Depaakene, Depacon) and clonazepam; antipsychotics such as risperidone and haloperidol; and antidepressants such as paroxetine. These and other therapeutics and behavioral modifiers are known in the art for treating MAPT-related diseases or conditions in subjects and can be administered to subjects in combination with the administration of one or more MAPT dsRNA agents of the present invention to treat MAPT-related diseases or conditions. The MAPT dsRNA agent of the present invention, administered to cells or subjects to treat MAPT-related diseases or conditions, can act synergistically with one or more other therapeutic agents or activities and enhance the effectiveness of one or more therapeutic agents or activities and / or enhance the effectiveness of the MAPT dsRNA agent in treating MAPT-related diseases or conditions.

[0278] The treatment methods of the present invention include the administration of MAPT dsRNA agents, which can be used before the onset of and / or while the MAPT-related disease or condition is present, including the early, middle, and late stages of the disease or condition, and all times before and after these stages. The methods of the present invention can also be used to treat subjects who have previously been treated with one or more other therapeutic agents and / or activities for the MAPT-related disease or condition, which have been unsuccessful, had a low success rate, and / or are no longer successful in treating the subject's MAPT-related disease or condition.

[0279] vector-encoded dsRNA

[0280] In some embodiments of the invention, a vector can be used to deliver MAPT dsRNA agents into cells. The MAPT dsRNA agent transcription unit can be contained in a DNA or RNA vector. The preparation and use of vectors encoding transgenes to deliver sequences into cells and / or subjects is well known in the art. Vectors can be used in the methods of the invention to result in transient expression of MAPT dsRNA, for example, for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or longer, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or more. The length of transient expression can be determined using conventional methods, based on elements such as, but not limited to, the selected specific vector construct and the target cells and / or tissues. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative vectors. Transgenes can also be constructed to allow their inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0281] The MAPT dsRNA agent, whether single-stranded or multi-stranded, can be transcribed from a promoter on an expression vector. When expressing two separate strands to produce, for example, dsRNA, two separate expression vectors can be co-introduced into the cell using methods such as transfection or infection. In some embodiments, each separate strand of the MAPT dsRNA agent of the present invention can be transcribed from a promoter contained on the same expression vector. In some embodiments of the present invention, the MAPT dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the MAPT dsRNA agent has a stem and loop structure.

[0282] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. The expression vectors useful in the embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the MAPT dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells removed from the subject and then reintroduced into the subject, or by any other means that allows for the introduction of the desired target cells.

[0283] Viral vector systems that may be included in embodiments of the method include, but are not limited to: (a) adenovirus vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) piconemavirus vectors; (i) poxvirus vectors, such as orthopoxviruses, e.g., vaccinia virus vectors or fowlpox viruses, e.g., canary pox or fowlpox; and (j) helper-dependent or enterovirus-free adenoviruses. Constructs for recombinant expression of MAPT dsRNA agents may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. The use of viral vector systems, as well as promoters and enhancers, etc., is conventional in the art and may be used in conjunction with the methods and compositions described herein.

[0284] Some embodiments of the present invention include the delivery of MAPT dsRNA agents into cells using a viral vector. Various adenovirus-based delivery systems are conventionally used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that can be used in the methods of the present invention are: AAV vectors, poxviruses (e.g., vaccinia virus), modified ankara virus (MVA), NYVAC, and fowlpox (e.g., chickenpox or canarypox).

[0285] Some embodiments of the present invention include a method for delivering a MAPT dsRNA agent into cells using a vector, and such a vector may be located in a pharmaceutically acceptable carrier that may, but does not necessarily, include a sustained-release matrix into which a gene delivery vector is embedded. In some embodiments, a vector for delivering MAPT dsRNA can be generated from recombinant cells, and the pharmaceutical compositions of the present invention may include one or more cells that generate a MAPT dsRNA delivery system.

[0286] Pharmaceutical compositions of MAPT dsRNA or ssRNA drugs

[0287] Some embodiments of the present invention include pharmaceutical compositions using a MAPT dsRNA agent or a MAPT antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing a MAPT dsRNA agent or a MAPT antisense polynucleotide agent can be used in the methods of the present invention to reduce MAPT gene expression and MAPT activity in cells, and can be used to treat MAPT-related diseases or conditions. Such pharmaceutical compositions can be formulated according to the route of administration. Non-limiting examples of formulations for delivery methods are: formulations for subcutaneous delivery, formulations for systemic administration via parenteral delivery, formulations for intravenous (IV) delivery, formulations for intrathecal delivery, formulations for direct delivery to the brain, etc. Administration of the pharmaceutical compositions of the present invention to deliver a MAPT dsRNA agent or a MAPT antisense polynucleotide agent into cells can be performed in one or more ways, such as: topically (e.g., via a transdermal patch), pulmonaryly, for example, by inhalation or blowing of powder or aerosol, including via a nebulizer; intratracheally, intranasally, epidermally and transdermally, orally or parenterally. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous, for example, via an implanted device; or intracranial, for example, via intraparenchymal, intrathecal, or intraventricular administration. MAPT dsRNA agents or MAPT antisense polynucleotide agents can also be delivered directly to target tissues, such as directly to the liver, directly to the kidneys, etc. It should be understood that "delivery of MAPT dsRNA agents" or "delivery of MAPT antisense polynucleotide agents" into cells respectively includes the direct delivery of MAPT dsRNA agents or MAPT antisense polynucleotide agents and the expression of MAPT dsRNA agents in cells from encoding vectors delivered to cells, or the presence of MAPT dsRNA or MAPT antisense polynucleotide agents in cells by any suitable means. Methods for preparing and using formulations and delivering repressive RNA are well known and routinely used in the art.

[0288] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceuticalally acceptable carrier” refers to a carrier used for administering the therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. This term explicitly excludes cell culture media. For orally administered pharmaceuticals, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginate are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay gastrointestinal absorption. Pharmaceutical agents contained in pharmaceutical formulations will be further described below.

[0289] As used herein, terms such as “pharmacologically effective amount,” “therapeuticly effective amount,” and “effective amount” refer to the amount of the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention that produces the intended pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of a drug used to treat that disease or condition is the amount required to reduce that parameter by at least 10%. For example, a therapeutically effective amount of the MAPT dsRNA agent or MAPT antisense polynucleotide agent can reduce MAPT peptide levels by at least 10%.

[0290] Effective amount

[0291] The method of the present invention includes, in some aspects, contacting cells with an effective amount of a MAPT dsRNA agent or a MAPT antisense polynucleotide agent to reduce MAPT gene expression in the contacted cells. Some embodiments of the method of the present invention include administering an effective amount of a MAPT dsRNA agent or a MAPT antisense polynucleotide agent to a subject to reduce MAPT gene expression in the subject and treat the subject with a MAPT-related disease or condition. An “effective amount” for reducing MAPT expression and / or treating a MAPT-related disease or condition is an amount necessary or sufficient to achieve the desired biological effect. For example, an effective amount of a MAPT dsRNA agent or a MAPT antisense polynucleotide agent for treating a MAPT-related disease or condition may be an amount necessary to (i) slow or stop the progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is an amount that produces a therapeutic response that prevents and / or treats the disease or condition when administered to a subject requiring treatment for a MAPT-related disease or condition. According to some aspects of the invention, an effective amount is the amount that produces a therapeutic response to prevent and / or treat the MAPT-related disease or condition when administered in combination with or in combination with another treatment method for a MAPT-related disease or condition. In some embodiments of the invention, the biological effect of treating a subject with the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the invention may be improvement and / or complete elimination of symptoms caused by the MAPT-related disease or condition. In some embodiments of the invention, the biological effect is the complete elimination of the MAPT-related disease or condition, for example, by diagnostic testing indicating that the subject has no MAPT-related disease or condition. Non-limiting examples of detectable physiological symptoms include a decrease in MAPT levels in the liver of a subject after administration of the agent of the invention. Other methods known in the art for assessing the status of a MAPT-related disease or condition may be used to determine the effect of the agent and / or method of the invention on the MAPT-related disease or condition.

[0292] Typically, an effective amount of MAPT dsRNA or MAPT antisense polynucleotide agent is determined in clinical trials to reduce MAPT peptide activity to a level sufficient to treat MAPT-related diseases or conditions. In blinded studies, the effective dose is determined for both test and control populations. In some embodiments, the effective amount will result in a desired response, such as a reduction in the amount of MAPT-related disease or condition in cells, tissues, and / or subjects suffering from the disease or condition. Therefore, an effective amount of MAPT dsRNA or MAPT antisense polynucleotide agent for treating MAPT-related diseases or conditions that can be treated by reducing MAPT peptide activity can be an amount that, upon administration, reduces the amount of MAPT peptide activity in a subject to less than the amount present in cells, tissues, and / or subjects without administration of the MAPT dsRNA or MAPT antisense polynucleotide agent. In some aspects of the invention, the MAPT peptide activity and / or MAPT gene expression level present in cells, tissues, and / or subjects unexposed to or not treated with the MAPT dsRNA or MAPT antisense polynucleotide agent of the invention is referred to as a “control” amount. In some embodiments of the method of the present invention, the control dose for the subject is the subject's pre-treatment dose; in other words, the subject's level before administration of the MAPT agent can be the subject's control level and compared with MAPT peptide activity and / or MAPT gene expression levels. MAPT gene expression in the subject is observed after siRNA administration. In the treatment of MAPT-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in cells, tissues, and / or the subject. The reduction or elimination may be temporary or permanent. It should be understood that the status of MAPT-related diseases or conditions can be monitored using methods such as determining MAPT peptide activity, MAPT gene expression, symptom assessment, and clinical testing. In some aspects of the present invention, the desired response to treatment of MAPT-related diseases or conditions is to delay or even prevent the onset of the disease or condition.

[0293] The effective amount of a compound that reduces MAPT peptide activity can also be determined by assessing the physiological effects of administration of a MAPT dsRNA agent or a MAPT antisense polynucleotide agent on cells or subjects (e.g., reduction of MAPT-related diseases or symptoms after administration). The efficacy of the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention (which can be administered as a pharmaceutical compound of the present invention) can be determined using subject assays and / or symptom monitoring, and to determine whether there is a response to treatment. Non-limiting examples include one or more tests for reduced MAPT biological activity known in the art, such as, or other pathologies associated with elevated MAPT levels, particularly in blood, serum, or cerebrospinal fluid samples. Phenotypically, these pathologies exhibit varying degrees of motor, cognitive, and behavioral impairments.

[0294] A method of administering the dsRNA agent or MAPT antisense polynucleotide agent of the present invention to a subject for the treatment of MAPT-related diseases or conditions, wherein the efficacy is determined by assessing and / or monitoring one or more “physiological characteristics” of the subject’s MAPT-related disease or condition. Non-limiting examples of physiological characteristics of MAPT-related diseases or conditions are MAPT mRNA levels, MAPT protein levels, or variable progression of motor, cognitive, and behavioral impairments.

[0295] It should be understood that the amount of MAPT dsRNA or MAPT antisense polynucleotide administered to a subject may be modified, at least in part, based on the determination of the subject's disease and / or condition and / or physiological characteristics. The therapeutic dose may be varied, for example, by increasing or decreasing the amount of MAPT dsRNA or MAPT antisense polynucleotide, by changing the composition of the MAPT dsRNA or MAPT antisense polynucleotide administered, by changing the route of administration, by changing the time of administration, etc. The effective dose of MAPT dsRNA or MAPT antisense polynucleotide will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of any concurrent treatments, the specific route of administration, and other factors within the knowledge and expertise of the healthcare professional. For example, the effective dose may depend on the required MAPT peptide activity and / or MAPT gene expression level for effective treatment of MAPT-related diseases or conditions. Those skilled in the art can determine, based on experience, the effective amount of a specific MAPT dsRNA agent or MAPT antisense polynucleotide agent used in the methods of this invention without excessive experimentation. In conjunction with the teachings provided herein, by selecting from the various MAPT dsRNA agents or MAPT antisense polynucleotide agents of this invention and weighing factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred route of administration, an effective prophylactic or therapeutic regimen for a specific subject can be planned. As used in the embodiments of this invention, the effective amount of the MAPT dsRNA agent or MAPT antisense polynucleotide agent of this invention can be the amount that produces the desired biological effect in the cells upon contact with them.

[0296] It should be recognized that MAPT gene silencing can be determined in any cell expressing MAPT, whether constitutively or through genome engineering, and by any suitable assay. In some embodiments of the invention, by administration of the MAPT dsRNA agent of the invention, MAPT gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the invention, by administration of the MAPT dsRNA agent of the invention, MAPT gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.

[0297] dose

[0298] MAPT dsRNA and MAPT antisense polynucleotide agents are delivered in the pharmaceutical composition at doses sufficient to inhibit MAPT gene expression. In some embodiments of the invention, the dose of the MAPT dsRNA or MAPT antisense polynucleotide agent is in the range of 0.01 to 200.0 mg per kg body weight per day for the recipient, typically in the range of 1 to 50 mg, 5 to 40 mg, 10 to 30 mg, 1 to 20 mg, 1 to 10 mg, or 4 to 15 mg per kg body weight per day (inclusive). For example, MAPT can be administered in the following amounts. dsRNA or MAPT antisense polynucleotide: approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2. 3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4 mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8 mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, Single doses are available in doses of 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, up to 50 mg / kg body weight.

[0299] Various factors can be considered when determining the dosage and timing of administration of the MAPT dsRNA agent of the present invention. The absolute amount of the MAPT dsRNA agent or MAPT antisense polynucleotide agent administered will depend on various factors, including concurrent treatment, number of doses, and individual subject parameters, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved through routine experiments. In some embodiments, a maximum dose may be used, i.e., the highest safe dose based on reasonable medical judgment.

[0300] In some embodiments, the method of the present invention may include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a MAPT dsRNA agent or a MAPT antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., a MAPT dsRNA agent or a MAPT antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. The dose may be administered once daily or multiple times daily, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the MAPT dsRNA agent or MAPT antisense polynucleotide agent may be administered as two, three or more sub-dose at appropriate intervals throughout the day, or even delivered using continuous infusion or a controlled-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention may be administered to the subject once or more daily, once or more weekly, once or more monthly, or once or more annually.

[0301] In some aspects, the methods of the present invention include administering a pharmaceutical compound alone, in combination with one or more other MAPT dsRNA agents or MAPT antisense polynucleotide agents, and / or in combination with other pharmaceutical therapies or treatment activities or regimens administered to a subject suffering from a MAPT-related disease or condition. The pharmaceutical compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may be sterile and contains an amount of MAPT dsRNA agent or MAPT antisense polynucleotide agent that reduces the activity of the MAPT polypeptide to a level sufficient to produce the desired response in a weight or volume unit suitable for administration to the subject. The dose of the pharmaceutical composition, comprising MAPT dsRNA agent or MAPT antisense polynucleotide agent to reduce MAPT protein activity, administered to the subject may be selected according to various parameters, particularly depending on the route of administration and the subject's condition. Other factors include the required duration of treatment. If the subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or the dose may be effectively increased through a different, more localized delivery route).

[0302] treat

[0303] The terms “MAPT-related diseases,” “MAPT-related diseases and conditions,” and “diseases and conditions caused and / or regulated by MAPT” as used in this article are intended to include any disease associated with the MAPT gene or protein. Such diseases may be caused by overproduction of the MAPT protein, mutations in the MAPT gene, aberrant cleavage of the MAPT protein, or aberrant interactions between MAPT and other proteins or other endogenous or exogenous substances. Exemplary MAPT-related diseases include, but are not limited to: tau proteinopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), FTLD with MAPT mutations, FTD with motor neuron disease, non-fluency variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic aphasia (PPA-S), primary progressive aphasia-language reduction aphasia (PPA-L), and Parkinson's disease associated with chromosome 17 with frontotemporal dementia (FTDP-17). Pick's disease (PiD), argyrophilic cereal disease (AGD), corticobasal ganglia degeneration (CBD), multisystem tau disease with Alzheimer's disease (MSTD), white matter tau disease with globular inclusions (FTLD with GGI), neurofibrillary tangles (NFT) dementia, amyotrophic lateral sclerosis (ALS), corticobasal ganglia syndrome (CBS), progressive supranuclear palsy (PSP), Parkinson's disease, post-encephalitis Parkinson's disease, Down syndrome (DS), Huntington's disease, myotonic dystrophy type 1, and Niemann-Pick disease.

[0304] MAPT mutations can lead to frontotemporal dementia, Parkinson's disease, and progressive supranuclear palsy. MAPT mutations and hyperphosphorylated tau protein are also associated with Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and traumatic brain injury, affecting millions worldwide. Under pathological conditions, tau protein undergoes various intramolecular modifications, forming toxic oligotau protein and paired helical filaments. These filaments further assemble into neurofibrillary tangles and deposits in the brain (tauopathies). Because tau regulation is crucial for memory, tauopathies are associated with cognitive impairment. Currently, there are no effective therapies to halt or reverse the progression of Alzheimer's and Parkinson's diseases, both of which are associated with tau protein. Therefore, there is a need for effective and efficient silencing of MAPT mRNA expression, and this application addresses this issue.

[0305] Tauopathies are a heterogeneous group of progressive neurodegenerative diseases characterized by the presence of Tau aggregates in the brain. Phenotypic, Tauo diseases present with varying degrees of motor, cognitive, and behavioral impairments. Tauo diseases include, but are not limited to, Alzheimer's disease, frontotemporal dementia (FTD), and progressive supranuclear palsy (PSP). Tau is a major component of neurofibrillary tangles in neuronal cytoplasm and is a hallmark of Alzheimer's disease. Tau aggregation and deposition are also observed in the brains of approximately 50% of Parkinson's disease patients. FTD includes, but is not limited to, behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), and corticobasal ganglia syndrome (CBS).

[0306] Methods for improving at least one symptom or feature of a neurodegenerative disease are also provided. In some embodiments, the neurodegenerative disease is tau proteinosis, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, or Dravet syndrome. In some embodiments, the neurodegenerative disease is AD or FTD. In some embodiments, symptoms or features include memory loss, motor function loss, and an increase in the number and / or volume of neurofibrillary inclusions.

[0307] As used herein, "symptom" or "characteristic" refers to any physical feature or test result that indicates the presence or extent of a disease or condition. In some embodiments, the symptom is obvious to the subject or a medical professional examining or testing the subject. In some embodiments, the characteristic is obvious in invasive diagnostic tests, including but not limited to autopsies. In some embodiments, the characteristic is obvious in brain MRI scans. In some embodiments, symptoms and characteristics include memory loss, loss of motor function, and / or an increase in the number and / or volume of neurofibrillary inclusions.

[0308] Current treatments aim only to alleviate symptoms and improve patients' quality of life as the disease progresses. Drugs in preclinical or clinical development include active and passive immunotherapies; inhibitors of O-deglycosylation, aggregation, kinases, acetylation, caspases, or tau expression; phosphatase activators; microtubule stabilizers; and modulators of autophagy or proteasome degradation. Biomarkers and assays used in clinical trials to evaluate tau protein disorders include threonine 181-phosphorylated tau protein (pTau), total tau protein (tTau), neurofilament light chains (NfL), and volumetric MRI (vMRI).

[0309] In some aspects of the invention, the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the invention may be administered to a subject at one or more times before or after a diagnosis of a MAPT-related disease or condition. In some aspects of the invention, the subject is at risk of having or developing a MAPT-related disease or condition. A subject at risk of developing a MAPT-related disease or condition is a subject with an increased probability of developing a MAPT-related disease or condition compared to a control risk level. In some embodiments of the invention, the risk level may be statistically significant compared to a control risk level. Subjects at risk may include, for example, subjects who are or will have a pre-existing disease and / or genetic abnormality that makes them more susceptible to a MAPT-related disease or condition than control subjects without a pre-existing disease or genetic abnormality; subjects with a family and / or personal history of a MAPT-related disease or condition; and subjects who have previously received treatment for a MAPT-related disease or condition. It should be understood that pre-existing diseases and / or genetic abnormalities that make a subject more susceptible to a MAPT-related disease or condition may be diseases or genetic abnormalities that have been previously identified as having a higher probability of having a MAPT-related disease or condition.

[0310] It should be understood that MAPT dsRNA agents or MAPT antisense polynucleotide agents can be administered to subjects based on their individual medical conditions. For example, healthcare providers may assess MAPT levels measured in samples obtained from the subject and determine whether it is desirable to reduce the subject's MAPT levels by administering the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention. In this example, MAPT levels can be considered a physiological characteristic of MAPT-related diseases even if the subject has not been diagnosed with one (e.g., the diseases disclosed herein). Healthcare providers may monitor changes in the subject's MAPT levels as a measure of the efficacy of the administered MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention. In a non-limiting example, biological samples (e.g., blood or serum samples) may be obtained from the subject, and the subject's MAPT levels may be determined in the samples. The MAPT dsRNA agent or MAPT antisense polynucleotide agent is administered to the subject, and a blood sample is obtained from the subject after administration, which is used to determine the MAPT level, and the result is compared with the result determined in a sample taken before (before) administration to the subject. A decrease in MAPT levels in subjects in subsequent samples compared to pre-drug levels indicates that the administered MAPT dsRNA agent or MAPT antisense polynucleotide agent is effective in reducing the subject's lipid levels. Certain embodiments of the method of the present invention include treatment adjustment, including administering the dsRNA agent or MAPT antisense polynucleotide agent of the present invention to the subject based at least in part on an assessment of changes in one or more physiological characteristics of a subject's MAPT-related disease or condition. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or MAPT antisense polynucleotide agent of the present invention on the subject can be determined and used to help adjust the amount of the dsRNA agent or MAPT antisense polynucleotide agent of the present invention subsequently administered to the subject. In a non-limiting example, the subject is administered the dsRNA agent or MAPT antisense polynucleotide agent of the present invention, the subject's MAPT level is determined after administration, and based at least in part on the determined level, it is determined that a larger amount of the dsRNA agent or MAPT antisense polynucleotide agent is needed to increase the physiological effect of the administered agent, such as reducing or further reducing the subject's MAPT level. In another non-limiting example, the dsRNA agent or MAPT antisense polynucleotide agent of the present invention is administered to a subject, the subject's MAPT level is determined after administration, and based at least in part on the determined level, a lower amount of the dsRNA agent or MAPT antisense polynucleotide agent needs to be administered to the subject.

[0311] Therefore, some embodiments of the present invention include assessing changes in one or more physiological characteristics resulting from prior treatment in a subject to adjust the amount of the dsRNA agent or MAPT antisense polynucleotide agent of the present invention subsequently administered to the subject. Some embodiments of the method of the present invention include 1, 2, 3, 4, 5, 6 or more physiological characterizations of MAPT-related diseases or conditions to assess and / or monitor the efficacy of administration of the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention, and optionally using the measurement results to adjust one or more of the dosage, dosing regimen, and / or dosing frequency of the dsRNA agent or MAPT antisense polynucleotide agent of the present invention to treat the subject's MAPT-related disease or condition. In some embodiments of the method of the present invention, the desired outcome of administering an effective amount of the dsRNA agent or MAPT antisense polynucleotide agent of the present invention to a subject is a reduction in the subject's MAPT mRNA level, the subject's MAPT protein level, or an alleviation of varying degrees of motor, cognitive, and behavioral impairments. Tauopathies are a class of heterogeneous progressive neurodegenerative diseases pathologically characterized by the presence of Tau aggregates in the brain. Phenotypic, tau protein diseases exhibit varying degrees of motor, cognitive, and behavioral impairments. In some embodiments, the method includes clinically relevant inhibition of MAPT expression, such as evidenced by clinically relevant outcomes following treatment of a subject with an agent that reduces MAPT expression, such as stabilization or inhibition of caudate nucleus atrophy (e.g., assessed by volumetric MRI (VMRI)), stabilization or reduction of neurofilament light chain (NfL) levels in the subject's CSF sample, or reduction of mutant MAPT mRNA or cleaved mutant Tau. Examples include full-length mutant MAPT mRNA or protein and cleaved mutant MAPT mRNA or protein.

[0312] As used herein, when referring to MAPT-related diseases or conditions, the terms “treatment” or “treated” can refer to preventive treatment that reduces the likelihood of a subject developing a MAPT-related disease or condition, or to treatment administered after a subject has developed a MAPT-related disease or condition to eliminate or reduce the level of the MAPT-related disease or condition, prevent the MAPT-related disease or condition from becoming more advanced (e.g., more severe), and / or slow the progression of the subject’s MAPT-related disease or condition compared to untreated subjects, thereby reducing the activity of MAPT peptides in the subject’s body.

[0313] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit MAPT gene expression. As used herein with respect to MAPT gene expression, the terms “inhibit,” “silence,” “reduction,” “downregulation,” and “knockdown” refer to a reduction in the expression of the MAPT gene compared to a control level of transcribed MAPT RNA, expressed MAPT activity, or translated MAPT from mRNA, when a cell, cell group, tissue, organ, or subject is contacted (e.g., treated) with the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention, said expression is measured by one or more of the following: the level of transcribed RNA from the gene, the level of expressed MAPT activity, and the level of translated MAPT polypeptide, protein, or protein subunit from mRNA in the cell, cell group, tissue, organ, or subject in which the MAPT gene is transcribed. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not been contacted (e.g., treated) with the MAPT dsRNA agent or MAPT antisense polynucleotide agent.

[0314] Administration method

[0315] Various routes of administration for MAPT dsRNA or MAPT antisense polynucleotide agents can be used in the methods of the present invention. The specific route of administration chosen depends at least in part on the specific condition being treated and the dose required to achieve the therapeutic effect. Generally, the methods of the present invention can be implemented using any medically acceptable route of administration, i.e., any route that produces a level of effective treatment for MAPT-related diseases or conditions without causing clinically unacceptable adverse reactions. In some embodiments of the present invention, MAPT dsRNA or MAPT antisense polynucleotide agents can be administered via oral, enteral, mucosal, subcutaneous, and / or parenteral routes. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a gastric tube), skin, vagina, rectum, sublingual, and inhalation. Delivery routes of the present invention can include intrathecal, intraventricular, or intracranial. In some embodiments of the present invention, MAPT dsRNA or MAPT antisense polynucleotide agents can be placed in a sustained-release matrix and administered by placing the matrix in the subject. In some aspects of the invention, MAPT dsRNA agents or MAPT antisense polynucleotide agents can be delivered to subject cells using nanoparticles coated with delivery agents targeting specific cells or organelles. Various delivery means, methods, and agents are known in the art. Non-limiting examples of delivery methods and agents are also provided elsewhere herein. In some aspects of the invention, the term "delivery" in relation to MAPT dsRNA agents or MAPT antisense polynucleotide agents can refer to the administration of one or more "naked" MAPT dsRNA agent or MAPT antisense polynucleotide agent sequences to cells or a subject, and in other aspects of the invention, "delivery" refers to administration to cells or a subject via transfection, delivery to a subject of cells containing a MAPT dsRNA agent or MAPT antisense polynucleotide agent, delivery to cells and / or a subject of a vector encoding a MAPT dsRNA agent or MAPT antisense polynucleotide agent, etc. Delivery of MAPT dsRNA agents or MAPT antisense polynucleotide agents using transfection may include administration of a vector to cells and / or a subject.

[0316] In some methods of the present invention, one or more MAPT dsRNA agents or MAPT antisense polynucleotide agents may be administered in formulation form, which may be administered in a pharmaceutically acceptable solution form, typically containing pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the present invention, the MAPT dsRNA agent or MAPT antisense polynucleotide agent may be formulated together with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the MAPT dsRNA agent or MAPT antisense polynucleotide agent may be administered in the form of a pharmaceutical composition. Typically, the pharmaceutical composition comprises a MAPT dsRNA agent or MAPT antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the effectiveness of the bioactivity of the active ingredient (e.g., the ability of the MAPT dsRNA agent or MAPT antisense polynucleotide agent to inhibit MAPT gene expression in cells or subjects). Various methods for administering and delivering dsRNA agents or MAPT antisense polynucleotide agents for therapeutic purposes are known in the art and can be used in the methods of the present invention.

[0317] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in pharmaceuticals, salts should be pharmaceutically acceptable, but non-pharmaceuticalally acceptable salts may be readily used to prepare their pharmaceutically acceptable salts, and are not excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Furthermore, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.

[0318] Some embodiments of the method of the present invention include direct administration of one or more MAPT dsRNA agents or MAPT antisense polynucleotide agents to tissues. In some embodiments, the tissue to which the compound is administered is tissue in which MAPT-related diseases or conditions exist or may occur, a non-limiting example being the heart. Direct tissue administration can be achieved by direct injection or other means. Many orally administered compounds naturally reach and pass through the liver and kidneys, and some embodiments of the treatment method of the present invention include oral administration of one or more MAPT dsRNA agents to a subject. MAPT dsRNA agents or MAPT antisense polynucleotide agents can be administered once, alone or in combination with other therapeutic agents, or can be administered in multiple doses. If administered multiple times, MAPT dsRNA agents or MAPT antisense polynucleotide agents can be administered via different routes. For example, although not intended to be limiting, the first (or first few) doses can be administered subcutaneously, and one or more additional doses can be administered orally and / or systemically. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In some other embodiments, the dsRNA agent is administered to the subject via intracisional administration. Non-limiting examples of intracisional administration include injection into the cerebellomedullary cistern via suboccipital puncture. In some embodiments, dsRNA is administered via intraventricular (ICV), intrastriatal (IS), intravenous (IV), subcutaneous (SQ), or combinations thereof.

[0319] For embodiments of the present invention requiring systemic administration of MAPT dsRNA or MAPT antisense polynucleotide agents, the MAPT dsRNA or MAPT antisense polynucleotide agents can be formulated for parenteral administration by injection, such as by bolus or continuous infusion. The injectable formulation can be in unit dose form, such as ampoules or multi-dose containers, with or without preservatives. MAPT dsRNA agent formulations (also referred to as pharmaceutical compositions) can be in the form of suspensions, solutions, or emulsions in oily or aqueous carriers, and can contain formulations such as suspending agents, stabilizers, and / or dispersants.

[0320] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral carriers include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's solutions, or non-volatile oils. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as Ringer's glucose-based supplements), etc. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Other forms of administration (such as intravenous administration) may use lower doses. If a subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or a higher dose may be used effectively via a different, more localized route of delivery). Multiple doses can be used daily as needed to achieve appropriate systemic or local levels of one or more MAPT dsRNA agents or MAPT antisense polynucleotide agents and to achieve an appropriate reduction in MAPT protein activity.

[0321] In other embodiments, the method of the present invention includes the use of a delivery carrier, such as biocompatible microparticles, nanoparticles, or implants suitable for implantation into a recipient (e.g., a subject). Exemplary biodegradable implants that may be useful according to this method are described in PCT Publication WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for containing biomacromolecules.

[0322] In the method of this invention, non-biodegradable and biodegradable polymer matrices can be used to deliver one or more MAPT dsRNA agents or MAPT antisense polynucleotide agents to a subject. In some embodiments, the matrix may be biodegradable. The matrix polymer may be a natural or synthetic polymer. The polymer can be selected based on the desired release time period, typically from a few hours to a year or longer. Typically, release times between a few hours and three to twelve months can be used. The polymer may optionally be in the form of a hydrogel that can absorb up to about 90% of its weight in water, and may further optionally be crosslinked with multivalent ions or other polymers.

[0323] Generally, in some embodiments of the invention, bioerodible implants can be used to deliver MAPT dsRNA agents or MAPT antisense polynucleotide agents by diffusion or by degradation of a polymer matrix. Exemplary synthetic polymers for such uses are well known in the art. Both biodegradable and bionon-degradable polymers can be used to deliver MAPT dsRNA agents or MAPT antisense polynucleotide agents using methods known in the art. Bioadhesive polymers such as bioerodible hydrogels (see HS Sawhney, CP Pathak and JA Hubell in Macromolecules, 1993, 26, 581-587, whose teachings are incorporated herein by reference) can also be used to deliver MAPT dsRNA agents or MAPT antisense polynucleotide agents to treat MAPT-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems avoid repeated administration of MAPT dsRNA agents or MAPT antisense polynucleotide agents, thereby increasing convenience for subjects and healthcare professionals. Many types of release delivery systems are available and are known to those skilled in the art. (See, for example: U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teachings of each patent are incorporated herein by reference). Additionally, pump-based hardware delivery systems can be used, some of which are suitable for implantation.)

[0324] The use of long-release implants may be suitable for prophylactic treatment of subjects, as well as for subjects at risk of recurrent MAPT-related diseases or conditions. Long-release as used herein refers to an implant constructed and positioned to deliver therapeutic levels of MAPT dsRNA or MAPT antisense polynucleotides for a duration of at least 10, 20, 30, 60, 90 days, six months, one year, or longer. Long-release implants are well known to those skilled in the art and include some of the release systems described above.

[0325] Therapeutic formulations of MAPT dsRNA or MAPT antisense polynucleotide drugs can be prepared by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers, and stored in lyophilized or aqueous forms. [Remington's Pharmaceutical Sciences 21] st[edition, (2006)]. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the doses and concentrations used and include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride, benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl parabens such as methyl or propyl parabens; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues). Polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as TWEEN. ® PLURONICS ® Or polyethylene glycol (PEG).

[0326] Cells, subjects and controls

[0327] The methods of this invention can be used with cells, tissues, organs, and / or subjects. In some aspects of this invention, the subject is a human or vertebrate mammal, including but not limited to dogs, cats, horses, cattle, goats, mice, rats, and primates such as monkeys. Therefore, this invention can be used to treat MAPT-related diseases or conditions in human and non-human subjects. In some aspects of this invention, the subject can be a farm animal, zoo animal, domesticated animal, or non-domesticated animal, and the methods of this invention can be used in veterinary prevention and treatment programs. In some embodiments of this invention, the subject is a human, and the methods of this invention can be used in human prevention and treatment programs.

[0328] Non-limiting examples of subjects to whom this invention can be applied are subjects diagnosed with, suspected of having, or at risk of developing a disease or condition associated with higher than expected MAPT expression and / or activity, also referred to as “elevated MAPT expression levels.” Non-limiting examples of diseases and conditions associated with higher than expected MAPT expression and / or activity are described elsewhere herein. The methods of this invention can be applied to subjects diagnosed with a disease or condition associated with higher than expected MAPT expression and / or activity at the time of treatment, or subjects considered at risk of developing or progressing to a disease or condition associated with higher than expected MAPT expression and / or activity. In some aspects of this invention, the disease or condition associated with higher than expected MAPT expression and / or activity is an acute disease or condition, while in other aspects, the disease or condition associated with higher than expected MAPT expression and / or activity is a chronic disease or condition.

[0329] In one non-limiting example, the MAPT dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of developing memory loss, motor dysfunction, and / or an increase in the number and / or volume of neurofibrillary inclusions, a disease requiring reduction of MAPT expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or progressing to the disease or condition.

[0330] In another non-limiting example, the MAPT dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of developing memory loss, motor dysfunction, and / or an increased number and / or volume of neurofibrillary inclusions, for diseases requiring reduction of MAPT expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or progressing to the disease or condition.

[0331] Cells to which the methods of this invention can be applied include in vitro, in vivo, and isolated cells. Cells may be present in the subject's body, in cultures, and / or suspensions, or in any other suitable state or condition. Cells to which the methods of this invention can be applied may be hepatocytes, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some aspects of this invention, cells to which the methods of this invention can be applied are healthy, normal cells, which are unknown to be diseased cells. In some embodiments of this invention, the cells to which the methods and compositions of this invention are applied are hepatocytes, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, and / or kidney cells. In some aspects of this invention, control cells are normal cells, but it should be understood that cells suffering from a disease or condition may also be used as control cells in certain circumstances, such as when comparing the results of treated cells suffering from a disease or condition with untreated cells suffering from the same disease or condition.

[0332] According to the method of the present invention, the level of MAPT peptide activity can be determined and compared with a control level of MAPT peptide activity. The control can be a predetermined value, which can take various forms. It can be a single cutoff value, such as the median or mean. It can be established based on comparison groups, such as a group with normal MAPT peptide and / or MAPT peptide activity levels and a group with increased MAPT peptide and / or MAPT peptide activity levels. Another non-limiting example of a comparison group can be a group with one or more symptoms or diagnoses of a MAPT-related disease or condition; a group without one or more symptoms or diagnoses of such disease or condition; a group of subjects treated with the siRNA of the present invention; or a group of subjects not treated with the siRNA of the present invention. Typically, the control can be based on seemingly healthy normal individuals or seemingly healthy cells of appropriate age. It should be understood that, in addition to predetermined values, the control according to the present invention can be a material sample tested in parallel with the experimental material. Examples include samples from a control population or control samples generated by manufacturing to be tested simultaneously with the experimental samples. In some embodiments of the present invention, the control may include cells or subjects that have not been exposed to or treated with the MAPT dsRNA agent of the present invention, and in this case, the control level of MAPT peptide and / or MAPT peptide activity may be compared with the level of MAPT peptide and / or MAPT peptide activity in cells or subjects exposed to the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention.

[0333] In some embodiments of the invention, the MAPT peptide level measured for a subject may be a control level, compared with the MAPT peptide level measured for the same subject at different times. In a non-limiting example, MAPT levels are measured in biological samples obtained from subjects who have never received MAPT treatment according to the invention. In some embodiments, the biological sample is a serum sample. The MAPT peptide level measured in the sample obtained from the subject may serve as a baseline or control for the subject. After administering the MAPT dsRNA agent to a subject once or multiple times using the treatment method of the invention, one or more additional serum samples may be obtained from the subject, and the MAPT peptide levels in the subsequent samples may be compared with the subject's control / baseline levels. This comparison can be used to assess the onset, progression, or regression of MAPT-related disease or condition in the subject. For example, a higher MAPT peptide level in a baseline sample obtained from a subject than the level obtained from that subject after administering the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the invention to the same subject indicates regression of the MAPT-related disease or condition and indicates that the administered MAPT dsRNA agent of the invention is effective in treating the MAPT-related disease or condition.

[0334] In certain aspects of the invention, one or more values ​​of MAPT peptide levels and / or MAPT peptide activity determined for a subject can be used as control values ​​for later comparison of MAPT peptide levels and / or MAPT activity in the same subject, thereby allowing assessment of changes in MAPT peptide activity in the subject relative to “baseline.” Therefore, an initial MAPT peptide level and / or initial MAPT peptide activity level may be present and / or determined in the subject, and the methods and compounds of the present invention can be used to reduce MAPT peptide levels and / or MAPT peptide activity levels in a subject, wherein the initial level is used as a control level for that subject.

[0335] Using the method of the present invention, the MAPT dsRNA agent and / or MAPT antisense polynucleotide agent of the present invention can be administered to a subject. The effectiveness of the administration and treatment of the present invention can be assessed when the MAPT peptide level in a serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of the MAPT peptide in a serum sample obtained from the subject at a previous time point, or compared to the level of a non-contact control (e.g., the MAPT peptide level in a control serum sample). It should be understood that both the level of the MAPT peptide and the level of MAPT peptide activity are related to the level of MAPT gene expression. Some embodiments of the method of the present invention involve administering an effective amount of the MAPT dsRNA and / or MAPT antisense agent of the present invention to the subject to inhibit MAPT gene expression and thereby reduce the level of MAPT peptide in the subject and reduce the level of MAPT peptide activity.

[0336] In some embodiments of the invention, the presence, absence, and / or amount (also referred to herein as level) of the MAPT peptide in one or more biological samples obtained from one or more subjects is included. This determination can be used to evaluate the efficacy of the treatment methods of the invention. For example, the methods and compositions of the invention can be used to determine the level of the MAPT peptide in biological samples obtained from subjects previously treated with the MAPT dsRNA agent and / or MAPT antisense agent of the invention. A MAPT peptide level measured in serum samples obtained from treated subjects that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more lower than the pre-treatment MAPT peptide level determined for the subject or the level in a non-contact control biological sample indicates the efficacy level of the treatment administered to the subject.

[0337] In some embodiments of the invention, the physiological characteristics of MAPT-related diseases or conditions identified for a subject can be controlled assays, compared with physiological characteristic assays of the same subject at different time points. In non-limiting examples, physiological characteristics (e.g., reduced MAPT expression) can also be indirectly assessed by measuring a decrease in MAPT biological activity, for example, or other pathologies associated with elevated MAPT levels, preferably in blood, serum, or cerebrospinal fluid samples. Phenotypic, tau protein diseases exhibit varying degrees of motor, cognitive, and behavioral impairments. Tauopathies are a class of heterogeneous, progressive neurodegenerative diseases pathologically characterized by the presence of Tau aggregates in the brain. Phenotypic, tau protein diseases exhibit varying degrees of motor, cognitive, and behavioral impairments. Tauopathies are a class of heterogeneous, progressive neurodegenerative diseases pathologically characterized by the presence of Tau aggregates in the brain.

[0338] The MAPT mRNA level (and / or other physiological characteristics of MAPT disease or condition) measured in samples obtained from the subject can serve as the subject's baseline or control. In the treatment method of the present invention, after administering one or more MAPT dsRNA agents to the subject, one or more additional serum samples may be obtained from the subject, and the MAPT mRNA level and / or MAPT protein level in the subsequent samples are compared with the subject's control / baseline level and / or ratio, respectively. Such comparisons can be used to assess the onset, progression, or regression of MAPT-related disease or condition in the subject. For example, a higher MAPT mRNA level in a baseline sample obtained from the subject than the MAPT mRNA level measured in a sample obtained from the same subject after administration of the MAPT dsRNA agent or MAPT antisense polynucleotide agent of the present invention indicates regression of the MAPT-related disease or condition and demonstrates the efficacy of the administered MAPT dsRNA agent of the present invention in treating the MAPT-related disease or condition.

[0339] In certain aspects of the invention, one or more physiological characteristics of a MAPT-related disease or condition identified in a subject can be used as controls to allow for subsequent comparison of the physiological characteristics of the same subject, thereby allowing assessment of changes in the subject's "baseline" physiological characteristics. Thus, a subject may have and / or have identified initial physiological characteristics, and the methods and compounds of the invention can be used to reduce the level of MAPT peptides and / or MAPT peptide activity in a subject, wherein the initial physiological characteristic measurements serve as a control for that subject.

[0340] Using the method of the present invention, the MAPT dsRNA agent and / or MAPT antisense polynucleotide agent of the present invention can be administered to subjects in an effective amount to treat MAPT disease or condition. The efficacy of administration and treatment of the present invention can be assessed by determining changes in one or more physiological characteristics of MAPT disease or condition. In a non-limiting example, the MAPT mRNA level in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous time point, or compared to non-contact control levels (e.g., MAPT mRNA levels in a control serum sample). It should be understood that the MAPT mRNA level, MAPT protein level, or lipid level in the subject are considered. Some embodiments of the method of the present invention include administering the MAPT dsRNA and / or MAPT antisense agent of the present invention to a subject in an amount that effectively inhibits MAPT gene expression, thereby reducing MAPT mRNA levels, MAPT protein levels, or otherwise positively influencing the physiological characteristics of MAPT-related diseases or conditions in the subject.

[0341] Some embodiments of the present invention include determining the presence, absence, and / or variation of physiological characteristics of MAPT-related diseases or conditions using methods such as, but not limited to: (1) assessing the physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subjects (e.g., but not limited to, acquiring liver images); and (3) performing a physical examination on the subjects. The determination results can be used to evaluate the effectiveness of the treatment methods of the present invention.

[0342] medicine box

[0343] The scope of this invention also includes kits containing one or more MAPT dsRNA agents and / or MAPT antisense polynucleotide agents and instructions for their use in the methods of this invention. The kits of this invention may include one or more MAPT dsRNA agents, MAPT sense polynucleotides, and MAPT antisense polynucleotide agents, which can be used to treat MAPT-related diseases or conditions. Kits containing one or more MAPT dsRNA agents, MAPT sense polynucleotides, and MAPT antisense polynucleotide agents can be prepared for use in the treatment methods of this invention. The components of the kits of this invention may be packaged in an aqueous medium or in lyophilized form. The kits of this invention may include a carrier divided into multiple or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc., and tightly confining them therein. A first container device or a series of container devices may contain one or more compounds, such as MAPT dsRNA agents and / or MAPT sense or antisense polynucleotide agents. The second container device or a series of container devices may contain targeting agents, markers, delivery agents, etc., which may be included as part of MAPTdsRNA agents and / or MAPT antisense polynucleotides in embodiments of the treatment methods of the present invention for administration.

[0344] The kit of the present invention may also include instructions. The instructions are typically in written form and provide guidance on how to implement the treatment contained in the kit and on making decisions based on that treatment.

[0345] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. Those skilled in the art will understand that the present invention is applicable to a variety of compositions and methods.

[0346] Example

[0347] Example 1.

[0348] Phosphamide compound 2

[0349]

[0350] DMTrCl (232 g, 684 mmol, 1.0 eq) in pyridine (400 mL) was added to a solution of isomannitol compound A (100 g, 684 mmol, 1.0 eq) in pyridine (600 mL), and the mixture was stirred at 25°C for 12 hours. LC-MS showed that compound A was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) and then diluted with DCM (500 mL). 2) Extraction: The combined organic phases were washed with brine (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound B (150 g, 48.9% yield) as a yellow solid.

[0351] 1 H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).

[0352] At 25 °C under a N2 atmosphere, 2 H-tetrazole (0.45 M, 436 mL, 1.1 eq) was added dropwise to a solution of compound B (80.0 g, 178 mmol, 1.0 eq) in DCM (800 mL), followed by a solution of compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 eq) in DCM (200 mL). The reaction mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20 °C and poured into ice-cold saturated NaHCO3 (500 mL), and then stirred with DCM (500 mL). 3) Extraction: The combined organic layers were washed with saturated NaHCO3 / salt water at a ratio of 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound 2 (77 g, 119 mmol, yield 66.5%) as a white solid.

[0353] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48- 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).

[0354] Phosphamide compound 1

[0355]

[0356] Under a N2 atmosphere at 0–5°C, compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL). The mixture was stirred at 25°C for 1.0 h. LC-MS showed that compound B was completely consumed, with several new peaks appearing on the LC-MS, indicating that approximately 70.9% of the target compound was detected. The resulting reaction mixture was cooled to -20°C and poured into a cold (0–5°C) saturated NaHCO3 (5.0 mL) solution, and stirred with DCM (5.0 mL). 2) Extraction: The combined organic layers were washed with cold (0-5°C) saturated NaHCO3 / salt water = 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated under vacuum to obtain a residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to give compound 1 (280 mg, 471 μmol, yield 42.3%) as a white solid.

[0357] 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz,2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (brd, J=8.00Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1 H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75Hz, 1H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12 H), 1.07 (br s, 3 H).

[0358] Other phosphoramides can be prepared according to the methods described herein and / or existing technologies (e.g., but not limited to US426,220 and WO02 / 36743).

[0359] Example 2. Preparation of a solid support containing the phosphorusamide monomer of the present invention

[0360]

[0361] Under nitrogen protection, dichloromethane (19.50 kg) was added to a 50 L glass reactor, and stirring was started. The temperature was controlled at 20-30 °C. DMT Trimann (1.47 kg), triethylamine (1.50 kg), 4-dimethylaminopyridine (0.164 kg), and succinic anhydride (1.34 kg) were added to the glass reactor, and the mixture was kept at 20-30 °C for 18 h. A sample was taken, and the reaction was terminated. A saturated sodium bicarbonate solution (22.50 kg) was added to the reaction system, and the mixture was stirred for 10-20 min, resulting in layer separation. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to obtain a residue of 1.83 kg, which was a gray to off-white solid.

[0362] N,N-Dimethylformamide (23.50 kg) was added to a 100 L glass reactor and stirred, with the temperature controlled at 20-30 °C. Under nitrogen protection, the products from the previous step, O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg), were added to the 100 L glass reactor through a solid feed funnel and stirred for 10-30 minutes. The mixture was then discharged into a 50 L zinc drum for later use. Aminomethyl macroporous resin (3.25 kg) (purchased from Tianjin Nankai Synthetic Technology Co., Ltd., batch number HA2X1209, loading 0.48 mmol / g) was added to the 100 L solid-phase synthesis reactor through a solid feed funnel. The temperature was controlled at 20–30 °C. N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc tank in the previous step were added to the solid-phase synthesis reactor. The reaction was maintained at this temperature, and the solid loading was monitored until it reached ≥250 μmol / g. The loading was detected by UV light. The mixture was filtered under nitrogen pressure, and the filter cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg). The filter cake was then left in the reactor. Add CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole, and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) to an 80 L glass reactor and stir for 3-8 min before use. Repeat this operation three times. Cover the reactor and add acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) to a solid-phase synthesis reactor. Purge with nitrogen for 10-30 min and then filter. Repeat this operation four times. Purge the filter cake in the solid-phase synthesis reactor with nitrogen for 2-4 h and then transfer it to a 50 L filter press. Maintain the temperature at 15-30 °C and continue drying. After drying, a yellow to white solid product is obtained, weighing 3.516 kg.

[0363] Isomannitol residues are added to the 5' or 3' end of the oligonucleotide chain by methods well known to those skilled in the art, such as the invab method, and further added to the target group.

[0364] Example 3. Preparation of 5'-phosphate ester mimic phosphoramide

[0365] Preparation of enantiophosphoramide-15-1 and enantiophosphoramide-15-2

[0366]

[0367] Benzoyl chloride (126 g, 893 mmol, 104 mL) was added at 0 °C to a solution containing pyridine (735 g, 9.29 mol, 750 mL) and acetonitrile (1.50 L) with uracil (50.0 g, 446 mmol). The reaction solution was stirred at 20–25 °C for 12.0 h, and TLC showed complete consumption of the uracil compound. The reaction mixture was concentrated under vacuum to obtain a residue. The residue was diluted with cold water (1.0 L) and then with ethyl acetate (1.0 L). 3) Extraction. The combined organic layers were washed with brine (500 mL) and dried with anhydrous sodium sulfate. The residue was purified by column chromatography (SiO2, ethyl acetate / petroleum ether = 1 / 10 to 1 / 1) to give a white solid Phos-15-1A (63 g, yield 65.3%).

[0368] 1 H NMR: EC4783-420-P1N (400 MHz, DMSO- d6 ) δ ppm 7.96 (dd, J =8.4,1.2 Hz, 2 H), 7.76-7.81 (m, 1 H), 7.67 (dd, J =7.6, 5.6 Hz, 1 H), 7.58-7.64(m, 2 H), 5.75 (dd, J =7.6, 1.2 Hz, 1 H).

[0369] Phos-15-SM2 (4.0 g, 47.6 mmol) and compound Phos-15-1A (7.91 g, 36.6 mmol) were dissolved in tetrahydrofuran (80 mL), and triphenylphosphine (11.5 g, 43.9 mmol) and diethyl azodicarboxylate (7.64 g, 43.9 mmol, 7.98 mL) were added. The mixture was stirred at 20–25°C for 16 hours. LC-MS showed that compound Phos-15-1A was completely consumed. The reaction mixture was concentrated under reduced pressure to remove tetrahydrofuran. The residue was diluted with water (80 mL) and then with ethyl acetate (80 mL). 3) Extraction. The combined organic phases were washed with brine (80 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO2, MeOH / DCM = 0 / 10 to 1 / 10) to give compound Phos-15-1B (14 g, crude product) as a white solid.

[0370] Under nitrogen protection, a mixture of compound Phos-15-1B (7.0 g, 9.30 mmol) and m-chloroperoxybenzoic acid (2.27 g, 11.1 mmol, 85% purity) in dichloromethane (70 mL) was heated at 0–5°C. After 16 hours of reaction, TLC showed complete consumption of compound Phos-15-1B and a new spot of low polarity was detected. The pH of the reaction mixture was slowly adjusted to 7–8 with a saturated solution of NaHSO3 and NaHCO3 (1:1), and then thawed with ethyl acetate (70 mL). 3) Extraction: Wash the combined organic phases with brine (700 mL). Dry over anhydrous sodium sulfate and concentrate under reduced pressure. Purify the residue by silica gel column chromatography (100-200 mesh silica gel), eluting with ethyl acetate:petroleum ether (1:30~1:1) to give a white solid compound Phos-15-1C (1.2 g, crude product).

[0371] Compound Phos-15-SM3 (4.0 g, 14.4 mmol) was dissolved in tetrahydrofuran (24.0 mL), and KSAc (1.81 g, 15.8 mmol) and tetrabutylammonium iodide (TBAI, 531.4 mg, 1.44 mmol) were added. The mixture was stirred at 70 °C for 4.0 h. LC-MS showed that the starting material Phos-15-SM3 was completely consumed, and the main peak of the desired target molecular weight was detected. The reaction mixture was cooled and concentrated under reduced pressure. The solid residue was removed by filtration through a short silica gel pad and washed with ethyl acetate. The filtrate was concentrated under vacuum to give a brown oily compound Phos-15-1D (3.50 g, 98.5% yield). Compound Phos-15-1D can be used in the next step without further purification.

[0372] 1 H NMR: EC11950-13-P1B (400 MHz, DMSO- d6 ) δ ppm 3.96-4.07 (m, 4H)3.27 (d, J =14.0 Hz, 2H) 2.40 (s, 3H) 1.22 (t, J =7.2 Hz, 6H).

[0373] Potassium carbonate (1.11 g, 8.05 mmol) and compound Phos-15-1D (1.91 g, 8.45 mmol) were added to an ethanol (15.0 mL) solution of compound Phos-15-1C (1.20 g, 4.02 mmol), and the mixture was stirred at 20–25 °C for 3.0 h. TLC showed that compound Phos-15-1C was completely consumed and a major new spot with high polarity was detected. The resulting reaction mixture was filtered, diluted with water (20 mL), and then thawed with dichloromethane (20 mL). 3) Extraction: The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (SiO2, MeOH / DCM = 1 / 100 to 10 / 100) to give the brown oily compound Phos-15-1E (1.00 g, 65.7% yield, a 1:1 mixture of enantiomers -1E-1 and -1E-2).

[0374] 1 H NMR: EC10615-82-P1N1 (400 MHz, DMSO-d6) δ ppm 11.23 (br s, 1 H), 7.69 (d, J=8.0 Hz, 1 H), 5.58 (dd, J=8.0, 1.6 Hz, 1 H), 4.93 (q, J=8.8 Hz, 1H), 3.96 - 4.17 (m, 5 H), 3.08 - 3.17 (m, 1 H), 3.03 (dd, J=14.0, 2.0 Hz, 2H), 2.38 - 2.47 (m, 1 H), 2.04-2.07 (m, 1 H), 1.82 - 1.90 (m, 1 H), 1.56-1.59(m, 1 H), 1.25 (t, J=6.8 Hz, 6 H).

[0375] Compound Phos-15-1E can be chirally resolved to yield enantiomers Phos-15-1E-1 and Phos-15-1E-2. Resolution conditions: DAICELCHIRALPAK AD 40 mm column, 140 mL / min, ethanol:carbon dioxide = 35:75. It is understood that when enantiomers phosphoramidite-15-1 or phosphoramidite-15-2 are desired, they can be obtained simply by reacting the corresponding enantiomers Phos-15-1E-1 or Phos-15-1E-2 with a phosphorus reagent.

[0376] Under a nitrogen atmosphere at room temperature, a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (P reagent, 956 mg, 3.17 mmol, 1.01 mL) in dichloromethane (0.5 mL) was added to a solution of compound Phos-15-1E (400 mg, 1.06 mmol) and di-isopropylamine-tetrazole salt (199 mg, 1.16 mmol) in dichloromethane (4.0 mL). The mixture was then stirred at 40 °C for 1.0 h. LC-MS showed that compound Phos-15-1E was completely consumed, with several new peaks appearing and approximately 80% of the desired compound detected. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0–5 °C) saturated sodium bicarbonate aqueous solution (10 mL), and stirred with dichloromethane (10 mL). 2) Extraction: The combined organic layers were washed with cold (0-5 °C) saturated sodium bicarbonate / salt water (5 mL / 5 mL), dried over anhydrous sodium sulfate, and concentrated under vacuum to obtain a residue (~2.0 mL). The residue was purified by column chromatography (alkaline Al₂O₃, MeOH / DCM = 1 / 80 to 1 / 40, 0.1% Et₃N) to give phosphoramidite-15 as a colorless oil (350 mg, 0.6 mmol, 57.2% yield, a 1:1 mixture of enantiophosphoramidite-15-1 and enantiophosphoramidite-15-2).

[0377] Enantiomers of phosphoramidine-15-1 or phosphoramidine-15-2 can be obtained from the corresponding Phos-15-1E-1 or Phos-15-1E-2 obtained by SFC separation and purification, following the same process described above.

[0378] δ ppm 11.23 (br s, 1 H), 7.70 (d, J=8.0 Hz, 1 H), 5.55 - 5.60 (m, 1H), 4.89 (q, J=8.4 Hz, 1H), 4.29 - 4.42 (m, 1H), 3.99 - 4.09 (m, 4H), 3.65 -3.84 (m, 2H), 3.53 - 3.62 (m, 2H), 3.35 - 3.41 (m, 1H), 3.02 (dd, J=14.0, 8.0Hz, 2H), 2.76-2.79 (m, 2H), 2.40 - 2.49 (m, 1H), 2.15 - 2.25 (m, 1H), 1.95 -2.07 (m, 1H), 1.65 - 1.75 (m, 1H), 1.23-1.26 (m, 6H) 1.12 - 1.21 (m, 12H).

[0379] The specific preparation methods for Phos-15-1E-1 or Phos-15-1E-2 chiral compounds are as follows:

[0380] System: Waters SFC 150

[0381] Column Name: DAICELCHIRALCEL® AD

[0382] Column type: 250 50 mm 10 mm

[0383] Mobile phase A: Supercritical CO2

[0384] Mobile phase B: EtOH

[0385] Wavelength: 214 nm

[0386] Flow rate: 140 mL / min

[0387] Column temperature: RT

[0388] Injection volume: 7.0 mL; Cycle time: 10.0 min

[0389] Solvents: Supercritical CO2 (food grade), EtOH (redistilled grade).

[0390] Preparation of phosphoramide-43

[0391]

[0392] (3aR, 6aR)-2,2-dimethyltetrahydro-3aH-cyclopentadieno[d][1,3]dioxacyclopenten-4(6aH)-one (phos-43-SM1, 16.2 g, 105 mmol, 1.0 eq), diethyl mercaptomethylphosphonate (19.3 g, 105 mmol, 1.0 eq), and dichloromethane (200 mL) were added to a 500 mL flask. The flask was stirred under nitrogen protection and cooled to 0–5 °C, then triethylamine (1.06 g, 10.5 mmol, 0.1 eq) was added dropwise. After the addition was complete, the temperature was restored to 25 °C and stirred overnight under nitrogen protection. The reaction was confirmed to be complete by LCMS, and the reaction solution was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using EA:DCM = 0%-15% as the eluent. The product was then concentrated under vacuum to obtain 25g of Phos-43-1A as a pale yellow oil, with a yield of 70.3%.

[0393] LCMS: M+H=339.5.

[0394] Phos-43-1A (25 g, 73.9 mmol, 1.0 eq) and ethanol (250 mL) were added to a 500 mL flask. The flask was stirred and cooled to 0–5 °C under nitrogen protection, and then sodium borohydride (3.1 g, 81.3 mmol, 1.1 eq) was added in portions. After the addition was complete, the mixture was stirred at 0–5 °C for 0.5 h. The reaction was confirmed to be complete by LCMS. Ice water (200 mL) was added dropwise to the reaction mixture and stirred for 10 min. The mixture was then extracted twice with dichloromethane (500 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%–5%) as the eluent. The product was then concentrated under vacuum to obtain 24.5 g of Phos-43-1B as a pale yellow oil, with a yield of 97.4%.

[0395] LCMS: M+H=341.5.

[0396] 1 H NMR: (400 MHz, CD3CN), δ ppm 4.67-4.65 (d, J=8.0, 1 H), 4.47-4.42(m, 2 H), 4.08-4.01 (m, 5 H), 3.27-3.25 (m, 1 H), 2.97-2.93 (d, J=16.0, 2 H),2.03-1.99 (m, 1 H), 1.73-1.71 (m, 1 H), 1.38 (s, 3 H), 1.26-1.22 (m, 9 H)

[0397] Phos-43-1B (10 g, 29.4 mmol, 1.0 eq), pyridine (7 g, 88.1 mmol, 3.0 eq), and dichloromethane (100 mL) were added to a 250 mL flask. The flask was stirred under nitrogen protection and cooled to -78 °C. Then, trifluoromethanesulfonic anhydride (12.4 g, 44.1 mmol, 1.5 eq) was added dropwise. After the addition was complete, the mixture was kept at -78 °C and stirred under nitrogen protection for 3 h. The reaction was confirmed to be complete by LCMS. The reaction solution was poured into 50 mL of ice water and then extracted twice with dichloromethane (100 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product Phos-43-1C, which was used directly in the next step.

[0398] LCMS: M+H=473.4

[0399] Phos-43-1C (16 g, 33.8 mmol, 1.0 eq), 3-benzoyluracil (8.8 g, 40.6 mmol, 1.2 eq), cesium carbonate (22 g, 67.7 mmol), and acetonitrile (200 mL) were added to a 500 mL flask. The flask was stirred overnight at 25 °C under nitrogen protection. The reaction was confirmed to be complete by LC-MS. The reaction solution was filtered, and the filtrate was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%-5%) as the eluent. The product was then concentrated under vacuum to obtain 18 g of Phos-43-1D as a brown oily substance, with a yield of 98.7%.

[0400] LCMS: M+H=539.4

[0401] Phos-43-1D (18 g, 33.4 mmol, 1.0 eq) and methanol (180 mL) were added to a 500 mL flask. Ammonia-methanol (180 mL) was added dropwise under nitrogen protection. After the addition was complete, the mixture was stirred at 25 °C under nitrogen protection for 5 h. LC-MS analysis confirmed the reaction was complete. The reaction solution was concentrated under vacuum to obtain the crude product Phos-43-1E, which was directly used in the next step.

[0402] LCMS: M+H=435.4

[0403] Phos-43-1E (14.5 g, 33.4 mmol, 1.0 eq) and dioxane (180 mL) were added to a 500 mL flask. Dioxane hydrochloride (4 M, 180 mL) was added dropwise, and the flask was stirred overnight at 25 °C under nitrogen protection. The reaction was confirmed to be complete by LC-MS. The reaction solution was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%-10%) as eluent. The product was then concentrated under vacuum to obtain 5.2 g of Phos-43-1F as a white solid, with a yield of 39.5%.

[0404] LCMS: M+H=395.4

[0405] Phos-43-1F (5.2 g, 13.2 mmol, 1.0 eq), toluene (100 mL), and acetonitrile (20 mL) were added to a 250 mL flask. Then, cyanomethylenetri-n-butylphosphine (6.4 g, 26.5 mmol, 2.0 eq) was added, and the flask was stirred at 90 °C for 48 h under nitrogen protection. The reaction was confirmed to be complete by LC-MS. The reaction solution was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%-10%) as the eluent. The product was then concentrated under vacuum to give 3.5 g of Phos-43-1G as a white solid, with a yield of 70.5%.

[0406] LCMS: M+H=377.3

[0407] Phos-43-1G (2.0 g, 5.3 mmol, 1.0 eq), anhydrous methanol (20 mL), trimethyl borate (1.1 g, 10.6 mmol, 2.0 eq), methyl orthoformate (0.56 g, 5.3 mmol, 1.0 eq), and sodium bicarbonate (44.5 mg, 0.52 mmol, 0.2 eq) were added to a 250 mL sealed container. The mixture was heated to 120 °C and stirred for 48 h. The container was cooled to room temperature, and the reaction was confirmed to be complete by LCMS. The reaction solution was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%-10%) as the eluent. The product was then concentrated under vacuum to give 1.3 g of Phos-43-1H as a white solid, with a yield of 60%.

[0408] LCMS: M+H=409.4

[0409] Phos-43-1G (0.6 g, 1.47 mmol, 1.0 eq) and anhydrous dichloromethane (10 mL) were added to a 50 mL flask, followed by tetrazolium (0.13 g, 1.76 mmol, 1.2 eq) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.66 g, 2.2 mmol, 1.5 eq). The mixture was stirred at 25 °C for 1 h under nitrogen protection. The reaction was confirmed to be complete by LCMS. The reaction solution was poured into an aqueous sodium bicarbonate solution and extracted twice with dichloromethane (20 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid silica gel column chromatography, eluting with DCM:MeOH:TEA = 0%-5% + 0.2% TEA. Phosphoramide-43 (0.89 g, 100% yield) was obtained by vacuum concentration at 35°C.

[0410] LCMS: M+H=609.6

[0411] 1 H NMR: (400 MHz, CD3CN), δ ppm 8.97 (s, 1 H), 7.43-7.41 (d, J=8.0, 1H), 5.61-5.59 (d, J=8.0, 1 H), 4.76 -4.69 (m, 1 H), 4.44-4.34 (m, 1 H), 4.14-4.04 (m, 5 H), 3.90-3.81 (m, 2 H), 3.69-3.62 (m, 2 H), 3.46 -3.44 (m, 1 H), 3.36-3.33 (d, J=12.0, 3 H), 2.97-2.87 (m, 2 H), 2.77-2.65 (m, 3 H), 1.67-1.56 (m, 1 H), 1.32-1.27 (m, 6 H), 1.24-1.18 (m, 12 H).

[0412] 31 P NMR: (400 MHz, CD3CN), δ ppm 150.03, 148.62; 23.44, 23.24.

[0413] The preparation method of phosphoramide-47 is the same as that of phosphoramide-43, except that the starting material 5-methyluracil is used as the nucleobase.

[0414] Preparation of phosphoramide-45

[0415]

[0416] Magnesium shavings (0.26 g, 10.6 mmol, 10.0 eq) and anhydrous ethanol (40 mL) were added to a 100 mL sealed container. The mixture was heated to 90 °C and stirred for 18 h. The container was cooled to room temperature, and Phos-43-1G (0.4 g, 1.06 mmol, 1.0 eq) was added. The mixture was heated to 90 °C and stirred for 18 h. The container was cooled to room temperature, and LC-MS analysis showed that the reaction was incomplete, with approximately 50% converted to Phos-45-1A. The reaction solution was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using MeOH:DCM = 0%-8% as eluent. The product was then concentrated under vacuum to obtain 0.13 g of Phos-45-1A as a pale yellow oil, with a yield of 29%.

[0417] LCMS: M+H=423.4

[0418] Phos-45-1A (0.11 g, 0.26 mmol, 1.0 eq) and anhydrous dichloromethane (3 mL) were added to a 50 mL flask, followed by tetrazolium (22 mg, 0.31 mmol, 1.2 eq) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.12 g, 0.4 mmol, 1.5 eq). The mixture was stirred at 25 °C for 1 h under nitrogen protection. The reaction was confirmed to be complete by LCMS. The reaction solution was poured into an aqueous sodium bicarbonate solution and extracted twice with dichloromethane (10 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid silica gel column chromatography, eluting with DCM:MeOH:TEA = 0%-3% + 0.2%TEA. Phos-45 (0.1 g, yield 61.7%), a yellow oily substance of phosphorus amide, was obtained by vacuum concentration at 35°C.

[0419] LCMS: M+H=623.5

[0420] 1H NMR: (400 MHz, CD3CN), δ ppm 7.42-7.40 (d, J=8.0, 1 H), 5.61-5.59(d, J=8.0, 1 H), 4.73-4.68 (m, 1 H), 4.34-4.30(m, 1 H), 4.12-4.06 (m, 5 H),3.88-3.83 (m, 2 H), 3.68-3.65 (m, 2 H), 3.58-3.42 (m, 2 H), 2.97-2.86 (m, 3H), 2.72-2.62(m,3 H), 1.65-1.53 ​​(m, 1 H), 1.32-1.17 (m, 18H), 1.13-1.10 (t, J = 6.8, 3 H).

[0421] 31 P NMR: (400 MHz, CD3CN), δ ppm 149.85, 148.50; 23.46, 23.25.

[0422] Preparation of phosphoramide-46

[0423]

[0424] Magnesium shavings (0.48 g, 20.0 mmol, 15.0 eq) and anhydrous ethylene glycol monomethyl ether (50 mL) were added to a 100 mL sealed container. The mixture was heated to 90 °C and stirred for 1 h. The container was cooled to room temperature, and Phos-43-1G (0.5 g, 1.33 mmol, 1.0 eq) was added. The mixture was heated to 90 °C and stirred for 18 h. The container was cooled to room temperature, and LC-MS analysis showed that the reactants had completely disappeared. The reaction mixture was transferred to a flask, and the pH was adjusted to 6 by adding 0.5 N dilute hydrochloric acid dropwise at 0 °C. The mixture was extracted five times with dichloromethane (50 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%-10%) as the eluent. The product was concentrated under vacuum to obtain 0.13 g of Phos-46-1A as a pale yellow oil, with a yield of 20%.

[0425] LCMS: M+H=513.4.

[0426] Phos-46-1A (0.1 g, 0.19 mmol, 1.0 eq) and anhydrous dichloromethane (3 mL) were added to a 50 mL flask, followed by tetrazolium (16 mg, 0.23 mmol, 1.2 eq) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.09 g, 0.3 mmol, 1.5 eq). The mixture was stirred at 25 °C for 1 h under nitrogen protection. The reaction was confirmed to be complete by LCMS. The reaction mixture was poured into an aqueous sodium bicarbonate solution and extracted twice with dichloromethane (10 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid silica gel column chromatography, eluting with DCM:MeOH:TEA = 0%-5% + 0.2%TEA. The product was concentrated under vacuum at 35 °C to obtain phosphorus sulfoxide, a yellow oily substance, Phos-46 (93 mg, yield 66.9%).

[0427] LCMS: M+H=713.6.

[0428] 1 H NMR: (400 MHz, CD3CN), δ ppm 8.92 (s, 1 H), 7.47-7.44 (dd, J=8.0, J=2.8, 1 H), 5.64-5.62 (d, J=8.0, 1 H), 4.78-4.68 (m, 1 H), 4.42-4.22 (m, 2H),4.18-4.15 (m, 4 H), 3.92-3.85 (m, 2 H), 3.78-3.66 (m, 3 H), 3.60-3.52 (m, 5H), 3.48-3.45 (m, 3 H), 3.36-3.35 (dd, J=2.4, J=0.8, 6 H), 3.28-3.27 (d, J=5.6, 3 H), 3.03-2.94 (m, 2 H), 2.75-2.63(m,3 H), 1.65-1.53 ​​(m, 1 H), 1.22-1.17 (m, 12 H).

[0429] 31 P NMR: (400 MHz, CD3CN), δ ppm 149.85, 148.42; 24.43, 24.22.

[0430] The 5'-phosphonate-modified nucleoside analogs described in this article can be prepared using similar methods or synthetic routes well known in the art.

[0431] The phosphoramidite compounds described herein are coupled to the 5' end of oligonucleotides to obtain 5'-terminal nucleotides, as described in CN110072530A and CN103154014A, each phosphonate group having a hydroxyl protecting atom, such as two methyl or ethyl protecting atoms on the oxygen atom, which are removed according to the deprotection step employed. In some embodiments, a nitrile:trimethylsilicon iodide:pyridine e=50:2:2 (v / v / v) deethylation solution is used to remove ethyl protection.

[0432] Preparation of phosphoramide-53

[0433]

[0434] BzCl (31.34 g, 5.0 eq.) was added dropwise to a mixture of Phos-53-SM1 (25.00 g, 1.0 eq.) and DMAP (2.72 g, 0.5 eq.) in pyridine (250 mL) at 0°C, and the mixture was stirred at 24°C for 18 hours. LC-MS showed that Phos-53-SM1 had been consumed and Phos-53-1A had been formed. The mixture was quenched with MeOH and evaporated under reduced pressure to obtain the crude product, which could be used directly for the next step. Analytical data: MS: [MH] - =768.

[0435] TFA (15 mL) was added to a solution of Phos-53-1A (100 g, crude) in DCM (500 mL), and the mixture was stirred at 24°C for 2 hours. LCMS showed that Phos-53-1A was consumed and Phos-53-1B was generated. The mixture was quenched with MeOH and evaporated under reduced pressure to obtain the crude product. The crude product was purified by silica gel chromatography using a gradient of MeOH in DCM (0-50%) to give Phos-53-1B (20 g, 96% yield in two steps). Analytical data: [M+H] + =467.

[0436] To a solution of Phos-53-1B (20 g, 1.0 eq.) in ACN (210 mL) and H₂O (140 mL), 4-OH TEMPO (2.95 g, 0.4 eq.) and DIB (27.62 g, 2.0 eq.) were added, and the mixture was stirred at 24°C for 18 hours. To the same mixture, 4-OH TEMPO (1.5 g, 0.2 eq.) and DIB (13 g, 0.95 eq.) were added, and the mixture was stirred at 24°C for 4 hours. The mixture was diluted with ethyl acetate. The organic layer was separated, washed with water and brine, dried over Na₂SO₄, filtered, and concentrated to obtain a crude product. This crude product was purified by silica gel chromatography (MeOH in DCM solution = 0–10%) to obtain Phos-53-1C (26 g, quantitative). Analytical data: MS: [M+H] + = 481.

[0437] Pb(OAc)4 (71.98 g, 3.0 eq.) was added to a THF (500 mL) solution of Phos-53-1C (26 g, 1.0 eq.), and the mixture was stirred at 24 °C for 18 h. LCMS showed that Phos-53-1C was consumed and Phos-53-1D was generated. The mixture was quenched with water, diluted with EA, and then filtered through a diatomaceous earth mat. The organic layer was washed with brine, dried over Na2SO4, filtered, and evaporated under reduced pressure to give the crude product. The crude product was purified by silica gel chromatography using a gradient of EA in PE (0–60%) to give Phos-53-1D (11.2 g, 53% yield in two steps). Analytical data: MS: [M+H] + =495.

[0438] SnCl4 (0.1 M, 17 mL, 1.05 eq.) was added dropwise to a DCM (80 mL) solution of Phos-53-1D (8.0 g, 1.0 eq.) at 0 °C, and the mixture was stirred at 23 °C for 20 min. Phos-53-SM2 (3.3 g, 1.1 eq.) was added to the mixture, and the mixture was stirred overnight at room temperature. LC-MS showed that Phos-53-1D had been consumed and Phos-53-1E had been formed. The mixture was quenched with water and diluted with EA. The organic layer was separated and washed with saturated NaHCO3 aqueous solution and brine, dried over Na2SO4, filtered, and concentrated to give crude product (14 g). Analytical data: MS: [M+H] + =619.

[0439] NaOMe (10.2 g, 2.5 equivalents, 30% wt., in MeOH) was added to a solution of Phos-53-1E (14 g, crude) in MeOH (150 mL), and the mixture was stirred at 25 °C for 1 h. LC-MS showed that Phos-53-1E was consumed and Phos-53-1F was generated. The mixture was neutralized with AcOH and concentrated to obtain the crude product, which was purified by silica gel chromatography using a gradient of MeOH in DCM (0-10%) to obtain Phos-53-1F (970 mg, 15% yield in two steps). Analytical data: MS: [M+H] + =411.

[0440] Phos-53-SM3 (1.425 g, 2.0 eq.) was added to a mixture of Phos-53-1F (970 mg, 1.0 eq.) and tetrazolium (265 mg, 1.6 eq.) in DCM (10 mL), and the mixture was stirred at 24 °C for 1 h. LC-MS showed that Phos-53-1F was consumed, yielding Phos-53. The mixture was washed with a saturated aqueous solution of NaHCO3, then with brine, dried over Na2SO4, filtered, and evaporated under reduced pressure to obtain the crude product. Reverse-phase purification yielded phosphoramide-53 (1.1 g, 76%). Analytical data: MS: [M+H] + =611,

[0441] 1 H NMR (400 MHz, CD3CN) δ 9.10 (s, 1H), 7.62 (t , 1H), 6.01 (dd, 1H), 5.62 (dd, 1H), 5.48 (dd, 1H), 4.32 (dddd, 1H), 4.12-3.92 (m, 5H), 3.83-3.64(m, 2H), 3.61-3.49 (m, 2H), 3.30 (d, 3H), 3.00-2.71 (m, 2H), 2.60 (m, 2H), 1.21-1.15 (m, 6H), 1.13-1.08 (m, 1H).

[0442] Other 5'-phosphonate mimics phosphoramids described herein can be prepared using similar methods or synthetic routes well known in the art. The 5'-phosphonate mimic phosphoramid compounds described in the examples are coupled to the 5' end of an oligonucleotide to obtain a 5'-terminal nucleotide well known in the art, as described in CN110072530A and CN103154014A, wherein each phosphonate group has a hydroxyl protecting atom, for example, two methyl or ethyl protecting atoms on an oxygen atom, and one or both methyl or ethyl groups are removed depending on the deprotection step employed. In some embodiments, ethyl protection is removed using a nitrile:trimethylsilicon iodide:pyridine e=50:2:2 (v / v / v) deethylation solution. In some embodiments, phosphoramid-53 is introduced into the 5' end of the antisense chain to produce 5'-terminal phos-53 and / or phos-53 Nucleotides.

[0443] Example 4. Synthesis of MAPT RNAi agent.

[0444] The MAPT RNAi double strands listed in Table 2-3 above are synthesized according to the following general procedure:

[0445] The sense and antisense sequences of siRNA were synthesized on an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramide chemistry. The elongation of the oligonucleotide chain was achieved through a four-step cycle: deprotection, condensation, capping, and oxidation or sulfidation steps for adding each nucleotide. Synthesis was performed on a solid support made of controlled-aperture glass (CPG, 1000 Å). The monomeric phosphoramide was commercially available or could be the phosphoramide compound from Examples 1-3. The phosphoramide compound described herein could be attached as a monomeric phosphoramide to the 3' end and further attached to the CPG solid support. When attached to the 5' end, the phosphoramide compound could be used for the final coupling reaction and could be further coupled to a target ligand if desired.

[0446] Phosphoramide (GLS-5) or GLS-15 Phosphoramide (as a non-limiting example) is disclosed in WO2023 / 045995A1 (the full text of which is incorporated herein by reference). For siRNAs used for in vitro screening (Table 2), synthesis was performed at a scale of 2 µmol, and for siRNAs used for in vivo assays (Table 3), synthesis was performed at a scale of 5 µmol or greater. A GalNAc ligand (GLO-n) was attached to the 3' end of the sense strand using a CPG solid carrier with GalNAc ligand attached. A GalNAc ligand (GLS-5) was attached to the 3' end of the sense strand. or GLS-15 As a non-restrictive instance attached to the 5' end of a sense chain, GLS-5 or GLS-15 The phosphorous amide with the GalNAc ligand cluster (disclosed in WO2023 / 045995A1, fully incorporated herein by reference) was used for the final coupling reaction with the GalNAc phosphorous amide attached to the 5' end of the sense chain. 3% trichloroacetic acid (TCA) in dichloromethane was used for deprotection of the 4,4'-dimethoxytriphenylmethyl protecting group (DMT). 5-Ethylthio-1H-tetrazole was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN were used for oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomer bound to the solid support was cleaved, and the protecting group was removed by treatment with a 1:1 volume of 40 wt.% aqueous methylamine solution and 28% ammonium hydroxide solution. For the synthesis of siRNA for in vitro screening, the crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice-cold EtOH was added to precipitate the sodium salt single-chain product, which could be used for annealing without further purification. For the synthesis of siRNA for in vivo testing, the crude single-chain product was further purified by ion-paired reversed-phase high-performance liquid chromatography (IP-RP-HPLC). The purified single-chain oligonucleotide product from IP-RP-HPLC was converted to sodium salt by dissolution in 1.0 M NaOAc and precipitated by adding ice-cold EtOH. Annealing of equimolar complementary sense and antisense oligonucleotides was carried out in water to form a double-stranded siRNA product, which was then lyophilized to obtain a fluffy white solid.

[0447] In some studies, the method of attaching a targeting group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of the sense chain involves using GalNAc phosphoramide (GLS-5) in the final coupling step of solid-state synthesis. or GLS-15 (phosphoramide), using synthetic processes, such as those used in the growth of oligonucleotide chains by adding nucleotides to the 5' end of the sense strand.

[0448] In some studies, methods for attaching GalNAc-containing targeting groups to the 3' end of the sense chain include using a solid support (CPG) containing GLO-n. Other methods involve attaching the GalNAc-containing targeting group to the CPG solid support via ester bonds, and then using the resulting CPG with the attached GalNAc targeting group during the synthesis of the sense chain, thereby obtaining a GalNAc targeting group attached to the 3' end of the sense chain.

[0449] The imann residue can be added to the 5' or 3' end of the oligonucleotide chain using methods well known to those skilled in the art, such as adding an invab residue to the oligonucleotide chain, and / or further adding it to a targeting group that targets GalNAc.

[0450] Example 5. In vitro screening of MAPT siRNA duplexes

[0451] Huh7 cells were digested with trypsin and adjusted to an appropriate density, then subjected to MAPT-psiCHECK. (TM) The complex of -2 and Lipofectamine 2000 (Invitrogen-11668-019) was mixed and seeded into 96-well plates. Simultaneously, test or control siRNA was transfected into cells using Lipofectamine RNAiMax (Invitrogen-13778-150) according to the manufacturer's recommended protocol. siRNA was tested at two concentrations (0.5 nM and 5 nM), repeated three times.

[0452] Day 1, MAPT-psiCHECK (TM) -2 transfections (one plate)

[0453] (1) Add 2.5µg MAPT-psiCHECK (TM) -2. The vector plasmid was transferred into an Eppendorf tube that did not contain RNASE (solution mixture #1).

[0454] (2) Add trypsin to dissociate Huh7 cells in the culture flask, count the cells using a Vi-Cell counter, and adjust the cell density to 1. 10^ 5 / ml

[0455] (3) Transfer 7.5µL of Lipofectamine 2000 (Invitrogen-11668-019) to solutionmix #1 and mix well.

[0456] (4) Add the solution from step 3 to the cell suspension, mix well, and then divide the suspension into 96-well plates (100 μl / well).

[0457] Day 2, siRNA transfection

[0458] (1) Dilute Lipofectamine® RNAiMAX reagent with Opti-MEM® medium.

[0459] (2) Dilute siRNA with water that does not contain RNA to prepare a 12× stock solution.

[0460] (3) Mix equal volumes of diluted RNAiMax with siRNA and incubate at room temperature for 15 minutes to allow the complex to form.

[0461] (4) Add 45 μl / well of compound Lipofectamine® RNAiMAX (Opti-MEM) mixture to 225 μl / well of fresh DMEM medium, discard the supernatant in the detection plate, and add 120 μl / well of compound mixture to a 96-well plate.

[0462] (5) The compound-free control well is defined as the well checked with MAPT-psi. (TM) -2 cells transfected and untreated with siRNA; blank control is well containing only cells.

[0463] Day 3, Dual-Glo® luciferase assay

[0464] (1) Add the reagent to the test plate and wait 10 minutes for cell lysis to occur.

[0465] (2) Transfer 100 μl of cell lysate to a plate and then measure the firefly luminescence.

[0466] (3) Add 50 μl of Dual-Glo® Stop & Glo® reagent to the detection plate and mix well. Wait 10 minutes and then measure the luminescence of the sea kidney.

[0467] (4) Calculate the relative expression level

[0468] Data Analysis

[0469] Sample well ratio = (sample kidney luminescence - background blank) / (sample firefly luminescence - background blank)

[0470] The ratio of control wells without compounds = (bioluminescence of control sample - background blank) / (bioluminescence of control sample - background blank)

[0471] Inhibition rate % = 100 - (Sample well ratio / Average ratio of compound-free control) × 100%

[0472] The double-stranded sequences used correspond to the sequences shown in Table 5-6.

[0473] Table 5 presents the results of in vitro studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0474]

[0475]

[0476]

[0477]

[0478]

[0479] Table 6 presents the results of in vitro studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0480]

[0481]

[0482] Example 6. In vivo screening of MAPT siRNA duplexes

[0483] On day 1, female C57BL / 6J mice (n=3 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding human MAPT (fused with the MAPT target sequence containing nucleotides 148-3521 of SEQ ID NO: 1) and the luciferase gene, respectively. On day 8, mice were subcutaneously administered a single dose of 5 mg / kg MAPT siRNA or saline. On day 15, liver tissue samples were collected, and MAPT mRNA levels were quantified using qPCR. The results are shown in Table 7. All tested MAPT RNAi agents showed MAPT inhibition in MAPT-transduced mice.

[0484] Table 7 presents the results of in vivo studies on the inhibition of MAPT expression using various MAPT RNAi agents. The duplex sequences used correspond to those shown in Table 3.

[0485]

[0486]

[0487] Example 7. In vivo screening of MAPT siRNA duplexes

[0488] On day 1, female C57BL / 6J mice (n=3 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding the human MAPT gene (fused with the MAPT target sequence containing nucleotides 148-3521 of SEQ ID NO: 1) and the luciferase gene, respectively. On day 8, mice were subcutaneously administered a single dose of 2 mg / kg MAPT siRNA or saline. On day 15, liver tissue samples were collected, and MAPT mRNA levels were quantified using qPCR. The results are shown in Tables 8-9. All tested MAPT RNAi agents showed MAPT inhibition in MAPT-transduced mice.

[0489] Table 8 presents the results of in vivo studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 3.

[0490]

[0491] Table 9 presents the results of in vivo studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 3.

[0492]

[0493] Example 8. In vitro screening of MAPT siRNA duplexes

[0494] Huh7 cells were trypsinized and adjusted to an appropriate density, then seeded in 96-well plates. On the second day after seeding, cells were transfected using Lipofectamine 2000 (Invitrogen-11668-019) according to the manufacturer's recommended protocol with a complex of psiCHECK™-2 vector plasmid, blank vector PCNDA3.0, siRNA, or control siRNA. The siRNA was tested in triplicate at different concentrations (0.5 nM and 5 nM).

[0495] On day 1, trypsin was added to dissociate Huh7 cells in one flask, and the cells were counted using a Vi-Cell counter. The cell density was adjusted to 1. 10^5 / ml, cultured in DMEM medium.

[0496] Day 2, transfection with a mixture of MAPT-psiCHECK™-2 vector / blank vector pCDNA3.0 / siRNAs / Lipofectamine 2000.

[0497] (1) Mix an appropriate amount of Lipofectamine 2000 (Invitrogen-11668-019) with Opti-MEM® medium (solution mixture mix #1). Finally, add 0.3 μl of Lipofectamine 2000 and 4.7 μl of Opti-MEM® medium to each well.

[0498] (2) Mix the appropriate MAPT-psiCHECK(TM)-2 vector, blank pCNDNA 3.0 vector and siRNA with Opti-MEM® medium in each well (solution mixture mix #2).

[0499] (3) Mix equal volumes of mix#1 and mix#2 solutions, and finally add 10 μl to each well. Incubate at room temperature for 15 minutes to allow the complex to form.

[0500] (4) Discard the DMEM medium and add 10 μl of mixed solutions mix#1 and mix#2 and 90 μl of fresh DMEM medium.

[0501] (5) The compound-free control well is defined as a well that has been transfected with MAPT-psiCHECK(TM)-2 vector and blank vector pCNDNA 3.0 and has not been treated with siRNA; the blank control is a well containing only cells.

[0502] Day 3, Double Glo luciferase assay

[0503] (1) Add Renilla luciferase assay reagent equilibrated to room temperature. The sample volume should be the same as the initial cell culture medium, and mix thoroughly. (For example, for a 96-well plate, it is recommended to add 80 μL of culture medium and 80 μL of assay reagent.)

[0504] (2) Mix on a horizontal oscillator at room temperature for at least 10 minutes.

[0505] (3) Detect the luminescence signal of Renina luciferase on a chemiluminescence detector or a multi-functional microplate reader with a chemiluminescence module. Complete the detection within 2 hours after adding the detection reagent. The detection order of Renina luciferase on the microplate should be the same as that of firefly luciferase.

[0506] Data Analysis:

[0507] Experimental design: Depending on the experimental objectives, each culture plate should include a blank control group, an experimental group, and a control group.

[0508] a. Blank control group

[0509] Background F: Untransfected cells + firefly luciferase assay reagent.

[0510] Background R: Untransfected cells + Firefly luciferase assay kit + Renida luciferase assay kit

[0511] Note: The sample size used in the blank control group must be the same as that of the experimental sample, and it must contain the same culture medium / serum combination as the experimental sample.

[0512] b. Experimental group: The transfected cells were treated with the experimental compound (i.e., experimental group F and experimental group R).

[0513] c. Control group: Transfected cells were not treated in any way to standardize the results (i.e., control group F and control group R).

[0514] Calculation results:

[0515] The experimental group ratio = (experimental group F - background F) / (experimental group R - background R), and the control group ratio = (control group F - background F) / (control group R - background R).

[0516] fold increase in expression = experimental group ratio / control group ratio

[0517] The double-stranded sequences used correspond to the sequences shown in Table 10-11.

[0518] Table 10 provides the results of in vitro studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0519]

[0520]

[0521]

[0522] Table 11 presents the results of in vitro studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.

[0523]

[0524]

[0525] Example 9. In vivo screening of MAPT siRNA duplexes

[0526] On day 1, female C57BL / 6J mice (n=3 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding the human MAPT gene (fused with the MAPT target sequence containing nucleotides 148-3521 of SEQ ID NO: 1) and the luciferase gene, respectively. On day 8, mice were subcutaneously administered a single dose of 2 mg / kg MAPT siRNA or saline. On day 19, liver tissue samples were collected, and MAPT mRNA levels were quantified using qPCR. The results are shown in Table 12. All tested MAPT RNAi agents showed MAPT inhibition in MAPT-transduced mice.

[0527] Table 12 presents the results of in vivo studies on the inhibition of MAPT expression using various MAPT RNAi agents. The double-stranded sequences used correspond to those shown in Table 3.

[0528]

[0529]

[0530] equivalent

[0531] Although several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing functions and / or obtaining results and / or one or more advantages described herein, and each of these variations and / or modifications is considered to be within the scope of the invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended as examples, and actual parameters, dimensions, materials, and / or configurations will depend on the specific application using the teachings of this invention. Those skilled in the art will recognize, or be able to determine, many equivalents of the specific embodiments of the invention described herein using only conventional experimentation. Therefore, it should be understood that the foregoing embodiments are presented by way of example only and within the scope of the appended claims and their equivalents; the invention may be practiced in ways different from the specific descriptions and claims. The invention is directed toward each individual feature, system, article, material, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods (provided that these features, systems, articles, materials, and / or methods do not contradict each other) is included within the scope of the invention.

[0532] All definitions defined and used in this document should be understood as control dictionary definitions, definitions referenced in incorporated documents, and / or the general meaning of the defining terms.

[0533] The indefinite articles “a” and “an” used in this specification and claims, unless otherwise expressly stated, shall be understood as “at least one”.

[0534] The phrase “and / or” as used in the specification and claims shall be understood as “any one or both” of the combined elements, that is, the elements exist together in some cases and separately in others. Other elements may optionally exist in addition to those expressly identified in the “and / or” clause, whether related to or unrelated to the expressly identified elements, unless otherwise expressly stated.

[0535] All references, patents and patent applications and publications cited or mentioned in this application are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 2 by no more than 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary.

2. The dsRNA agent according to claim 1, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, wherein the consecutive nucleotides are associated with nucleotides 165-195, 166-196, 167-197, 165-197, 257-287, 1495-1525, 1525-1555, 1528-1558, 1529-1559, 1525-1559, 1532-1562, 2234-2264, 2235-2265, 2236-2266 of SEQ ID NO:

1. 2237-2267, 2238-2268, 2235-2268, 2326-2356, 2327-2357, 2328-2358, 2329-2359, 2330-2360, 2331-2361, 2333-2363, 2334-2364, 2336-2366, 2342-2372, 2326 -2372, 2359-2389, 2364-2394, 2359-2394, 2412-2442, 2414-2444, 2412-2444, 2426-2456, 2688-2718, 2775-2805, 2805-2835, 2811-2841, 2835-2865, 2836-286 6. Any nucleotide sequence in 2837-2867, 2838-2868, 2839-2869, 2840-2870, 2841-2871, 2842-2872, 2843-2873, 2845-2875, 2835-2875, 2868-2898 differs from the corresponding nucleotide sequence of SEQ ID NO: 2 by 0, 1, 2, or 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary.

3. The dsRNA agent according to claim 2, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, wherein the consecutive nucleotides are associated with nucleotides 170-190, 171-191, 172-192, 170-192, 262-282, 1497-1517, 1500-1520, 1530-1550, 1533-1553, 1534-1554, 1530-1554, 1537-1557, 2239-2259, 2240-2260, 2 241-2261, 2242-2262, 2243-2263, 2239-2263, 2331-2351, 2332-2352, 2333-2353, 2334-2354, 2335-2355, 2336-2356, 2338-2358, 2339-2359, 2341-2361, 2347-236 7, 2331-2367, 2364-2384, 2369-2389, 2364-2389, 2417-2437, 2419-2439, 2417-2439, 2431-2451, 2693-2713, 2780-2800, 2810-2830, 2816-2836, 2840-2860, 2841- The antisense strand contains at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides that differ from the corresponding nucleotide sequence of SEQ ID NO:2 by 0, 1, 2 or 3 nucleotides.

4. The dsRNA agent of claim 1, wherein the antisense strand comprises a region complementary to the MAPT RNA transcript, the region comprising at least 15 consecutive nucleotides, differing from any of the antisense sequences listed in any of Tables 1-3 by no more than 1, 2, or 3 nucleotides.

5. The dsRNA agent of claim 1, wherein the antisense strand comprises a region complementary to the MAPT RNA transcript, the region comprising at least 15 consecutive nucleotides from any of the antisense sequences listed in any of Tables 1-3.

6. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand contain a region complementary to a MAPT RNA transcript, wherein the complementary region contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally contains a targeting ligand.

7. The dsRNA agent of claim 6, wherein the region complementary to the MAPT RNA transcript comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides, which differ from one of the antisense sequences listed in any one of Tables 1-3 by no more than 3 nucleotides.

8. The dsRNA agent according to any one of claims 1-7, wherein the antisense strand of the dsRNA is substantially or completely complementary to any target region of SEQ ID NO: 1, and preferably the dsRNA agent comprises any one of the antisense strand sequences described in Tables 1-3.

9. The dsRNA agent according to any one of claims 1-8, wherein the sense strand sequence is at least substantially complementary to or completely complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises any one of the sense strand sequences in Tables 1-3.

10. The dsRNA agent according to any one of claims 1-9, wherein the dsRNA agent comprises a sequence listed in double-stranded sequences in any one of Tables 1-3.

11. The dsRNA agent according to any one of claims 1-10, wherein the dsRNA agent comprises at least one modified nucleotide.

12. The dsRNA agent according to any one of claims 1-11, wherein all or substantially all nucleotides of the sense strand and / or antisense strand are modified nucleotides.

13. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to a portion of a MAPT RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand comprises a sequence that can be represented by formula (I): in: Each N′ F Represents nucleotides with 2'-fluorine modification; each N′ N1 and N′ N2 Each N′L independently represents a modified or unmodified nucleotide; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluorinated nucleotide, and m′ and n′ are each independently integers from 0 to 7.

14. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to a portion of a MAPT RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand contains a sequence that can be represented by formula (II): in: Each N F Represents nucleotides with 2'-fluorine modification; each N M1 N M2 N M3 N M4 N M5 and N M6 Each N represents a modified or unmodified nucleotide independently; L Each nucleotide can independently represent a modified or unmodified nucleotide but not a 2'-fluorinated nucleotide, and n is an integer from 0 to 7.

15. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting MAPT expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand contains a region complementary to a MAPT RNA transcript, wherein the complementary region contains at least 15 consecutive nucleotides, wherein the dsRNA comprises a duplex represented by formula (III): in: Each chain is approximately 18 to 30 nucleotides in length; each N F and N′ F Independently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4 N M5 、N′ N1 and N′ N2 Each can independently represent a modified or unmodified nucleotide; N′ N1 and N′ N2 It includes only one 2'-fluorinated nucleotide; N M1 N M2 N M3 N M4 N M5 and N M6 It contains only three 2'-fluorinated nucleotides; each N L and N′ L Each nucleotide can be independently represented as a modified or unmodified nucleotide, but not as a 2'-fluorinated nucleotide, and each of m′, n′, and n can be an independent integer from 0 to 7.

16. The dsRNA agent according to any one of claims 11-15, wherein the one or more modified nucleotides are independently selected from the group consisting of: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2'3'-seco nucleotide mimics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), glycol nucleosides (GNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, debased nucleotides, ribitol, reverse nucleotides, reverse debased nucleotides, isomannitol nucleotides, reverse 2'-Ome nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides, 3'-OMe nucleotides, nucleotides containing a 5'-thiophosphate group, 5'-phosphate-modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decylamide) group, 2'-amino-modified nucleotides, phosphamide esters, or nucleotides containing a non-natural base.

17. The dsRNA agent according to any one of claims 1-16, comprising an E-vinylphosphonate nucleotide at the 5' end of the antisense strand, or comprising a 5'-phosphate mimic nucleotide represented by formula (VIII) or its stereoisomer or racemic mixture at the 5' end of the antisense strand: Formula (VIII) in: Q8 is O, S, SO, SO2, PR 16 R 17 or NR 11 ;R 16 and R 17 Independently, it can be (=O), (=S), OH, SH, C1-C6 alkyl, or NR. 18 R 19 Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, mercapto or protected mercapto, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optionally substituted amino, native or modified nucleosides; and R b For O, S, or NR 12 R 12 Protected by hydrogen, C1-C6 alkyl, or amino groups; Q1 and Q2 are each independently H, halogen, -CN, or optionally substituted C1-C6 alkyl groups; The substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl; R 11 R 18 and R 19 Independently, it is H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid groups; Z is a nucleoside containing a sugar or a sugar-substituted portion; T3 is an internucleotide linker used to link the 5'-terminal nucleotide of formula (VIII) or its stereoisomer to the remaining portion of the 5'-terminus of the guide strand; Each substituent comprises one or more substituents, optionally independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkyl mercapto, CN.

18. The dsRNA agent according to any one of claims 1-17, wherein the dsRNA agent comprises at least one phosphate thionucleotide internucleotide bond.

19. The dsRNA agent according to any one of claims 1-17, wherein the sense strand comprises at least one phosphate thionucleotide internucleotide bond.

20. The dsRNA agent according to any one of claims 1-17, wherein the antisense strand comprises at least one phosphate thionucleotide internucleotide bond.

21. The dsRNA agent according to any one of claims 1-17, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thionucleotide internucleotide bonds.

22. The dsRNA agent according to any one of claims 1-17, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.

23. The dsRNA agent according to any one of claims 1-22, wherein the modified sense strand is a modified sense strand sequence shown in any one of Tables 2-3.

24. The dsRNA agent according to any one of claims 1-22, wherein the modified antisense strand is a modified antisense strand sequence shown in one of Tables 2-3.

25. The dsRNA agent according to any one of claims 1-24, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.

26. The dsRNA agent according to any one of claims 1 to 25, wherein the length of the complementary region is 19 to 21 nucleotides.

27. The dsRNA agent according to any one of claims 1 to 26, wherein the length of each strand does not exceed 30 nucleotides.

28. The dsRNA agent according to any one of claims 1 to 26, wherein the length of each strand does not exceed 25 nucleotides.

29. The dsRNA agent according to any one of claims 1 to 26, wherein the length of each strand does not exceed 23 nucleotides.

30. The dsRNA agent according to any one of claims 1-29, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.

31. The dsRNA agent of claim 30, wherein one or more targeting groups or linking groups are conjugated to a sense strand.

32. The dsRNA agent according to claim 30 or 31, wherein the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).

33. The dsRNA agent according to any one of claims 30-32, wherein the targeting group comprises the following structure: Each n'' is independently selected from 1 or 2.

34. The dsRNA agent according to any one of claims 30-33, wherein the targeting group has the following structure: 。 35. The dsRNA agent according to any one of claims 1-34, wherein the dsRNA agent comprises a targeting group conjugated to the 5' end of the sense strand.

36. The dsRNA agent according to any one of claims 1-34, wherein the dsRNA agent comprises a targeting group conjugated to the 3' end of the sense strand.

37. The dsRNA agent according to any one of claims 1 to 34, wherein the antisense strand contains a reversed debasement residue at its 3' end.

38. The dsRNA agent according to any one of claims 1-34, wherein the sense strand comprises one or two reversed debasing residues or imann residues at the 3' and / or 5' ends.

39. The dsRNA agent according to any one of claims 1-38, wherein the dsRNA agent has two blunt ends.

40. The dsRNA agent according to any one of claims 1 to 38, wherein at least one strand comprises a 3' overhang of at least one nucleotide.

41. The dsRNA agent according to any one of claims 1 to 38, wherein at least one strand comprises a 3' overhang of at least two nucleotides.

42. The dsRNA agent according to any one of claims 1-41, wherein the MAPT RNA transcript is SEQ ID NO:

1.

43. A composition comprising the dsRNA agent according to any one of claims 1-42.

44. The composition of claim 43, further comprising a pharmaceutically acceptable carrier.

45. The composition of claim 44, further comprising one or more additional therapeutic agents.

46. ​​The composition of claim 45, wherein the composition is packaged in a reagent kit, container, bag, dispenser, pre-filled syringe, or vial.

47. The composition according to any one of claims 43-46, wherein the composition is formulated for subcutaneous administration, for intrathecal administration, or for intravenous (IV) administration.

48. A cell comprising the dsRNA agent of any one of claims 1-42, optionally, said cell being a mammalian cell, optionally a human cell.

49. A method for inhibiting MAPT gene expression in cells, the method comprising: (i) Preparing cells containing an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-42 or the composition of any one of claims 43-47.

50. The method of claim 49, further comprising: (ii) The prepared cells are maintained for a sufficient time to allow for the degradation of the mRNA transcript of the MAPT gene, thereby inhibiting the expression of the MAPT gene in the cells.

51. The method according to any one of claims 49-50, wherein the cells are located in the subject and the dsRNA agent is administered subcutaneously to the subject.

52. The method according to any one of claims 49-50, wherein the cells are located in the subject and the dsRNA agent is administered to the subject via intravenous or intrathecal administration.

53. The method of claim 51 or 52, further comprising assessing MAPT gene inhibition after administration of a dsRNA agent to a subject, wherein the assessment method includes: (i) Identify one or more physiological characteristics of the subject’s MAPT-related disease or condition, and (ii) The identified physiological characteristics are compared with baseline pre-treatment physiological characteristics of MAPT-related diseases or conditions and / or control physiological characteristics of MAPT-related diseases or conditions, wherein the comparison indicates one or more of the presence or absence of inhibition of MAPT gene expression in the subject.

54. The method of claim 53, wherein the identified physiological characteristics are one or more of the following: MAPT mRNA level, MAPT protein level, varying degrees of motor, cognitive and behavioral impairments, or symptoms and features including memory loss, motor dysfunction and / or increased number and / or volume of neurofibrillary contents.

55. The method of claim 54, wherein there is a decrease in one or more of the subject's MAPT mRNA level, the subject's MAPT protein level, and / or a decrease in MAPT gene mRNA in one or more of the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, and spinal cord.

56. A method for inhibiting MAPT gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-42 or a composition of any one of claims 43-47.

57. The method of claim 56, wherein the dsRNA agent is administered to the subject subcutaneously.

58. The method of claim 56, wherein the dsRNA agent is administered intravenously or intrathecally.

59. The method according to any one of claims 56-58, further comprising evaluating the repression of the MAPT gene after administration of the dsRNA agent, wherein the evaluation method comprises: (i) Identify one or more physiological characteristics of the subject’s MAPT-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of MAPT-related diseases or conditions and / or control physiological characteristics of MAPT-related diseases or conditions. The comparisons described therein indicate the presence or absence of one or more of MAPT gene expression inhibition in the subjects.

60. The method according to claim 59, wherein, The identified physiological characteristics are one or more of the following: the subject's MAPT mRNA level, MAPT protein level, varying degrees of motor, cognitive and behavioral impairments, or symptoms and features including memory loss, motor dysfunction and / or an increase in the number and / or volume of neurofibrillary contents.

61. The method of claim 60, wherein there is a decrease in one or more of the subject's MAPT mRNA level, the subject's MAPT protein level, and / or a decrease in MAPT gene mRNA in one or more of the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, and spinal cord.

62. A method for treating a disease or condition associated with the presence of MAPT protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-42 or a composition of any one of claims 43-47 to inhibit MAPT gene expression.

63. The method of claim 62, wherein the disease or condition is one or more of the following: tau proteinosis, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), FTLD with MAPT mutation, FTD with motor neuron disease, non-fluency variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic aphasia (PPA-S), primary progressive aphasia-language reduction aphasia (PPA-L), Parkinson's disease-related frontotemporal dementia associated with chromosome 17 (FTDP-). 17) Pick's disease (PiD), argyrophilic cereal disease (AGD), corticobasal ganglia degeneration (CBD), multisystem tau disease with Alzheimer's disease (MSTD), white matter tau disease with glial cell inclusions (FTLD with GGI), neurofibrillary tangles (NFT) dementia, amyotrophic lateral sclerosis (ALS), corticobasal ganglia syndrome (CBS), progressive supranuclear palsy (PSP), Parkinson's disease, post-encephalitis Parkinson's disease, Down syndrome (DS), Huntington's disease, myotonic dystrophy type 1, and Niemann-Pick disease.

64. The method of claim 63, further comprising administering an additional treatment to the subject.

65. The method of claim 64, wherein the additional treatment option comprises: The subjects were administered one or more MAPT antisense polynucleotides of the present invention, administered a non-MAPT dsRNA therapeutic agent, and their behavior was modified.

66. The method of claim 65, wherein the non-MAPT dsRNA therapeutic agent is one or more of the following: monoamine inhibitors, such as xenazine, deuterated benzodiazepine, and reserpine; anticonvulsants, such as valproic acid (Depakote, Depaakene, Depacon) and clonazepam (Klonopin); antipsychotics, such as risperidone and haloperidol; and antidepressants, such as paroxetine (Paxil).

67. The method according to any one of claims 62-66, wherein the dsRNA agent is administered subcutaneously to the subject.

68. The method according to any one of claims 62-66, wherein the dsRNA agent is administered intravenously or intrathecally to the subject.

69. The method according to any one of claims 62-68, further comprising determining the efficacy of the administered double-stranded RNA (dsRNA) agent in the subject.

70. The method of claim 69, wherein the method for determining the efficacy of the treatment in the subject comprises: (i) Identify one or more physiological characteristics of the subject’s MAPT-related disease or condition, and (ii) Compare the identified physiological characteristics with the baseline pre-treatment physiological characteristics of MAPT-related diseases or conditions. The comparisons indicate the presence, absence, and level of efficacy of the double-stranded RNA (dsRNA) agent administered to the subjects.

71. The method of claim 70, wherein the identified physiological characteristics are: MAPT mRNA levels, MAPT protein levels, or varying degrees of motor, cognitive, and behavioral impairments in the subject, or symptoms and features including memory loss, motor dysfunction, and / or an increase in the number and / or volume of neurofibrillary inclusions.

72. The method of claim 70, wherein the subject exhibits a decrease in one or more of the MAPT mRNA level, MAPT protein level, and / or a decrease in MAPT gene mRNA in one or more of the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, and spinal cord.

73. A method for reducing the level of MAPT protein in a subject compared to a baseline pre-treatment level of MAPT protein in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-42 or a composition of any one of claims 43-47 to reduce the level of MAPT gene expression.

74. The method of claim 73, wherein the dsRNA agent is administered to the subject subcutaneously, intrathecally, or intravenously.

75. A method for altering the physiological characteristics of a MAPT-related disease or condition, compared with baseline pre-treatment physiological characteristics of a subject's MAPT-related disease or condition, the method comprising administering to the subject an effective amount of a double-stranded RNA (dsRNA) agent of any one of claims 1-42 or a composition of any one of claims 43-47 to alter the physiological characteristics of the subject's MAPT-related disease or condition.

76. The method of claim 75, wherein the dsRNA agent is administered to the subject subcutaneously, intrathecally, or intravenously.

77. The method according to any one of claims 75-76, wherein the physiological characteristic is one or more of the following: the subject's MAPT mRNA level; MAPT protein level; varying degrees of motor, cognitive, and behavioral impairments or symptoms and characteristics including memory loss, motor dysfunction, and / or an increase in the number and / or volume of neurofibrillary inclusions.

Images