A method for constructing a lepr gene modified diabetes model of golden hamsters and application thereof

CN122189090APending Publication Date: 2026-06-12NANJING MEDICAL UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING MEDICAL UNIV
Filing Date
2026-01-09
Publication Date
2026-06-12

Smart Images

  • Figure CN122189090A_ABST
    Figure CN122189090A_ABST
Patent Text Reader

Abstract

The application discloses a kind of Lepr gene modification diabetes golden hamster model construction method and application, belong to genetic engineering animal model construction technical field.The application obtains two-cell stage embryo by the hormone induction superovulation female hamster and male cage after natural fertilization, microinjection is carried out into single two-cell stage embryo blastomere culture reply again into real pregnant surrogate in vivo development, and then obtain Lepr modification diabetes golden hamster (db / db).The sgRNA of specific targeting hamster Lepr gene prepared in the application can accurately target hamster Lepr gene and realize gene knockout, and the db / db golden hamster model will fill the new crown infection severe model animal blank;Diabetes golden hamster can be simulated new crown infection severe case by using the method, and the pathogenic mechanism of SARS-CoV-2 of diabetes and diabetic patients is researched.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of life sciences and biotechnology, specifically relating to a method for constructing and applying a Lepr gene-modified diabetic golden hamster (db / db) model. Background Technology

[0002] Diabetes mellitus and type 2 diabetes are significant factors affecting human health, and their incidence has been steadily increasing. Currently, the primary animal model is the db / db mouse, but the metabolic characteristics and drug responses of mice differ considerably from those of humans, leading to discrepancies between research results and human clinical manifestations. Golden hamsters would be an excellent complementary animal model. Furthermore, golden hamsters can be directly infected with SARS-CoV-2 and exhibit pathological features similar to those in humans. The db / db golden hamster model will fill the gap in animal models for severe COVID-19 infection and will have significant research and application prospects in areas such as the study of SARS-CoV-2 infection mechanisms, screening of therapeutic drugs, and evaluation of novel pathogenic strains. Summary of the Invention

[0003] In response to the technical problems raised in the background art, the present invention provides a method for establishing a Lepr gene-modified diabetic golden hamster (db / db) model and its application.

[0004] This invention utilizes CRISPR-Cas9 technology, under a red-light chamber with a microscope equipped with a red filter, to inject Cas9 protein and sgRNAs targeting exon 6 of the Lepr gene into two-cell embryos to generate Lepr-modified golden hamsters, thus avoiding early embryonic developmental arrest. The resulting offspring were constructed through the transfer of albino recipient embryos in a true pregnancy and used to simulate diabetes and diabetes-related severe SARS-CoV-2 infection models.

[0005] The objective of this invention is achieved through the following technical methods:

[0006] In a first aspect, the present invention claims protection for a method for constructing a Lepr gene-modified diabetic golden hamster model, the method comprising: injecting a Cas9 functional element and an sgRNA targeting exon 6 of the Lepr gene into a two-cell embryo under a red light source, transplanting the embryo into a recipient, thereby obtaining a Lepr gene-modified diabetic golden hamster model.

[0007] Furthermore, the target site of the gene to be knocked out in golden hamster was determined, and gLepr-Sg1 (sgRNA) targeting the Lepr gene in golden hamster was designed. The nucleotide sequence of gLepr-Sg1 (sgRNA) is shown in SEQ ID NO:1.

[0008] gLepr-Sg1 (sgRNA):GCAGCAGTACACTGCGTCATAGG (SEQ ID NO: 1).

[0009] Furthermore, the process for preparing the sgRNA is as follows: a double-stranded DNA fragment is formed by annealing primers gLepr-Sg1F and gLepr-Sg1R; the double-stranded DNA fragment is inserted into the PUC57-CRISP9 vector linearized with BsaI; after transformation and screening, an sgRNA expression plasmid is obtained; using the verified sgRNA expression plasmid as a template, high-concentration sgRNA is synthesized and purified by in vitro transcription; the nucleotide sequence of gLepr-Sg1F is shown in SEQ ID NO:2, and the nucleotide sequence of gLepr-Sg1R is shown in SEQ ID NO:3.

[0010] gLepr-Sg1F: TAGGGCAGCAGTACACTGCGTCAT (SEQ ID NO: 2).

[0011] gLepr-Sg1R:AAACATGACGCAGTGTACTGCTGC (SEQ ID NO:3).

[0012] Furthermore, the PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid, and the construction method of the PUC57-CRISP9-sgRNA-GFP plasmid includes: digesting the PUC57 plasmid with Not I and Xho I restriction endonucleases to obtain a 2608 bp fragment as the PUC57-CRISP9 vector backbone; inserting the U6-T7-GFP-tracrRNA sequence as shown in SEQ ID NO:9 into the PUC57-CRISP9 vector backbone to construct the PUC57-CRISP9-sgRNA-GFP plasmid.

[0013] Furthermore, the method specifically includes the following steps:

[0014] (1) Under red light, active sgRNA and Cas9 functional elements were co-injected into the cytoplasm or nucleus of two-cell embryos of golden hamsters, and the injected embryos were transplanted into recipient mother mice for gestation to obtain F0 generation hamsters, and PCR identification and sequencing were performed.

[0015] (2) F0 generation hamsters were crossed with wild-type hamsters to obtain F1 generation hamsters, and PCR identification and sequencing were performed;

[0016] (3) The F1 generation heterozygous hamsters were crossbred to obtain the F2 generation hamsters. After PCR identification and sequencing, stable homozygotes were obtained, which are the Lepr gene-modified diabetic golden hamster animal models.

[0017] Furthermore, the Cas9 functional element is Cas9 mRNA or Cas9 protein.

[0018] Furthermore, the specific primer pairs for PCR identification include: Lepr-TOF, Lepr-TOR, Lepr-TIF, and Lepr-TIR; the nucleotide sequence of Lepr-TOF is shown in SEQ ID NO:4, the nucleotide sequence of Lepr-TOR is shown in SEQ ID NO:5, the nucleotide sequence of Lepr-TIF is shown in SEQ ID NO:6, and the nucleotide sequence of Lepr-TIR is shown in SEQ ID NO:7.

[0019] Lepr-TOF:CAGATAGTTTGGTGGAATGAATTCTAGC (SEQ ID NO:4)

[0020] Lepr-TOR:CATGTGAAACTGATGGGTACTTAAC (SEQ ID NO:5)

[0021] Lepr-TIF:GTTTGGTGGATGAATCTAGCTGAGAA (SEQ ID NO: 6)

[0022] Lepr-TIR: ACTCTAGCACAGTCTGTGACAAGT (SEQ ID NO:7).

[0023] In the technical solution of this invention, all golden hamsters are kept in SPF-grade and equivalent breeding environments.

[0024] In the technical solution of this invention, all experiments were conducted at room temperature (28.5℃) under red light.

[0025] In the technical solution of this invention, all golden hamsters that provide embryos are induced to ovulate superovulate by intraperitoneal injection of pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) and then mated with male hamsters in a 1:1 cage.

[0026] In the technical solution of this invention, before and after the two-cell embryo transfer, it is placed in an incubator in a self-prepared culture medium HEMC-11. The culture conditions are: temperature 37.5℃, carbon dioxide content 10%, oxygen concentration 5%, and nitrogen concentration 85%.

[0027] In the technical solution of this invention, the target site of sgRNA is located at exon 6 of the Lepr gene or upstream and downstream sites of exon 6. The Cas9 protein translated from Cas9 mRNA in vivo or the Cas9 protein in the injected sample binds to the target site under the guidance of sgRNA, thereby causing DNA double-strand breaks and generating non-homologous recombination repair.

[0028] As a specific embodiment of the present invention, the method for constructing the Lepr gene-modified diabetic golden hamster model of the present invention specifically includes the following steps:

[0029] (1) Structure of Lepr gene and design of target site for sgRNA: The target site of the gene to be knocked out in golden hamster was determined, and sgRNA targeting the Lepr gene of hamster was designed. The nucleotide sequence of the sgRNA is shown in SEQ ID NO:1.

[0030] Preparation of the sgRNA: A double-stranded DNA fragment was formed by annealing primers gLepr-Sg1F and gLepr-Sg1R. This double-stranded DNA fragment encodes an sgRNA targeting the Lepr gene (SEQ ID NO:1). The double-stranded DNA fragment was inserted into a BsaI-linearized PUC57-CRISP9 vector. After transformation and screening, an sgRNA expression plasmid was obtained. Using the verified sgRNA expression plasmid as a template, a high concentration of sgRNA was synthesized and purified by in vitro transcription. The nucleotide sequences of gLepr-Sg1F and gLepr-Sg1R are shown in SEQ ID NO:2-3. The PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid. The construction method of the PUC57-CRISP9-sgRNA-GFP plasmid includes: digesting the PUC57 plasmid with Not I and Xho I restriction endonucleases to obtain a 2608 bp fragment as the PUC57-CRISP9 vector backbone; inserting the U6-T7-GFP-tracrRNA sequence as shown in SEQ ID NO:9 into the PUC57-CRISP9 vector backbone to construct the PUC57-CRISP9-sgRNA-GFP plasmid.

[0031] (2) Donor preparation: Select 6-8 week old golden female mice. At 9:00 AM on the first day of estrus, inject pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) intraperitoneally to induce superovulation. At 6:00 PM on the fourth day, mate with male mice in a 1:1 ratio. At 9:00 AM on the second day, examine vaginal secretions under a microscope for sperm. The presence of sperm indicates mating.

[0032] (3) Recipient preparation: Eight-week-old golden female mice were selected and mated with male mice in a 1:1 ratio at 6 pm on the fourth day of estrus. At 9 am on the second day, the vaginal secretions were examined under a microscope for sperm. The presence of sperm indicated that the recipient was a 0.5-day true pregnancy recipient.

[0033] (4) Embryo Acquisition: Hamster fertilized eggs are sensitive to pH, temperature and light. All experiments were performed at room temperature of 28.5℃ under red light. The donor female mice were anesthetized by intraperitoneal injection of 1.25% aphthine (1.8 ml / 100 g), and then euthanized by cervical dislocation. The fallopian tubes were excised from the abdomen and placed in culture droplets. Under a stereomicroscope, the ampulla of the fallopian tube was torn open with ophthalmic forceps to release the cell cluster. Two-cell embryos with uniform blastomeres were selected and transferred to HEMC-11 culture medium for temporary storage. The in vitro embryo acquisition process was completed within 30 minutes.

[0034] (5) Embryo injection: 20 ng / μl sgRNA and 50 ng / μl cas9 mRNA were injected into the cytoplasm of two-cell embryos through a micromanipulator. After injection, the embryos were cultured in a three-gas incubator with a temperature of 37.5℃, a carbon dioxide content of 10%, an oxygen concentration of 5%, and a nitrogen concentration of 85%.

[0035] (6) Embryo transfer: 1.25% aphrodisiac recipient female mice, after making an incision in the middle of the back skin, open the abdominal wall muscle layer between the abdominal ribs and iliac bone, use forceps to remove the fat pad and pull out one side of the ovary and fallopian tube, and aspirate 14-20 embryos for use. Under a stereomicroscope, use ophthalmic forceps to longitudinally tear the ampulla and fimbriae of the fallopian tube, and blow the embryo into the ampulla of the fallopian tube through the transfer tube.

[0036] (7) A method for constructing a Lepr gene-modified golden hamster model, comprising: constructing a Lepr gene-modified golden hamster model by using gLepr-Sg1 (sgRNA). The Lepr gene modification includes: ① a deletion of 16 bases in the entire exon 2 sequence of the Lepr gene, resulting in the deletion of the nucleotide sequence after amino acid 298, and translation errors of the Lepr protein after amino acid 98.

[0037] (8) Breeding and screening of Lepr gene-modified diabetic golden hamster (db / db) model, which includes: ① injecting a mixture of Cas9 mRNA (or Cas9 protein) and sgRNA into golden hamster fertilized eggs and then transplanting them into surrogates to obtain F0 generation golden hamsters, and screening the positive golden hamsters among them as F0 generation Lepr gene-modified diabetic golden hamsters; ② screening the offspring obtained by crossing F0 generation Lepr gene-modified diabetic golden hamsters with wild-type golden hamsters, and taking the positive golden hamsters among them as F1 generation heterozygous golden hamsters; ③ screening the offspring obtained by self-breeding of F1 generation heterozygous golden hamsters, and taking the positive golden hamsters among them as F2 generation golden hamsters; the screening method for positive golden hamsters includes PCR identification and gene sequencing, and the positive homozygotes in the F2 generation golden hamsters are selected as Lepr gene-modified diabetic golden hamster animal models.

[0038] In this embodiment of the invention, the specific primer pairs used for PCR identification and gene sequencing include: Lepr-TOF, Lepr-TOR, Lepr-TIF, and Lepr-TIR; the nucleotide sequences of Lepr-TOF, Lepr-TOR, Lepr-TIF, and Lepr-TIR are shown in SEQ ID NO:4-7.

[0039] This invention protects a method for modeling Lepr gene-modified golden hamsters by modifying fertilized eggs or two-cell embryos and then transplanting them into surrogate mother mice for development. When Lepr homozygous animals obtained using this method were mated with wild-type golden hamsters, no offspring were produced, indicating that the Lepr homozygous modified individuals are infertile like db / db mice. Lepr protein was not detected by Western blot analysis of leptin released from white adipose tissue (body fat) in the inguinal subcutaneous adipose tissue (IAT), thus confirming the successful construction of the Lepr gene-modified golden hamster model.

[0040] Secondly, this invention seeks protection for the use of the Lepr gene-modified diabetic hamster model constructed by the above method in any of the following:

[0041] (1) To study the infection mechanism of SARS-CoV-2 virus;

[0042] (2) To study the related functions and mechanisms of action of the Lepr gene;

[0043] (3) Study the pathogenesis of diabetes. (4) Screen drugs for the prevention and treatment of SARS-CoV-2 virus infection;

[0044] (5) Screening for diabetes treatment drugs;

[0045] (6) Develop vaccines to prevent SARS-CoV-2 virus infection.

[0046] Thirdly, this invention seeks to protect the application of the Lepr gene-modified diabetic hamster model constructed by the above method in the evaluation of novel pathogenic strains of SARS-CoV-2.

[0047] Fourthly, this invention seeks protection for the use of the Lepr gene-modified diabetic hamster model constructed by the above method as a severe COVID-19 infection model or a severe SARS-CoV-2 infection model related to diabetes.

[0048] The advantages of the Lepr gene-modified golden hamster model constructed in this invention are:

[0049] (1) The method for constructing the golden hamster model of the present invention is highly efficient and has a stable reproductive transmission rate. Lepr gene-modified golden hamster offspring are obtained by gene modification of two-cell embryos through true pregnancy recipient transplantation. The heterozygous strain of this modified strain has normal fertility. Therefore, the present invention provides an important method for constructing a golden hamster model for applied research such as exploring the pathogenesis of diabetes, COVID-19 infection, and vaccine and drug development.

[0050] (2) Compared with wild-type hamsters, the db / db diabetic golden hamsters constructed in this invention have increased liver damage indicators such as alanine aminotransferase (ALT), aspartate aminotransferase (AST) and total protein (TP), which is helpful for diabetes-related research.

[0051] (3) The db / db diabetic golden hamsters constructed based on the present invention died after SARS-CoV-2 infection, while WT golden hamsters survived after SARS-CoV-2 infection, which is helpful for the study of the mechanism and drugs of severe COVID-19 infection.

[0052] (4) The db / db diabetic golden hamsters constructed in this invention only increased in weight by 10-15% compared to wild-type hamsters. Moreover, after reaching adulthood, the weight of db / db diabetic golden hamsters was actually lower than that of wild-type hamsters. This is a significant interspecies difference compared to the fact that db / db mice have twice the weight of wild-type mice, which is similar to the clinical symptoms in humans. Therefore, this invention will contribute to the pathophysiology of diabetes and the development of drugs. Attached Figure Description

[0053] Figure 1 This is a schematic diagram of the construction of the db / db diabetic golden hamster in an embodiment of the present invention.

[0054] A strategy for producing leptin receptor-deficient golden hamsters using CRISPR / Cas9 technology was employed. An sgRNA target site was designed in exon 8 of the leptin receptor gene in golden hamsters. Sequencing results revealed a 16-nucleotide deletion (mut16) in the leptin receptor-deficient (db / db) golden hamster strain, leading to translational errors in the leptin receptor protein.

[0055] Figure 2 As an embodiment of the present invention, Western blot analysis of db / db diabetic golden hamsters showed the absence of Lepr expression in inguinal subcutaneous adipose tissue.

[0056] Western blot analysis showed that leptin receptor expression was absent in the subcutaneous adipose tissue of the groin of db / db golden hamsters, with GAPDH used as a loading control.

[0057] Figure 3 db / db Schematic diagram of weight changes in a golden hamster.

[0058] Under normal rearing conditions (including feeding commercially available common golden hamster food, the same rearing environment, and feeding frequency), the body weight of 7-12 week old db / db golden hamsters (n=5) and wild-type golden hamsters (n=5) was routinely monitored. Significant differences were found between male and female db / db golden hamsters starting from 6 weeks of age (p<0.05).

[0059] Figure 4 The db / db golden hamster showed elevated blood sugar after fasting, indicating diabetic lesions.

[0060] Blood samples were collected from db / db golden hamsters (n=5, 2 males and 3 females) and wild-type golden hamsters (n=5, 2 males and 3 females) at different time points after a 16-hour fast to monitor blood glucose levels. Blood glucose levels increased in db / db golden hamsters after fasting, and the error bar represents the standard error. Statistical significance was determined by two-way ANOVA and multiple comparison models. *** P < 0.001.

[0061] Figure 5 A diagram illustrating the process of viral infection in golden hamsters.

[0062] On days 2, 5, and 14 after viral infection, tissue samples were taken to observe histopathological changes and viral titers.

[0063] Figure 6 db / db Weight changes in golden hamsters infected with COVID-19.

[0064] db / db hamsters are highly susceptible to SARS-CoV-2 variants. Infected male and female db / db hamsters with the SARS-CoV-2 prototype, SARS-CoV-2 Delta (B.1.617), or SARS-CoV-2 Omicron BA.5 variant showed significantly lower body weight and prolonged disease course compared to controls; the prototype and BA.5 variants failed to regain normal body weight after 14 days.

[0065] Figure 7The viral titer in the lungs of db / db hamsters was significantly increased after infection.

[0066] Lung tissue samples were collected from hamsters. Virus-infected db / db hamsters (6 males and 7 females per strain) and wild-type hamsters (5 males and 4 females per strain) were euthanized at 2, 5, and 14 DPIs. Both males and females were included at each sampling time point. Viral load in the lungs and nasal turbinates of infected wild-type (WT) and db / db hamsters was determined using a plaque formation assay. Error bars represent standard errors. Statistical significance was assessed using two-way ANOVA and a multiple comparison model. *P < 0.05, **P < 0.01, ***P < 0.001. (SARS-CoV-2 prototype, SARS-CoV-2 Delta (B.1.617), or SARS-CoV-2 Omicron BA.5 variant).

[0067] Figure 8 The viral titer in the nasal turbinate tissue of db / db hamsters increased after infection.

[0068] Nasal turbinate tissue samples were collected from hamsters. Virus-infected db / db hamsters (6 males and 7 females per strain) and wild-type hamsters (5 males and 4 females per strain) were euthanized at 2, 5, and 14 DPIs. Both males and females were included at each sampling time point. Viral load in the lungs and nasal turbinates of infected wild-type (WT) and db / db hamsters was determined using a plaque formation assay. Error bars represent standard errors. Statistical significance was assessed using two-way ANOVA and a multiple comparison model. *P < 0.05, **P < 0.01, ***P < 0.001. (SARS-CoV-2 prototype, SARS-CoV-2 Delta (B.1.617), or SARS-CoV-2 Omicron BA.5 variant).

[0069] Figure 9 db / db Lung pathology of a golden hamster infected with the novel coronavirus.

[0070] Male and female hamsters aged 6-10 weeks were either infected simulatingly or intranasally inoculated with 1×10⁵ TCID⁵ of the SARS-CoV-2 prototype, SARS-CoV-2 Delta variant, or SARS-CoV-2 Omicron BA.5 variant, respectively. Infected db / db hamsters (A) and wild-type hamsters (B) were sacrificed at 2, 5, and 14 days post-infection to observe lung pathological changes. Hamsters in the simulated infection group were sacrificed at 14 days as a negative control. Semi-quantitative analysis and pathological scoring were performed on H&E-stained tissue sections. Images were acquired using the Pannoramic MIDI system. In lung histopathology, black arrows indicate alveolar wall thickening and widening of alveolar spacing; green arrows indicate lymphocyte and granulocyte infiltration; and orange arrows indicate bronchial epithelial cell necrosis.

[0071] Figure 10 This is a structural diagram of the U6-T7-GFP-trcRNA sequence. Detailed Implementation

[0072] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make equivalent changes to the disclosed technical content to create equivalent embodiments. Any modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the present invention fall within the protection scope of the present invention.

[0073] Example 1

[0074] This embodiment provides a method for constructing a Lepr gene-modified hamster animal model via microinjection. The specific steps of the construction method are as follows:

[0075] (1) Structure of Lepr gene (Gene ID: 101822984, the amino acid sequence of Lepr protein is shown in SEQ ID NO:8) and design of sgRNA target site: The target site of the gene to be knocked out in golden hamster was determined, and sgRNA targeting the hamster Lepr gene was designed on the eighth exon. The sgRNA is gLepr-Sg1 (SEQ ID NO:1: GCAGCAGTACACTGCGTCATAGG).

[0076] The designed sgRNA sequence was constructed into an expression vector using an in vitro ligation cloning method to obtain an sgRNA expression plasmid. Using the validated sgRNA expression plasmid as a template, high-concentration sgRNA was synthesized and purified through in vitro transcription.

[0077] The primers used in constructing the sgRNA expression plasmid include gLepr-Sg1F and gLepr-Sg1R.

[0078] gLepr-Sg1F: TAGGGCAGCAGTACACTGCGTCAT (SEQ ID NO: 2).

[0079] gLepr-Sg1R:AAACATGACGCAGTGTACTGCTGC (SEQ ID NO:3).

[0080] The specific process for constructing the sgRNA expression plasmid and performing in vitro transcription is as follows:

[0081] (a) Construction of sgRNA expression plasmid

[0082] Construction of PUC57-CRISP9-sgRNA-GFP plasmid:

[0083] The PUC57 (General Electric Company, GE) plasmid was purified by gel extraction using Not I and Xho I restriction endonucleases at 37°C for 2 hours to obtain a 2608 bp fragment, which was used as the backbone of the PUC57-CRISP9 vector.

[0084] The artificially synthesized sequence containing U6-T7-GFP-tracrRNA (containing Not I and Xho I restriction sites, nucleotide sequence as shown in SEQ ID NO:9, sequence structure as shown in...) was used. Figure 10 As shown, the vector backbone (2608 bp) was inserted into the PUC57-CRISP9 vector to construct PUC57-CRISP9-sgRNA-GFP, and the results were verified by sequencing.

[0085] Vector backbone preparation: The PUC57-CRISP9-sgRNA-GFP plasmid was linearized by digestion with BsaI restriction endonuclease. The target vector fragment of approximately 2965 bp was then separated and purified by gel electrophoresis for later use.

[0086] Oligo annealing: The two synthesized specific primers, gLepr-Sg1F and gLepr-Sg1R, were mixed. First, they were treated with T4 polynucleotide kinase (T4 PNK) to ensure 5' end phosphorylation of the oligonucleotide chains, which is essential for subsequent ligation. Then, the two primers were annealed to form a double-stranded DNA fragment through a temperature cycling program (37°C, 30 min → 95°C, 5 min → slow cooling to 25°C).

[0087] Ligation and Transformation: The annealed double-stranded Oligo fragment (after dilution) was mixed with the purified linearized vector backbone, and ligation was performed using T4 DNA ligase to insert the sgRNA sequence into the vector. The ligation product was transformed into DH5α competent E. coli cells, and selection was performed using Amp+ (ampicillin resistance). Only colonies successfully transformed with the plasmid were allowed to grow.

[0088] Positive clone identification: Single colonies were picked and cultured. After plasmid extraction, PCR amplification and sequencing were performed using universal primers M13F / M13R (M13R: CAG GAA ACA GCT ATG ACC; M13F: TGT AAA ACG ACG GCC AGT) to verify whether the inserted sgRNA sequence was correct.

[0089] (b) In vitro transcription to synthesize sgRNA

[0090] After obtaining a plasmid that has been correctly sequenced, it is used as a template to generate a large amount of the required sgRNA through in vitro transcription.

[0091] Transcription template amplification: Using the successfully validated plasmid as a template, PCR amplification was performed using M13F / M13R primers. The product was purified by gel excision and used as a template for in vitro transcription. The purpose of this step is to obtain a large number of pure sgRNA-encoded DNA fragments without the plasmid backbone.

[0092] In vitro transcription: Using the HiScribe T7 in vitro transcription kit, sgRNA was synthesized under the catalysis of T7 RNA polymerase, using the PCR product as a template. After the reaction was completed, TURBO DNase was added to degrade the DNA template, ensuring that the final product was pure RNA.

[0093] sgRNA purification and storage: The transcribed sgRNA was purified using ethanol precipitation to remove impurities such as salt ions, proteins, and unbound nucleotides from the reaction system. The purified sgRNA was reconstituted with RNase-free water, its concentration was determined, and it was diluted to a working concentration (e.g., 1000 ng / μl). Finally, it was stored at -80°C.

[0094] (2) Donor preparation: Select 6-8 week old golden female mice. At 9:00 AM on the first day of estrus, inject pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) intraperitoneally to induce superovulation. At 6:00 PM on the fourth day, mate with male mice in a 1:1 ratio. At 9:00 AM on the second day, examine vaginal secretions under a microscope for sperm. The presence of sperm indicates mating.

[0095] (3) Recipient preparation: Eight-week-old golden female mice were selected and mated with male mice in a 1:1 ratio at 6 pm on the fourth day of estrus. At 9 am on the second day, the vaginal secretions were examined under a microscope for sperm. The presence of sperm indicated that the recipient was a 0.5-day true pregnancy recipient.

[0096] (4) Embryo Acquisition: Hamster fertilized eggs are sensitive to pH, temperature and light. All experiments were performed at room temperature of 28.5 degrees Celsius under red light. The donor female mice were anesthetized by intraperitoneal injection of 1.25% aphthine (1.8 ml / 100 g), and then euthanized by cervical dislocation. The fallopian tubes were excised from the abdomen and placed in culture droplets. Under a stereomicroscope, the ampulla of the fallopian tube was torn open with ophthalmic forceps to release the cell cluster. Two-cell embryos with uniform blastomeres were selected and transferred to HEMC-11 culture medium for temporary storage. The in vitro embryo acquisition process was completed within 30 minutes.

[0097] (5) Embryo injection: 20 ng / μl sgRNA and 50 ng / μl cas9 mRNA were injected into the cytoplasm of two-cell embryos through a micromanipulator. After injection, the embryos were cultured in a three-gas incubator with a temperature of 37.5℃, a carbon dioxide content of 10%, an oxygen concentration of 5%, and a nitrogen concentration of 85%.

[0098] (6) Embryo transfer: 1.25% aphrodisiac recipient female mice, after making an incision in the middle of the back skin, open the abdominal wall muscle layer between the abdominal ribs and iliac bone, use forceps to remove the fat pad and pull out one side of the ovary and fallopian tube, and aspirate 14-20 embryos for use. Under a stereomicroscope, use ophthalmic forceps to longitudinally tear the ampulla and fimbriae of the fallopian tube, and blow the embryo into the ampulla of the fallopian tube through the transfer tube.

[0099] (7) The identification primers are any one or a combination of two of the outer identification primer pair and the inner identification primer pair; F0 generation positive heterozygous hamsters are selected by sequencing and mated with wild-type hamsters to obtain F1 generation hamsters. F1 generation heterozygous hamsters are then hybridized to obtain F2 generation hamsters. The obtained F2 generation hamsters are identified by PCR and sequenced to obtain homozygotes in the F2 generation hamsters. The sequencing results show that there is a 16-nucleotide deletion (del16) in the Lepr-deficient (Lepr- / -) (db / db) golden hamster strain, which leads to Lepr protein translation errors. The short chain screening and identification primer pairs include: Lepr-TOF, Lepr-TOR, Lepr-TIF and Lepr-TIR.

[0100] Lepr-TOF:CAGATAGTTTGGTGGAATGAATTCTAGC (SEQ ID NO:4)

[0101] Lepr-TOR:CATGTGAAACTGATGGGTACTTAAC (SEQ ID NO:5)

[0102] Lepr-TIF:GTTTGGTGGATGAATCTAGCTGAGAA (SEQ ID NO: 6)

[0103] Lepr-TIR: ACTCTAGCACAGTCTGTGACAAGT (SEQ ID NO:7).

[0104] (8) Comparative Experiment: The experiment consisted of model construction and SARS-CoV-2 infection. ① Screening results by F0 generation sequencing showed that the leptin receptor-deficient (db / db) golden hamster strain had a 16-nucleotide deletion (mut16), leading to translation errors of the leptin receptor protein. ② Western blot analysis showed that leptin receptor expression was absent in the subcutaneous adipose tissue of the db / db hamster groin, with GAPDH used as a loading control.

[0105] like Figure 1 As shown, this describes a strategy for producing leptin receptor-deficient golden hamsters using CRISPR / Cas9 technology. An sgRNA target site was designed in exon 8 of the golden hamster leptin receptor gene. Sequencing results revealed a 16-nucleotide deletion (mut16) in the leptin receptor-deficient (db / db) golden hamster strain, leading to translational errors in the leptin receptor protein.

[0106] Western blot analysis showed a lack of leptin receptor expression in the subcutaneous adipose tissue of the db / db golden hamster groin, with GAPDH used as a loading control (e.g. Figure 2 (As shown).

[0107] Under normal rearing conditions (including feeding commercially available common golden hamster food, identical rearing environment, and feeding frequency), the weight of 7-12 week old db / db golden hamsters (n=5) and wild-type golden hamsters (n=5) was routinely monitored. Significant differences in weight between male and female db / db golden hamsters were observed starting from 6 weeks of age (e.g., Figure 3 (As shown). (p<0.05)

[0108] like Figure 4 As shown, blood samples were collected from db / db golden hamsters (n=5, 2 males and 3 females) and wild-type golden hamsters (n=5, 2 males and 3 females) at different time points after a 16-hour fast to monitor blood glucose levels. Blood glucose levels increased in db / db golden hamsters after fasting, indicating diabetic lesions. Error bars represent standard errors. Statistical significance was determined by two-way ANOVA and multiple comparison models. *** P < 0.001.

[0109] Example 2

[0110] Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is widespread globally, continuously evolving and generating new variants, posing a persistent threat to public health, particularly impacting populations with chronic comorbidities. Diabetes is a high-risk factor for severe outcomes in COVID-19 infection. Therefore, establishing animal models consistent with the clinicopathological features of COVID-19 in diabetic patients is crucial. Wild-type hamsters and db / db hamsters aged 6–10 weeks were inoculated with 1×10 5 TCID 50 The SARS-CoV-2 strains (prototype, Delta, or Omicron BA.5) were used. Control group hamsters were subjected to a simulated infection with the same volume of DMEM. To monitor survival, wild-type and db / db hamsters infected with SARS-CoV-2 (2 males and 3 females per strain) and simulated infected hamsters (1 male and 2 females) were observed for 14 days. To collect tissue samples, infected wild-type hamsters (5 males and 4 females per strain, with 3 animals containing both males and females randomly selected at each designated time point) and db / db hamsters (6 males and 7 females per strain, with 4 or 5 animals containing both males and females randomly selected at each designated time point) were euthanized to obtain tissue. Hamsters were inoculated with the virus under appropriate anesthesia, with potential pain and suffering minimized. Clinical manifestations and survival were recorded over 14 days. Specific tissues were collected for pathological analysis and viral titer determination.

[0111] Results: SARS-CoV-2-infected db / db golden hamsters showed moderate localized thickening of the alveolar walls, widening of alveolar interstitial spaces at 2 DPI, and minimal lymphocytic and granulocytic infiltration. At 5 DPI, the lung histological changes in db / db hamsters were more severe, with higher scores, including indistinct alveolar structure, bronchial epithelial cell necrosis, multiple visible fragments of necrotic cells, perivascular edema, and extensive localized lymphocytic infiltration. By 14 DPI, lung damage gradually lessened and recovered, characterized by mild localized inflammation. Compared to the prototype strain, the variant strain exhibited a lower lung damage score.

[0112] This study constructed a leptin receptor gene knockout hamster model with a diabetic phenotype (db / db) and found that diabetic hamsters were more susceptible to SARS-CoV-2 and its variants than wild-type hamsters. Compared with wild-type hamsters, SARS-CoV-2 and its variants induced a stronger immune cytokine response in the lungs of diabetic hamsters. Histopathological comparative analysis also showed that infection with SARS-CoV-2 and its variants led to more severe lung tissue damage in diabetic hamsters and may induce serious complications such as diabetic nephropathy and heart disease. Our results indicate that although the respiratory pathogenicity of SARS-CoV-2 variants is reduced, they can still damage other organs such as the kidneys and heart in diabetic hamsters, suggesting that we must not ignore the risk of SARS-CoV-2 variants spreading to diabetic patients. This hamster model helps to better understand the pathogenesis of severe pneumonia caused by SARS-CoV-2 primers in diabetic patients, and also helps to develop and test effective treatments and preventive therapies against SARS-CoV-2 variants for these high-risk populations.

[0113] like Figure 5 As shown, during the viral infection of golden hamsters, tissue samples were taken on days 2, 5, and 14 post-infection to observe histopathological changes and viral titers. Figure 6 As shown, db / db hamsters are highly susceptible to SARS-CoV-2 variants. Infected male and female db / db hamsters with the SARS-CoV-2 prototype, SARS-CoV-2 Delta (B.1.617), or SARS-CoV-2 Omicron BA.5 variant all exhibited significantly lower body weight and prolonged disease duration compared to controls; the prototype and BA.5 variants failed to regain normal body weight after 14 days.

[0114] Lung tissue samples were collected from hamsters. Virus-infected db / db hamsters (6 males and 7 females per strain) and wild-type hamsters (5 males and 4 females per strain) were euthanized at 2, 5, and 14 DPIs. Both males and females were included at each sampling time point. Viral load in the lungs and nasal turbinates of infected wild-type (WT) and db / db hamsters was detected using a plaque formation assay. Error bars represent standard errors. Statistical significance was assessed using two-way ANOVA and a multiple comparison model. *P < 0.05, **P < 0.01, ***P < 0.001. (SARS-CoV-2 prototype, SARS-CoV-2 Delta (B.1.617), or SARS-CoV-2 Omicron BA.5 variant). Figure 7 As shown, the viral titer in the lungs of db / db hamsters increased significantly after infection.

[0115] Nasal turbinate tissue samples were collected from hamsters. Virus-infected db / db hamsters (6 males and 7 females per hamster) and wild-type hamsters (5 males and 4 females per hamster) were euthanized at 2, 5, and 14 DPIs. Both males and females were included at each sampling time point. Viral load in the lungs and nasal turbinates of infected wild-type (WT) and db / db hamsters was detected using a plaque formation assay. Error bars represent standard errors. Statistical significance was assessed using two-way ANOVA and a multiple comparison model. *P < 0.05, **P < 0.01, ***P < 0.001. (SARS-CoV-2 prototype, SARS-CoV-2 Delta (B.1.617), or SARS-CoV-2 Omicron BA.5 variant). Figure 8 As shown, the viral titer in the nasal turbinate tissue of db / db hamsters increased after infection.

[0116] like Figure 9 As shown, male and female hamsters aged 6-10 weeks received either a simulated infection or intranasal inoculation with 1×10⁵ TCID⁵ of the SARS-CoV-2 prototype strain, the SARS-CoV-2 Delta variant, or the SARS-CoV-2 Omicron BA.5 variant, respectively. Infected db / db hamsters (A) and wild-type hamsters (B) were sacrificed at 2, 5, and 14 days post-infection to observe lung pathological changes. The simulated infection group was sacrificed at 14 days as a negative control. Semi-quantitative analysis and pathological scoring were performed on H&E-stained tissue sections. Images were acquired using the Pannoramic MIDI system. In lung histopathology, black arrows indicate alveolar wall thickening and widening of alveolar interstitial spaces; green arrows indicate lymphocyte and granulocyte infiltration; and orange arrows indicate bronchial epithelial cell necrosis.

[0117] sequence list

[0118] Lepr protein amino acid sequence (XP_040613034.1, SEQ ID NO:8)

[0119]

[0120] Nucleotide sequence of U6-T7-GFP-trcRNA (SEQ ID NO:9):

[0121]

Claims

1. A method for constructing a Lepr gene-modified diabetic golden hamster model, characterized in that, The method involves injecting a Cas9 functional element and an sgRNA targeting exon 6 of the Lepr gene into a two-cell embryo under a red light source, followed by embryo transfer into a recipient, thereby obtaining a Lepr gene-modified diabetic golden hamster model.

2. The construction method according to claim 1, characterized in that, The target site of the gene to be knocked out in golden hamster was determined, and an sgRNA targeting the Lepr gene in golden hamster was designed. The nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1.

3. The construction method according to claim 1 or 2, characterized in that, The process for preparing the sgRNA is as follows: a double-stranded DNA fragment is formed by annealing primers gLepr-Sg1F and gLepr-Sg1R; the double-stranded DNA fragment is inserted into the BsaI-linearized PUC57-CRISP9 vector; after transformation and screening, an sgRNA expression plasmid is obtained; using the verified sgRNA expression plasmid as a template, high-concentration sgRNA is synthesized and purified by in vitro transcription; the nucleotide sequence of gLepr-Sg1F is shown in SEQ ID NO:2, and the nucleotide sequence of gLepr-Sg1R is shown in SEQ ID NO:

3.

4. The construction method according to claim 3, characterized in that, The PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid. The construction method of the PUC57-CRISP9-sgRNA-GFP plasmid includes: digesting the PUC57 plasmid with Not I and Xho I restriction endonucleases to obtain a 2608 bp fragment as the PUC57-CRISP9 vector backbone; inserting the U6-T7-GFP-tracrRNA sequence, as shown in SEQ ID NO:9, into the PUC57-CRISP9 vector backbone to construct the PUC57-CRISP9-sgRNA-GFP plasmid.

5. The construction method according to any one of claims 1-4, characterized in that, The method specifically includes the following steps: (1) Under red light, active sgRNA and Cas9 functional elements were co-injected into the cytoplasm or nucleus of two-cell embryos of golden hamsters, and the injected embryos were transplanted into recipient mother mice for gestation to obtain F0 generation hamsters, and PCR identification and sequencing were performed. (2) F0 generation hamsters were crossed with wild-type hamsters to obtain F1 generation hamsters, and PCR identification and sequencing were performed; (3) The F1 generation heterozygous hamsters were crossbred to obtain the F2 generation hamsters. After PCR identification and sequencing, stable homozygotes were obtained, which are the Lepr gene-modified diabetic golden hamster animal models.

6. The construction method according to claim 1 or 5, characterized in that, The Cas9 functional element is Cas9 mRNA or Cas9 protein.

7. The construction method according to claim 5, characterized in that, The specific primer pairs for PCR identification include: Lepr-TOF, Lepr-TOR, Lepr-TIF, and Lepr-TIR; the nucleotide sequence of Lepr-TOF is shown in SEQ ID NO:4, the nucleotide sequence of Lepr-TOR is shown in SEQ ID NO:5, the nucleotide sequence of Lepr-TIF is shown in SEQ ID NO:6, and the nucleotide sequence of Lepr-TIR is shown in SEQ ID NO:

7.

8. The application of the Lepr gene-modified diabetic hamster model constructed by any of the methods described in claims 1-7 in any of the following: (1) To study the infection mechanism of SARS-CoV-2 virus; (2) To study the related functions and mechanisms of action of the Lepr gene; (3) Study the pathogenesis of diabetes. (4) Screen drugs for the prevention and treatment of SARS-CoV-2 virus infection; (5) Screening for diabetes treatment drugs; (6) Develop vaccines to prevent SARS-CoV-2 virus infection.

9. The application of the Lepr gene-modified diabetic hamster model constructed by any of the methods described in claims 1-7 in the evaluation of novel pathogenic strains of SARS-CoV-2.

10. The Lepr gene-modified diabetic hamster model constructed by any of the methods described in claims 1-7 may be used as a severe COVID-19 infection model or a model of diabetes and diabetes-related severe SARS-CoV-2 infection.