Use of pig GDPD2 gene in preparation of medicine for inhibiting replication of porcine epidemic diarrhea virus
By overexpressing the porcine GDPD2 gene vector or cell line and regulating its expression and activity, the problem of poor immunization effect of porcine epidemic diarrhea virus vaccine was solved, and effective inhibition and disease control of porcine epidemic diarrhea virus were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YANGZHOU UNIV
- Filing Date
- 2025-03-13
- Publication Date
- 2026-06-12
AI Technical Summary
Existing porcine epidemic diarrhea virus vaccines have limited immunization efficacy due to frequent virus mutations and poor protection for newborn piglets, leading to challenges in disease control.
By overexpressing the porcine GDPD2 gene or its encoded protein, and using GDPD2 gene overexpression vectors or overexpression cell lines, the expression or activity of the porcine GDPD2 gene can be regulated to inhibit the replication of porcine epidemic diarrhea virus.
It significantly inhibits the replication of porcine epidemic diarrhea virus, improves the disease resistance of pig herds, and reduces disease incidence and economic losses.
Smart Images

Figure CN120137939B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the application of the porcine GDPD2 gene in the preparation of drugs that inhibit the replication of porcine epidemic diarrhea virus, and belongs to the field of molecular biology technology. Background Technology
[0002] Porcine epidemic diarrhea (PED) is a highly contagious intestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV). Its main clinical features include vomiting, diarrhea, and dehydration in suckling piglets, with a mortality rate that can reach 100%, causing enormous economic losses to the global pig industry. Although several PEDV vaccines are available, frequent viral mutations mean that immunized pig herds can still be infected, and existing vaccines offer limited protection for newborn piglets. Therefore, in-depth research into the pathogenic mechanism of PEDV, screening and identifying key targets involved in PEDV infection, and ultimately improving the disease resistance of pig herds from a genetic perspective are critical industry issues that urgently need to be addressed, and also an important area of national seed industry revitalization in recent years.
[0003] The GDPD2 (Glycerophosphodiester Phosphodiesterase Domain Containing 2) gene encodes a glycerol phosphate diesterase, whose protein product plays a crucial role in lipid metabolism and cellular signaling. GDPD2 participates in phospholipid metabolism by hydrolyzing glycerol phosphate diesters, regulating intracellular lipid homeostasis, and has potential functions in inflammatory responses and immune regulation. Recent studies have found that GDPD2 may influence viral replication and transmission during viral infection by regulating host cell lipid metabolism and signaling pathways. Based on its unique biological functions, GDPD2 is not only an important research subject in basic research on lipid metabolism and viral infection mechanisms, but also has potential applications in antiviral drug development and disease control. Regulating GDPD2 expression or activity may provide new strategies for the treatment of viral infection-related diseases. Summary of the Invention
[0004] Objectives of the Invention: The first objective of this invention is to provide the application of the porcine GDPD2 gene in the preparation of drugs that inhibit the replication of porcine epidemic diarrhea virus (PEDV). The second objective of this invention is to provide the application of the porcine GDPD2 gene or its encoded protein in the preparation of drugs for the prevention and / or treatment of diseases caused by PEDV.
[0005] Technical solution: This invention provides the application of the porcine GDPD2 gene in the preparation of drugs that inhibit the replication of porcine epidemic diarrhea virus, wherein the Gene ID of the GDPD2 gene is 100516309.
[0006] The present invention also provides the use of the porcine GDPD2 gene or the protein encoded thereon in the preparation of medicaments for the prevention and / or treatment of diseases caused by porcine epidemic diarrhea virus, wherein the GDPD2 gene has the Gene ID: 100516309.
[0007] Furthermore, the relevant disease is porcine epidemic diarrhea.
[0008] Furthermore, the application involves suppressing porcine epidemic diarrhea virus replication by overexpressing the porcine GDPD2 gene.
[0009] Furthermore, the overexpression of the porcine GDPD2 gene is a vector overexpressing the porcine GDPD2 gene or a cell line overexpressing the porcine GDPD2 gene.
[0010] Furthermore, the method for constructing the overexpression vector of porcine GDPD2 gene is as follows: using cDNA from IPEC-J2 cells as a template, the CDS sequence of the porcine GDPD2 gene is amplified by PCR using primer pairs with sequences as shown in SEQ ID NO.1-2, and the obtained target fragment is inserted into the basic vector.
[0011] Furthermore, the base vector is the pcDNA3.1 vector.
[0012] Furthermore, the restriction enzyme sites for inserting the target fragment into the base vector are EcoRI and BamHI.
[0013] Furthermore, the PCR amplification program is 98℃ for 3 min; 98℃ for 10 s, 60℃ for 20 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min.
[0014] Furthermore, the qRT-PCR primer sequences used to identify whether the overexpression of the porcine GDPD2 gene vector was successfully constructed are shown in SEQ ID NO. 3-4.
[0015] Furthermore, the qRT-PCR program is 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.
[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention is the first to discover that overexpression of the porcine GDPD2 gene can effectively inhibit the replication of porcine epidemic diarrhea virus, and the porcine GDPD2 gene can be used as a target for inhibiting porcine epidemic diarrhea virus infection to prepare related drugs. Attached Figure Description
[0017] Figure 1 To detect GDPD2 mRNA expression levels in GDPD2-overexpressing cells and control cells using qRT-PCR. Control: Cells transfected with the empty pcDNA3.1 vector; OE-GDPD2: Cells transfected with the recombinant pcDNA3.1-GDPD2 vector containing the GDPD2 coding sequence. ** P<0.01.
[0018] Figure 2 The expression level of the PEDV M gene was detected by qRT-PCR in GDPD2 knockout cells and control cells. WT: wild-type cells; GDPD2-KO: GDPD2 knockout cells. ** P<0.01.
[0019] Figure 3 The expression levels of the PEDV M gene in GDPD2-overexpressing cells and control cells were detected by qRT-PCR. Control: Cells transfected with the empty pcDNA3.1 vector; OE-GDPD2: Cells transfected with the recombinant pcDNA3.1-GDPD2 vector containing the GDPD2 coding sequence. *** P<0.001.
[0020] Figure 4 Western blot was used to detect GDPD2 protein expression levels in GDPD2-overexpressing cells and control cells. Control: Cells transfected with the empty pcDNA3.1 vector; OE-GDPD2: Cells transfected with the recombinant pcDNA3.1-GDPD2 vector containing the GDPD2 coding sequence.
[0021] Figure 5 Western blot was used to detect the expression level of PEDV N protein in GDPD2 knockout cells and control cells. WT: wild-type cells; GDPD2-KO: GDPD2 knockout cells.
[0022] Figure 6 Western blot was used to detect the expression level of PEDVN protein in GDPD2-overexpressing cells and control cells. Control: Cells transfected with the empty pcDNA3.1 vector; OE-GDPD2: Cells transfected with the recombinant pcDNA3.1-GDPD2 vector containing the GDPD2 coding sequence.
[0023] Figure 7 For TCID 50 Methods: PEDV viral titers were detected in GDPD2 knockout cells and control cells. WT: wild-type cells; GDPD2-KO: GDPD2 knockout cells. ** P<0.01.
[0024] Figure 8 For TCID 50 Methods: The PEDV viral titer was detected in GDPD2-overexpressing cells and control cells. Control: Cells transfected with the empty pcDNA3.1 vector; OE-GDPD2: Cells transfected with the recombinant pcDNA3.1-GDPD2 vector containing the GDPD2 coding sequence. ** P<0.01. Detailed Implementation
[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0026] Example 1: Obtaining GDPD2 Overexpressing Cells
[0027] The PEDV used in this experiment was the PEDV CV777 strain, which was preserved in our laboratory.
[0028] Design primers for amplifying the full-length porcine GDPD2 gene, GDPD2-F (SEQ ID NO.1): caagctgtgaccggc gc ctac GAATTCGCCACCATGGCCGAGTCCCGC, GDPD2-R (SEQ ID NO.2): accccat cgatggaccggtcg GGATCCCTCCATTATGAAATTGTTGAT. (Italics indicate restriction site sequences, underlined sequences indicate pcDNA3.1 vector homologous arm sequences.) CDS sequences containing restriction sites and vector homologous arms were amplified from IPEC-J2 cells via RT-PCR, and the target fragment was obtained by gel recovery. The pcDNA3.1 vector (Wuhan Miaoling Biotechnology Co., Ltd., catalog number P0156) was double-digested with restriction endonucleases EcoRI and BamHI, and the target fragment was ligated to the pcDNA3.1 vector after double digestion with EcoRI and BamHI using homologous recombination to obtain the pcDNA3.1-GDPD2 vector. The RT-PCR system consisted of: 2 μL template cDNA, 1 μL each of forward and reverse primers, and 2× Hieff... Plus PCR Master Mix High-Fidelity DNA Polymerase 12.5 μL, enzyme-free water to a final volume of 25 μL. PCR program: 98℃ for 3 min; 98℃ for 10 s, 60℃ for 20 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min.
[0029] IPEC-J2 cells were loaded at a rate of 1×10 6Cells were seeded in 6-well plates. When the cell density reached approximately 70%, the constructed pcDNA3.1-GDPD2 vector was transfected into IPEC-J2 cells using jetPRIME transfection reagent. 24 hours after transfection, the culture medium was changed, and G418 was added to a final concentration of 4 μg / mL for drug screening. After 24 hours of drug screening, the culture medium was changed again, and G418 was added again at a final concentration of 4 μg / mL. After three rounds of drug screening, positive cells were obtained, passaged, and cultured to expand their expression. These cells were then used as GDPD2 overexpressing cells for subsequent use.
[0030] Example 2: Verification of the relationship between GDPD2 and PEDV
[0031] (1) GDPD2 overexpressing cells OE-GDPD2, GDPD2 knockout cells GDPD2-KO (for details, see patent: A cell line and its construction method based on CRISPR-Cas9 technology to target and knock out the porcine GDPD2 gene, patent number CN202010867825.9), and control cells (IPEC-J2 cells transfected with pcDNA3.1 empty vector Control or wild-type IPEC-J2 cells WT) were mixed at 1×10⁻⁶ cells per cell line. 5 Cells were seeded in 12-well or 6-well plates. When the cell density reached 80%, PEDV (MOI=1) virus was inoculated. After 2 hours, the medium was replaced with DMEM containing 4 μg / mL trypsin and 2% FBS. After 24 hours of cell culture, the cell supernatant, cellular RNA, and protein were collected for subsequent use.
[0032] (2) RNA collected in step (1) was extracted according to the Trizol reagent extraction instructions and reversed to cDNA. The reverse transcription system was as follows: RNA: 1000 ng, 5×HiScript qRT SuperMix II: 4 μL, enzyme-free water: to a final volume of 20 μL. The reverse transcription reaction program was: 50℃: 15 min, 85℃: 5 s. The expression levels of porcine GDPD2 gene and PEDV M gene were detected by qRT-PCR using cDNA as a template. The primer sequences for GDPD2 gene were: F (SEQ ID NO.3): 5'-CCACAGCCCCATTCCTTC-3', R (SEQ ID NO.4): 5'-GCCC CTCGGTGTCCCATC-3'; the primer sequences for M gene were: F: 5'-AGGTCTGCATTCCAGTGCTT-3'; R: 5'-GGACATAGAAAGCCCAACCA-3'. qRT-PCR system (10 μL): cDNA 1 μL, upstream primer: 0.2 μL, downstream primer: 0.2 μL, SYBR Green Master Mix 5 μL, ddH2O 3.6 μL. Reaction program: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles. Results are as follows: Figure 1 As shown, compared with the control group (WT), GDPD2 mRNA expression was significantly increased in GDPD2 overexpressing cells, indicating successful construction of GDPD2 overexpressing cells. PEDV M gene expression detection results showed that, compared with the control group (WT), the M gene expression level in GDPD2 knockout cells was significantly increased (…). Figure 2 In contrast to the control group (Control), the expression level of the M gene in GDP D2 overexpressing cells was significantly decreased. Figure 3 The above results indicate that GDPD2 can act as an important host factor in regulating PEDV replication.
[0033] (3) Collect the protein from step (1) and lyse the cells with RIPA lysis buffer containing protease inhibitors. Detect the protein concentration according to the BCA instructions, ensuring the protein sample size reaches 20 μg. Add 5×SDS-PAGE loading buffer, denature at 95℃ for 10 min, and then perform SDS-PAGE separation. Transfer the protein to a PVDF membrane and block with skim milk at room temperature for 2 h. Incubate the membrane with anti-GDPD2 (Proteintech, 25074-1-AP) and anti-PEDVN (Youlong Biotech, AA1000) protein antibodies at 4℃ overnight. After washing three times with TBST, incubate the membrane with the corresponding secondary antibodies at room temperature for 2 h, and then detect the protein bands using a chemiluminescence imaging system. The results showed that compared with the control group (Control), the expression level of GDPD2 protein was significantly increased in GDPD2 overexpressing cells, further demonstrating the successful construction of the GDPD2 overexpressing cell line. Figure 4 PEDVN protein assays revealed that, compared to the control group WT, the expression level of N protein in GDPD2 knockout cells was significantly increased. Figure 5 In GDPD2-overexpressing cells, the expression level of N protein was significantly decreased compared to the control group (Control). Figure 6 This further proves that GDPD2 participates in regulating the replication of PEDV.
[0034] (4) Vero cells were seeded at a density of approximately 8000 cells / well in 96-well plates. After cell attachment, the supernatant was discarded. The viral supernatant collected in step (1) was serially diluted 10-fold in eight steps and then added to the 96-well plates. Cells were cultured for 7 days, and the positive rate of cytopathic effects in each well was observed and recorded daily. The viral titer (TCID) in each experimental group was calculated using the Reed-Muench method. 50 The results showed that, compared with the control group WT, the PEDV viral titer in GDPD2 gene knockout cells was significantly increased ( ). Figure 7 In GDPD2-overexpressing cells, the PEDV viral titer was significantly lower than that in the control group (Control). Figure 8 The above results indicate that GDPD2 can inhibit PEDV replication in host cells.
Claims
1. Overexpression pigs GDPD2 The application of gene vectors in the preparation of drugs that inhibit the replication of porcine epidemic diarrhea virus is characterized by, The GDPD2 Gene ID: 100516309.
2. The application according to claim 1, characterized in that, The overexpression pigs GDPD2 The gene vector was constructed as follows: using cDNA from IPEC-J2 cells as a template, PCR amplification of pigs was performed using primer pairs with sequences shown in SEQ ID NO. 1~2. GDPD2 The CDS sequence of the gene is used to insert the obtained target fragment into a base vector. The construction method also includes identifying overexpressing pigs. GDPD2 The steps involved in successfully constructing a gene vector.
3. The application according to claim 2, characterized in that, The base vector is pcDNA3.1 vector.
4. The application according to claim 2, characterized in that, The target fragment is inserted into the base vector at EcoRI and BamHI restriction sites.
5. The application according to claim 2, characterized in that, The PCR amplification program was 98℃ for 3 min; 98℃ for 10 s, 60℃ for 20 s, 72℃ for 1 min, for 35 cycles; 72℃ for 5 min.
6. The application according to claim 2, characterized in that, Used to identify overexpression pigs GDPD2 The qRT-PCR primer sequences for determining whether the gene vector was successfully constructed are shown in SEQ ID NO. 3~4.
7. The application according to claim 6, characterized in that, The qRT-PCR program is 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.
Citation Information
Patent Citations
Cell line for targeted knockout of pig GDPD2 gene based on CRISPR-Cas9 technology, and construction method of cell line
CN112011539A
ShRNA for inhibiting expression of porcine epidemic diarrhea virus M gene, recombinant expression vector and application thereof
CN111454954A
Application of preparation for activating PJA1 gene expression of pig in preparation of medicine for resisting porcine epidemic diarrhea virus infection
CN115957349A