Use of compound incyclinide in the preparation of a medicament for the treatment of dengue virus

By using the compound Incyclinide to inhibit dengue virus replication in cells, the problem of the lack of effective anti-dengue virus drugs in the prior art has been solved, and a significant effect of inhibiting viral replication has been achieved.

CN120154590BActive Publication Date: 2026-06-02ARMY MEDICAL UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ARMY MEDICAL UNIV
Filing Date
2025-04-23
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

There are currently no approved drugs to treat dengue virus, and existing technologies cannot effectively inhibit the replication of dengue virus.

Method used

Treatment of cells with the compound incyclinide at a specific concentration significantly inhibited dengue virus replication in cells, and its inhibitory effect was detected by real-time quantitative PCR.

Benefits of technology

The compound Incyclinide significantly inhibited dengue virus replication at concentrations of 50 μM, 20 μM, and 10 μM, and has the potential to become an anti-dengue virus drug.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120154590B_ABST
    Figure CN120154590B_ABST
Patent Text Reader

Abstract

The application provides application of a compound Incyclinide in preparation of an anti-dengue virus drug, and belongs to the technical field of biological medicines.The dengue virus is a dengue virus with a serum type of DENV-2.The anti-virus activity experiment determines that the compound Incyclinide can significantly inhibit replication of the dengue virus under conditions of concentrations of 50 μM, 20 μM and 10 μM, and the compound Incyclinide has the effect of inhibiting replication of the dengue virus and can be used for preparation of the anti-dengue virus drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of the compound Incyclinide in the preparation of drugs against dengue virus. Background Technology

[0002] Dengue virus (DENV) belongs to the family Flaviviridae. Other important pathogens in this genus include Zika virus and yellowfever. Dengue virus is a single-stranded positive-sense RNA virus, primarily transmitted to humans by Aedes aegypti and Aedes albopictus mosquitoes. DENV has four distinct serotypes (DENV-1–4). Human infection with DENV is usually asymptomatic or causes a range of self-limiting symptoms, including fever and rash. However, some patients develop the fatal dengue hemorrhagic fever / dengue shock syndrome (DHF / DSS).

[0003] Dengue virus enters cells via receptor-mediated endocytosis, releasing approximately 11 kb of single-stranded RNA genome into the cytoplasm. The viral genome RNA contains an open reading frame (ORF) encoding a single polyprotein flanked by a cap-shaped 5' untranslated region (UTR) and a non-polyadenylated 3' UTR, serving as a template for the translation of viral precursor proteins. The single polyprotein is then co-cleaved and post-translationally cleaved into three structural proteins (C, prM, and E) and seven non-structural proteins (NS) (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). The structural proteins are used for viral particle assembly, while the non-structural proteins are primarily involved in viral RNA genome synthesis and further translational processes leading to DENV infection.

[0004] Currently, there are no approved drugs for treating dengue virus on the market. Therefore, it is necessary to provide a new drug for treating dengue fever virus. Summary of the Invention

[0005] The purpose of this invention is to provide the use of the compound Incyclinide in the preparation of drugs against dengue virus.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the use of the compound Incyclinide in the preparation of drugs against dengue virus, wherein the structural formula of the compound Incyclinide is:

[0008] .

[0009] Preferably, the dengue virus is dengue virus with serotype DENV-2.

[0010] Preferably, the dengue virus with serotype DENV-2 includes the DV2 NGC dengue virus strain.

[0011] Preferably, the concentration of the compound Incyclinide in the drug is 10–50 μM.

[0012] This invention provides the application of the compound Incyclinide in the preparation of reagents that inhibit dengue virus replication in cells, wherein the structural formula of the compound Incyclinide is:

[0013] .

[0014] Preferably, the cells include liver cancer cells.

[0015] Preferably, the liver cancer cells include human alveolar basal epithelial cells from lung cancer.

[0016] Preferably, the human alveolar basal epithelial cells of the lung cancer include HUH-7 cells.

[0017] Preferably, the dengue virus is dengue virus with serotype DENV-2.

[0018] Preferably, the dengue virus with serotype DENV-2 includes the DV2 NGC dengue virus strain.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention has determined through antiviral activity experiments that the compound Incyclinide can significantly inhibit dengue virus replication at concentrations of 50 μM, 20 μM, and 10 μM, indicating that the compound Incyclinide has the effect of inhibiting dengue virus replication and can be used to prepare anti-dengue virus drugs. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0022] Figure 1 The example illustrates the inhibitory effect of compound Incyclinide on dengue virus type 2 replication in the supernatant of HUH-7 cells;

[0023] Figure 2 The example illustrates the inhibitory effect of compound Incyclinide on dengue virus type 2 replication in HUH-7 cells. Detailed Implementation

[0024] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0025] The compound Incyclinide used in the following examples has the CAS number 15866-90-7; fetal bovine serum, penicillin sodium, streptomycin, and DMEM culture medium were all purchased from Gibco, USA; PrimeScript™ RT Reagent Kit and TB were used. Premix Ex Taq TM II was purchased from Takara, Japan. The brand of the real-time PCR instrument is LightCycler96 (Roche, USA), and the brand of the CO2 incubator is CCL-170B-8.

[0026] Example

[0027] The steps for evaluating the anti-dengue virus function of compound Incyclinide are as follows:

[0028] 1. Culture of human liver cancer cells

[0029] Human liver cancer cells HUH-7 were divided into groups of 2 × 10⁻⁶ cells per well. 5 The sample was inoculated into 24-well plates and cultured using DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin sodium and 1% streptomycin. The plates were then incubated in a carbon dioxide incubator.

[0030] 2. Cell treatment

[0031] After culturing HUH-7 cells for 24 h, they were divided into four groups: DMSO group, 50 μM group, 20 μM group, and 10 μM group. The DMSO group was treated with 0.01% DMSO, while the 50 μM, 20 μM, and 10 μM groups were treated with 50 μM, 2 μM, and 10 μM of the compound Incyclinide, respectively. The treatment time for each group was 24 h.

[0032] 3. Dengue virus infects cells

[0033] The HUH-7 cells treated above were infected with dengue virus (DV2 NGC strain) with an MOI of 0.4. Two hours after infection, the supernatant was discarded and the cells were collected and replaced with 2% FBS medium. At the same time, the same drugs as the previous day were added to each group. After 24 hours, the cells and cell supernatant were collected and real-time quantitative PCR (RT-qPCR) was performed.

[0034] 4. Real-time quantitative PCR (RT-qPCR) for detecting relative gene expression levels

[0035] Genomic DNA was extracted from the collected cells using a rapid tissue / cell extraction kit (BOER, China), strictly following the manufacturer's instructions. PrimeScript was then used to extract the DNA. TM Reverse transcription was performed using the RT Reagent Kit. TB was used. Premix Ex Taq TM II and RT-qPCR was performed on samples 96. The amplification reaction system used for the detection is shown in Table 1. The reaction conditions were as follows: Step 1: Pre-denaturation at 95℃ for 30s; Step 2: Denaturation at 95℃ for 5s, then at 60℃ for 30s, for 40 cycles; Step 3: Melting curve reaction conditions: gradually increase the temperature to 95℃. After the PCR reaction, the melting curve and amplification curve were checked for any abnormalities. The experimental data were exported, and the expression level of the target gene was calculated using the -ΔΔct method.

[0036] Table 1. Amplification reaction system used for RT-qPCR detection.

[0037] name volume TBGreenPremixExTaqII(TliRNaseHPlus)(2×) 5μL 10 μM upstream primer (CCGTTCACGACCAGCATAGG, SEQ ID NO.1) 0.5μL 10 μM downstream primer (TCAGTCATGGCTTCAACGTGGT, SEQ ID NO.2) 0.5μL template 2μL <![CDATA[Nuclease-free ddH2O]]> up to 10 μL

[0038] 5. Data Analysis

[0039] The statistical data obtained above were analyzed using GraphPad Prism v6.0 software. Unpaired two-tailed Student's t-test was used for between-group statistical analysis; P ≤ 0.05 indicated a significant difference between groups.

[0040] The inhibitory effect of the compound incyclinide on the replication of dengue virus type 2 in the supernatant of HUH-7 cells is as follows: Figure 1 As shown, the inhibitory effect on dengue virus type 2 replication in HUH-7 cells is as follows: Figure 2 As shown in the figure, compared with the DMSO group, the 50μM, 20μM, and 10μM groups all significantly inhibited dengue virus replication in the supernatant and intracellular fluid of HUH-7 cells, indicating that the compound Incyclinide has excellent inhibitory effects on dengue virus replication and is expected to become a new anti-dengue virus drug.

[0041] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of compound Incyclinide in the preparation of drugs against dengue virus, characterized in that, The structural formula of the compound Incyclinide is: 。 2. The application as described in claim 1, characterized in that, The dengue virus in question is serotype DENV-2.

3. The application as described in claim 2, characterized in that, The dengue virus with serotype DENV-2 includes the DV2NGC dengue virus strain.

4. The application as described in claim 1, characterized in that, The concentration of the compound Incyclinide in the drug is 10-50 μM.