A method for in vitro self-circulation synthesis of alpha, omega-dihydroxy fatty acids

The in vitro self-circulating biotransformation system constructed by bridging flavin catalyst F4 solves the problems of environmental pollution and low efficiency in the preparation of α,ω-dicarboxylic acids in existing technologies, and realizes the synthesis of α,ω-dicarboxylic acids with high efficiency and low cost, which is applicable to a variety of fatty acid substrates.

CN122189117APending Publication Date: 2026-06-12NANJING TECH UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING TECH UNIV
Filing Date
2026-01-21
Publication Date
2026-06-12

Smart Images

  • Figure CN122189117A_ABST
    Figure CN122189117A_ABST
Patent Text Reader

Abstract

The application provides a method for in-vitro self-circulation synthesis of alpha, omega-dibasic fatty acid, which comprises using H2O2-dependent P450 monooxygenase to catalyze methyl hydroxylation of fatty acid ends to synthesize omega-hydroxy fatty acid, and using an enzyme with alcohol oxidation and aldehyde oxidation dual catalytic functions or using alcohol dehydrogenase and aldehyde dehydrogenase to oxidize omega-hydroxy fatty acid to alpha, omega-dibasic fatty acid with NAD + as a cofactor, and using bridged flavin catalyst F4 to oxidize and regenerate NADH to NAD + Meanwhile, H2O2 is generated in-situ to supply omega-hydroxy fatty acid synthesis. The method provided by the application uses renewable resource fatty acid as a substrate, realizes cyclic regeneration of cofactor NAD + / NADH and in-situ generation and safe use of H2O2, and has the advantages of simple catalytic process, low cost, low pollution and high conversion rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biocatalysis technology, specifically relating to a method for the in vitro self-circulating synthesis of α,ω-dicarboxylic acids. Background Technology

[0002] α,ω-dicarboxylic acids (α,ω-DCAs) are an important class of platform chemicals with wide applications in the production of high-performance polyamides, polyesters, plasticizers, adhesives, and coatings. Traditional α,ω-DCAs preparation mainly relies on chemical oxidation routes, such as cyclohexanone oxidation or butadiene processes, but these typically require strong acid systems and heavy metal catalysts, and are accompanied by emissions of pollutants such as N2O5, posing significant environmental problems. While bio-based routes based on microbial fermentation have some sustainability potential, their industrial sustainability is still limited by factors such as reliance on non-renewable alkanes as raw materials and difficulties in product extraction and purification.

[0003] Fatty acids are abundant and are important renewable raw materials for the production of various high-value chemicals, including α,ω-DCAs. In recent years, the ω-oxidation pathway of bacterial cytochrome P450 monooxygenases (CYPs) has enabled the biosynthesis of fatty acids to α,ω-DCAs in engineered bacteria such as *E. coli*. For example, by constructing a multi-enzyme cascade system of CYP153 monooxygenase with alcohol dehydrogenases, aldehyde dehydrogenases, etc., the continuous conversion from terminal hydroxylation to carboxylation can be achieved. However, existing engineered bacterial systems generally face the following problems: imbalance between the biosynthetic module and the cofactor regeneration module, limited substrate and oxygen uptake, poor coordination of multi-enzyme system expression, and low catalytic efficiency, resulting in low conversion rates and product yields.

[0004] Compared to cellular systems, in vitro biotransformation (ivBT) cascades overcome the limitations of cellular metabolic regulation, offering greater flexibility and controllability. They also avoid substrate uptake and product efflux constraints, providing a superior engineering platform for complex oxidation reactions. However, existing P450 enzyme systems for α,ω-DCAs synthesis typically require complex electron transport protein partners and specific NAD(P)H / NAD(P) pairings. + The continuous consumption of cofactors can easily lead to the disruption of redox balance and increase the difficulty of system construction.

[0005] To date, no complete enzymatic cascade reaction from fatty acids to diacids has been achieved using the ivBT system. Therefore, it is necessary to simplify and optimize the catalytic enzyme system, cofactor regeneration method, and oxidation module to construct an efficient and sustainable in vitro biotransformation platform for diacids. Summary of the Invention

[0006] Based on the advantages of in vitro biosynthesis systems and the problems existing in α,ω-DCAs production methods, this invention provides a method for preparing α,ω-DCAs through in vitro biotransformation with cofactor recycling. This invention designs an in vitro dual-enzyme cascade catalytic reaction system that eliminates the need for the additional expensive cofactor NADPH, enabling the production of NADPH-based α,ω-DCAs. + The recycling and regeneration of NADH and the in-situ regeneration of H2O2 enable efficient conversion of substrates. The system is simple and low-cost, providing a reserve technology for industrial production.

[0007] The specific technical solution of this invention is as follows:

[0008] Application of bridged flavin catalyst F4 in an in vitro self-circulating synthesis system of α,ω-dicarboxylic acids, wherein the in vitro self-circulating synthesis system includes bridged flavin catalyst F4, an ω-hydroxy fatty acid synthesis system, and an α,ω-dicarboxylic acid synthesis system, wherein the bridged flavin catalyst F4 is... ;

[0009] The ω-hydroxy fatty acid synthesis system uses H2O2-dependent P450 monooxygenase to catalyze the methyl hydroxylation of fatty acids (C8-C16 fatty acids) to obtain ω-hydroxy fatty acids, R-CH3+ H2O2→R-CH2OH+H2O, where R represents -(CH2)n-COOH, and n=6~14 integers; the preferred fatty acid is lauric acid;

[0010] The α,ω-dicarboxylic acid synthesis system uses enzymes with dual catalytic functions of alcohol oxidation and aldehyde oxidation, or utilizes alcohol dehydrogenase and aldehyde dehydrogenase to obtain NAD+. + As a cofactor, ω-hydroxy fatty acids are oxidized to α,ω-dicarboxylic acids: HO-CH2-(CH2)n-COOH + H2O + 2NAD + → HOOC-(CH2)n-COOH + 2NADH + 2 H + ;

[0011] The bridged flavin catalyst F4 accepts electrons and protons from NADH in the α,ω-dicarboxylic acid synthesis system, oxidizing and regenerating it into NAD. + Simultaneously, H2O2 is generated in situ to supply the ω-hydroxy fatty acid synthesis system, enabling the system to achieve self-circulation, NADH+ H + + O2→ NAD + + H2O2.

[0012] Based on the above applications, this invention provides a method for in vitro self-circulating synthesis of α,ω-difatty acids, comprising the following steps:

[0013] (1) Synthesis of ω-hydroxy fatty acids: The methyl hydroxylation of fatty acids is catalyzed by H2O2-dependent P450 monooxygenase to obtain ω-hydroxy fatty acids, R-CH3+ H2O2→ R-CH2OH + H2O, R=(CH2)n-COOH, n=6~14 integers;

[0014] (2) Synthesis of α,ω-difatty acids: using enzymes with dual catalytic functions of alcohol oxidation and aldehyde oxidation, or utilizing alcohol dehydrogenase and aldehyde dehydrogenase to obtain NAD+. + As a cofactor, it oxidizes ω-hydroxy fatty acids to α,ω-dicarboxylic acids: HO-CH2-(CH2)n-COOH + H2O + 2NAD + → HOOC-(CH2)n-COOH + 2 NADH + 2 H + ;

[0015] (3) The NADH generated in step (2) is oxidized and regenerated into NAD by the bridged flavin catalyst F4. + Simultaneously, H2O2 is generated in situ, NADH + H + + O2→ NAD + + H2O2, NAD + The H2O2 is supplied to step (1) for recycling.

[0016] The P450 monooxygenase described in this invention is derived from Spongiibacter sp IMCC 21906, the alcohol dehydrogenase is selected from Saccharomyces cerevisiae S288C, the aldehyde dehydrogenase is selected from Marinobactera quaeolei, and the enzyme with dual catalytic functions of alcohol oxidation and aldehyde oxidation is derived from Geobacillus thermonitrificans.

[0017] The amino acid sequence of the P450 monooxygenase derived from Spongiibacter sp IMCC 21906 is shown in SEQ ID NO:1; the amino acid sequence of the alcohol dehydrogenase derived from Geobacillus thermodenitrificans, which has dual catalytic functions of alcohol oxidation and aldehyde oxidation, is shown in SEQ ID NO:2.

[0018] The reaction described in this invention can be carried out under different temperature conditions, preferably 20°C to 50°C.

[0019] In the method described in this invention, the concentration of the bridging flavin catalyst F4 is 0.1~2.0 mM.

[0020] The method described in this invention can be carried out under different enzyme-to-base ratios, including 1:50 to 1000.

[0021] The method of the present invention uses fatty acid substrates comprising one or more of octanoic acid (C8), decanoic acid (C10), lauric acid (C12), tetradecanoic acid (C14), and hexadecanoic acid (C16), with a fatty acid concentration of 2 mM.

[0022] Based on the above method, this invention further provides an in vitro self-circulating reaction system for the synthesis of α,ω-difatty acids, comprising a reaction substrate fatty acid, an H2O2-dependent P450 monooxygenase, an enzyme with dual catalytic functions of alcohol oxidation and aldehyde oxidation, or an alcohol dehydrogenase and an aldehyde dehydrogenase, a bridging flavin catalyst F4, H2O2, and NAD. + .

[0023] Preferably, the reaction system is a phosphate buffer system with a pH of 6.0 to 8.5.

[0024] Preferably, the concentration of the substrate fatty acid is not less than 2 mM. The amount of P450 monooxygenase added is 3 µM, and the amount of the enzyme with dual catalytic functions of alcohol oxidation and aldehyde oxidation added is 5 µM. The reaction system contains 100 mM H2O2 and 0.1 mM NAD. + 0.1 mM bridged flavin catalyst F4.

[0025] Advantages of this invention:

[0026] Bridged flavin catalyst F4 is a highly efficient, stable, metal-free, and light-free water-soluble organic catalyst that can achieve NAD+ using oxygen under mild conditions. + / NADP + In-situ regeneration of NAD+, accompanied by H2O2 generation (see ACS Catal. 2016, 6, 4989−4994). This invention is the first to utilize the bridged flavin catalyst F4 as an "electron relay station" or "bridge" to achieve NAD+ regeneration in flavin-dependent dehydrogenases / oxidoreductases. + The efficient cycling properties of NADH were applied to the synthesis of α,ω-difatty acids, constructing an in vitro self-circulating biosynthetic system. This system utilizes NAD+... + The recycling and in-situ regeneration of NADH and H2O2 provide reactants for the synthesis steps of ω-hydroxy fatty acids and α,ω-dicarboxylic acids. The reaction system is simple, low-cost, and has broad substrate adaptability. Attached Figure Description

[0027] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0028] Figure 1 SDS-PAGE electrophoresis analysis of alcohol dehydrogenase ADH2. Lane 1 contains the soluble crude enzyme solution expressed intracellularly, lane 2 is the blank control, and lane 3 contains the purified enzyme.

[0029] Figure 2 The results are for screening bifunctional alcohol dehydrogenases.

[0030] Figure 3 Enzymatic properties analysis of the bifunctional alcohol dehydrogenase ADH2, including (a) optimal temperature, (b) temperature stability, (c) optimal pH, and (d) pH stability.

[0031] Figure 4 The results of catalysis and mass spectrometry of 12-hydroxylauric acid by the bifunctional alcohol dehydrogenase ADH2 are presented.

[0032] Figure 5 The results show the catalytic effect of the bifunctional alcohol dehydrogenase ADH2 on 12-hydroxylauric acid in the reaction system with ADH and ALDH.

[0033] Figure 6 This provides a pathway for the preparation of α,ω-DCAs from fatty acids using an in vitro two-enzyme cascade system.

[0034] Figure 7 To investigate the catalytic conversion of lauric acid to lauryl iodide under different pH conditions.

[0035] Figure 8 To investigate the catalytic conversion of lauric acid to lauryl iodide under different temperature conditions.

[0036] Figure 9 The synthesis of lauric acid from lauric acid was studied under different concentrations of the bridging flavin catalyst F4.

[0037] Figure 10 To investigate the synthesis of lauric acid from lauric acid under different dual-enzyme concentration ratios.

[0038] Figure 11 The system was designed to catalyze the synthesis of lauric acid from lauric acid under different enzyme-to-base ratios (E / S).

[0039] Figure 12 This represents the catalytic ability of the reaction system for fatty acid substrates of different chain lengths. Detailed Implementation

[0040] To enable those skilled in the art to better understand the present invention, the invention will be further described below with reference to the accompanying drawings and embodiments. It should be noted that these embodiments are only for explaining the invention and not for limiting its scope. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.

[0041] Example 1: Preparation of alcohol dehydrogenase ADH2

[0042] (1) Construction of engineered bacteria expressing bifunctional alcohol dehydrogenase ADH2

[0043] The bifunctional alcohol dehydrogenase ADH2 described in this invention is derived from *Geobacillus thermodenitrificans*, and its amino acid sequence is shown in SEQ ID NO:2. To improve protein expression, a recombinant *E. coli* expression vector was constructed. The enzyme was prepared according to the literature *Microbiology* (2009), 155, 2078-2085. Using genomic DNA of the strain *Geobacillus thermodenitrificans* as a template, high-fidelity enzyme 2×Phanta Max Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and primer pair BF(5'CG) were used. CATATG CAAAATTTTACGTTTCGCAATCCG 3', Nde I) and BR (5'GC CTCGAG PCR amplification was performed using ATTTCTGCGTGCGTTTTACCG 3', Xho I), following the experimental procedures outlined in the Vazyme biological products and user manual. The amplified coding gene DNA fragment should be 1161 bp. Nucleic acid electrophoresis verified the correct band length, and its base sequence is shown in SEQ ID NO:3. The amplified DNA fragment was then digested with Dpn I to digest the template DNA. After digestion, the PCR product was purified to remove primers, enzymes, mononucleotides, etc. This step was performed using the AxyPrep PCR Clean up kit.

[0044] The purified DNA fragment was double-digested with the vector pET-22b(+) using Nde I and Xho I (Baori Biotechnology Co., Ltd.). Each digestion was performed in 50 μl solutions, following the instructions of the DNA restriction endonuclease manufacturers. After digestion, the DNA fragment was recovered using a gel. Ligation of the vector DNA and the fragment DNA was carried out at a molar ratio of 1:3, using a 10 μl ligation solution catalyzed by T4 ligase. Ligation was performed overnight at 16°C to obtain the plasmid pET22b-ADH2. After ligation, the ligation solution was transformed into competent E. coli BL21(DE3) cells using the heat shock method and plated on LB agar plates containing 100 μg / ml ampicillin, incubated at 37°C for 14-16 h. Sequencing results were verified by sequencing (performed by Anhui General Biotechnology Co., Ltd.), yielding the corresponding recombinant strain E. coli BL21(DE3)-ADH2.

[0045] (2) Expression of alcohol dehydrogenase ADH2

[0046] The recombinant strain constructed in step (1) was inoculated into 50 mL of LB liquid medium, and ampicillin was added to a final concentration of 100 µg / mL. The culture was incubated overnight at 37°C at 180 rpm / min. 2% of the overnight cultured seed culture was inoculated into 50 mL of fresh LB liquid medium and incubated at 37°C at 180 rpm / min until the OD600 reached 0.6–1.0. IPTG (final concentration 0.1 mM) was then added, and expression was induced at 20°C for 16–20 h. The induced fermentation broth was centrifuged at 12000 rpm / min for 10 min, the supernatant was discarded, and the cells were resuspended in a 50 mM K2HPO4-KH2PO4 (pH 8.3) buffer. The cells were then sonicated and subjected to SDS-PAGE electrophoresis. The stacking gel concentration was 4%, the separating gel concentration was 12.5%, and the sample was mixed with the loading buffer at a 3:1 ratio. The mixture was reacted in a boiling water bath for 5 min before electrophoresis. The electrophoresis apparatus was set to an initial voltage of 120V. As the sample moved to the separating gel, the voltage was increased to 230V until the sample reached the bottom of the electrophoresis tank, at which point the electrophoresis ended. The results are as follows: Figure 1 As shown, the molecular weight of ADH2 is 42.8 kDa, which is consistent with the calculated molecular weight, indicating that ADH2 was successfully induced and expressed, accounting for about 80% of the total soluble protein.

[0047] (3) Isolation and purification of alcohol dehydrogenase ADH2

[0048] Because ADH2 has a six-histidine (His) tag fused to its N-terminus, nickel chloride in the Ni column can bind to proteins containing the His tag and also to imidazole. Therefore, the Ni column was used to purify the target protein separately. Example 2: After centrifugation, the supernatant from the fermentation expression was filtered through a 0.22 μm filter. The Ni column was washed with Buffer A (50 mM Tris-HCl, pH 8.0) at a flow rate of 2 mL / min until equilibration. The protein sample was injected into the injection loop using a syringe, and the breakthrough protein was collected. The Ni column was washed again with Buffer A (50 mM Tris-HCl, pH 8.0) until no protein was eluted. The target protein was eluted using a gradient of 20% Buffer B (50 mM Tris-HCl, 500 mM imidazole, pH 8.0). The protein solution purified by nickel column was subjected to desalting using a pre-packed GE desalting column. The imidazole-containing buffer was replaced with 50 mM Tris-HCl (pH 8.0) to remove imidazole from the protein solution. The collected protein solution was validated by SDS-PAGE, and the results are shown below. Figure 1 The amino acid sequencing results were consistent with those of SEQ ID NO:1.

[0049] Following the above method, pure enzyme solutions of alcohol dehydrogenase ABO (ABO67118.1) from Geobacillus thermodenitrificans NG80-2, alcohol dehydrogenase 101 (WP_088554065.1) from Calderihabitans maritimus, and alcohol dehydrogenase VEG (VEG72963.1) from Pasteurella aerogenes were prepared.

[0050] Example 2 Screening of bifunctional alcohol dehydrogenases

[0051] Enzyme activity assay:

[0052] The recombinant strain constructed in Example 1 was fermented and cultured according to the method in Example 2. The enzyme activity of the obtained crude protein enzyme solution was measured using 12-hydroxylauric acid as a substrate. The measurement method is as follows:

[0053] Enzyme activity unit definition: One enzyme activity unit is the amount of enzyme required to catalyze the production of 1 μmol of lauryl iodide per minute from 12-hydroxylauric acid at 30℃ and pH 8.3.

[0054] Accurately weigh 20 mg of 12-hydroxylauric acid and dissolve it in 1 mL of DMSO. Mix well to obtain a 100 mM substrate solution. Accurately pipette 10 μL of the substrate solution into a reaction vessel, add 45 μL of appropriately diluted enzyme solution, and add NAD+ to a final concentration of 0.1 mM. + Using an inactivated enzyme reaction solution as a control, the reaction was carried out at 30 °C for 30 min, and the product formation was detected by gas chromatography. The gas chromatography results are as follows: Figure 2 As shown, both ABO and ADH2 can catalyze the conversion of 12-hydroxylauric acid to lauryl acid, while 101 and VEG did not detect the target product under the same conditions, indicating that they have no catalytic activity or low activity for this substrate. Meanwhile, the amount of lauryl acid generated by ADH2 was significantly higher than that generated by ABO, indicating that ADH2 has higher catalytic efficiency and can be considered a preferred enzyme for further research.

[0055] Example 3: Stability analysis of the bifunctional alcohol dehydrogenase ADH2

[0056] To determine the optimal conditions for the catalytic reaction of ADH2, the optimum temperature and temperature stability of ADH2 were measured. Optimal temperature: The purified enzyme obtained in Example 4 was appropriately diluted and added to the substrate solution prepared in Example 3. The solutions were then reacted in water baths at 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, and 70 °C for 30 min. Product formation was detected by gas chromatography, and enzyme activity at each temperature was calculated according to a standard curve. Figure 2 As shown, the optimal temperature for ADH2 is 45 ℃.

[0057] Temperature stability: The purified enzyme obtained in Example 4 was appropriately diluted and incubated in water baths at 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, and 70 ℃ for 2 h each. After incubation, samples were taken and the remaining enzyme activity was measured according to the enzyme activity assay method in Example 3. The highest enzyme activity at 0 h was taken as 100%, and the relative enzyme activity after incubation at each temperature was calculated. Curves showing the changes in residual enzyme activity under different incubation conditions were plotted. The results are as follows: Figure 3 As shown, after ADH2 was incubated at 20–45°C for 2 hours, the original enzyme activity was minimally lost, retaining 80% of the enzyme activity.

[0058] Example 4: Catalytic effect of the bifunctional alcohol dehydrogenase ADH2 and ADH+ALDH catalytic system on 12-hydroxylauric acid

[0059] To investigate whether there are differences between the ADH2 catalytic system and those of ADH and ALDH, this example uses 12-hydroxylauric acid as a substrate to study the two systems. The reaction system contained 2 mM substrate (100 mM substrate dissolved in DMSO), 0.5 mg / mL purified ADH2 enzyme solution / ADH (NC_001147.6) + ALDH (CCG96717.1) enzyme solution, and NAD+ was added to a final concentration of 0.1 mM. + The enzyme reaction was activated. The reaction was carried out at 45℃ and 1000 rpm for 2 h. After the reaction, the product concentration was determined by gas chromatography (GC). The GC analysis conditions were as follows: HP-5 capillary column (30 m × 0.320 mm id × 0.25 μm) and flame ionization detector (FID).

[0060] Experimental results Figure 4 As shown, the results indicate that under the same protein concentration conditions in the system, ADH2 single enzyme can achieve the same level of catalytic reaction as ADH and ALDH dual enzymes.

[0061] Example 5: Construction of an in vitro self-circulating catalytic system for α,ω-DCAs

[0062] The P450 monooxygenase MCC selected in this invention can utilize the specificity of H2O2 to hydroxylate lauric acid at the end to generate 12-hydroxylauric acid, and the long-chain alcohol dehydrogenase ADH2 can realize a one-step reaction from hydroxyl to carboxyl group.

[0063] Add the following to a 2 ml centrifuge tube sequentially: lauric acid substrate to a final concentration of 2 mM; P450 monooxygenase MCC from Spongiibacter sp. IMCC 21906 to a final concentration of 3 µM; long-chain alcohol dehydrogenase ADH2 from Geobacillus thermodenitrificans to a final concentration of 5 µM; and NAD+. + The initial addition amount was 0.1 mM, and the initial addition amount of bridged flavin catalyst F4 (FMN) was 0.5 mM. Kpi phosphate buffer (pH 7.5) was added to a final concentration of 100 mM, and water was added to bring the total volume to 500 μl. After mixing, the reaction was carried out at 30℃ and 1000 rpm for 20 h. Under aerobic conditions, the F4 catalyst can achieve in-situ NAD+ uptake. +The NADH cycle regenerates and simultaneously generates H₂O₂, driving the terminal hydroxylation of MCC and the continuous oxidation reaction of ADH₂. The reaction is terminated by adding 6M HCl and extracted with twice the volume of ethyl acetate. After drying under nitrogen, the product is derivatized with BSTFA reagent at 70°C for 30 min. Gas chromatography-GC-FID detection equipped with a flame ionization detector revealed the formation of the final product, lauryl iodide. This system requires only two enzymes (MCC and ADH₂) and, driven by an F₄ autocatalytic cycle, can achieve a highly efficient in vitro conversion from lauric acid to lauryl iodide, providing a technological basis for constructing a green and simplified lauryl iodide synthesis system.

[0064] Example 6: Optimization of key reaction conditions.

[0065] The reaction conditions of the in vitro synthesis system determined in Example 5 were optimized, including reaction pH, reaction temperature, FMN addition amount, MCC to ADH2 ratio and enzyme-to-bottom ratio (E / S).

[0066] 1. The optimal pH for the reaction was determined by conducting the reaction at pH 6.0, 6.5, 7.0, 7.5, 8.0, and 8.5, respectively. All other reaction conditions were consistent with Example 1. After the reaction, the formation of the final product, lauryl icing, was detected by GC-FID. Bar charts of product concentrations under different pH conditions were plotted, and the results are shown below. Figure 7 As shown, the optimal pH for the reaction is 8.0.

[0067] 2. The optimal reaction temperatures were set at 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃, respectively. All other reaction conditions were the same as in Example 5. After the reaction, the formation of the final product, lauryl icing, was detected by GC-FID. Bar charts of product concentrations under different temperature conditions were plotted, and the results are shown below. Figure 8 As shown, the optimal reaction temperature is 40 °C.

[0068] 3. The bridging flavin catalyst F4 was added at concentrations of 0 mM, 0.5 mM, 1 mM, 1.5 mM, and 2.0 mM, respectively, and the remaining reaction conditions were the same as in Example 5. After the reaction, the formation of the final product, lauryl icing, was detected by GC-FID. A bar chart of product concentration under different F4 concentrations was plotted, and the results are shown below. Figure 9 As shown, the optimal FMN concentration for the reaction is 1.5 mM. The conversion rate at 2.0 mM is consistent with that at 1.5 mM, indicating that the reaction has reached a relatively saturated state.

[0069] 4. The MCC / ADH2 ratio and enzyme concentration ratio were determined to be 1:1, 1:2, 1:4, 1:5, 1:10, and 1:15, respectively. All other reaction conditions were the same as in Example 5. After the reaction, the formation of the final product, lauryl iodide, was detected by GC-FID. A bar chart of the conversion rate under different MCC / ADH2 ratios was plotted. The results are shown below. Figure 10 As shown, the conversion rate reaches its highest when MCC / ADH2 = 1:10, indicating that the first step of the hydroxylation reaction is rapid and a certain amount of ADH2 is needed to quickly convert the intermediate product into the final substrate, lauryl iodide.

[0070] 5. The enzyme-to-substrate lauric acid ratio (E / S) was set to 1:10 with an MCC to ADH2 ratio of 1:10. The enzyme-to-substrate ratios were 1:1000, 1:500, 1:200, and 1:50, respectively. All other reaction conditions remained the same as in Example 5. After the reaction, the formation of the final product, lauric acid, was detected by GC-FID. A bar chart of the conversion rate under different E / S conditions was plotted. The results are shown below. Figure 11 As shown, the conversion rate reaches its highest when E / S = 1:50.

[0071] Example 7 Catalytic efficiency of α,ω-DCAs in vitro self-circulating catalytic system for fatty acids of different chain lengths.

[0072] For the in vitro synthesis system and optimal reaction conditions determined in Examples 5 and 6, hexanoic acid (C6), octanoic acid (C8), decanoic acid (C10), tetradecanoic acid (C14), hexadecanoic acid (C16), and octadecanoic acid (C18) were selected for verification. The remaining reaction conditions were consistent with those in Example 6. After the reaction, the formation of the final product dicarboxylic acid was detected by GC-FID, and a conversion bar chart was plotted and compared with the lauric acid reaction system. The results are as follows: Figure 12 As shown, this catalytic system exhibits the highest catalytic efficiency for the substrate lauric acid and is more biased towards the oxidation of medium- and long-chain fatty acids. No target products were detected at C6 and C18, suggesting that the MCCs in the first hydroxylation reaction may be selective for the substrates and cannot oxidize these two substrates.

Claims

1. The application of bridged flavin catalyst F4 in the in vitro self-circulating synthesis system of α,ω-diacids, characterized in that... The in vitro self-circulating synthesis system includes a bridged flavin catalyst F4, an ω-hydroxy fatty acid synthesis system, and an α,ω-dicarboxylic acid synthesis system. The bridged flavin catalyst F4 is ; The ω-hydroxy fatty acid synthesis system uses H2O2-dependent P450 monooxygenase to catalyze the methyl hydroxylation of fatty acid terminals to obtain ω-hydroxy fatty acids. The α,ω-dicarboxylic acid synthesis system uses enzymes with dual catalytic functions of alcohol oxidation and aldehyde oxidation, or utilizes alcohol dehydrogenase and aldehyde dehydrogenase to obtain NAD+. + It acts as a cofactor to oxidize ω-hydroxy fatty acids to α,ω-dicarboxylic acids; The bridged flavin catalyst F4 accepts electrons and protons from NADH in the α,ω-dicarboxylic acid synthesis system, oxidizing and regenerating it into NAD. + Simultaneously, H2O2 is generated in situ to supply the ω-hydroxy fatty acid synthesis system, enabling the system to self-circulate.

2. A method for in vitro self-circulating synthesis of α,ω-difatty acids, characterized in that... Includes the following steps: (1) Synthesis of ω-hydroxy fatty acids: ω-hydroxy fatty acids are obtained by catalyzing the methyl hydroxylation of fatty acid terminals with H2O2-dependent P450 monooxygenase. (2) Synthesis of α,ω-difatty acids: using enzymes with dual catalytic functions of alcohol oxidation and aldehyde oxidation, or utilizing alcohol dehydrogenase and aldehyde dehydrogenase to obtain NAD+. + It acts as a cofactor to oxidize ω-hydroxy fatty acids to α,ω-dicarboxylic acids; (3) The NADH generated in step (2) is oxidized and regenerated into NAD by the bridged flavin catalyst F4. + Simultaneously, H2O2 and NAD are generated in situ. + The H2O2 is supplied to step (1) for recycling.

3. The method as described in claim 2, characterized in that... The P450 monooxygenase is derived from Spongiibacter spIMCC 21906, the alcohol dehydrogenase is derived from Saccharomyces cerevisiae S288C, the aldehyde dehydrogenase is derived from Marinobacter aquaeolei, and the enzyme with dual catalytic functions of alcohol oxidation and aldehyde oxidation is derived from Geobacillus thermodenitrificans.

4. The method as described in claim 3, characterized in that... The amino acid sequence of the P450 monooxygenase derived from Spongiibacter sp IMCC 21906 is shown in SEQ ID NO:1; the amino acid sequence of the alcohol dehydrogenase derived from Geobacillus thermodenitrificans, which has dual catalytic functions of alcohol oxidation and aldehyde oxidation, is shown in SEQ ID NO:

2.

5. A reaction system for the in vitro self-circulating synthesis of α,ω-difatty acids, characterized in that... The reaction substrates include fatty acids, H2O2-dependent P450 monooxygenases, enzymes with dual catalytic functions of alcohol oxidation and aldehyde oxidation, or alcohol dehydrogenases and aldehyde dehydrogenases, bridged flavin catalyst F4, H2O2, and NAD. + The bridged flavin catalyst F4 is .

6. The reaction system as described in claim 5, characterized in that... The P450 monooxygenase is derived from Spongiibactersp IMCC 21906, the alcohol dehydrogenase is derived from Saccharomyces cerevisiae S288C, the aldehyde dehydrogenase is derived from Marinobacter aquaeolei, and the enzyme with dual catalytic functions of alcohol oxidation and aldehyde oxidation is derived from Geobacillus thermodenitrificans.

7. The reaction system as described in claim 5, characterized in that... The reaction system is a phosphate buffer system with a pH of 6.0~8.

5.

8. The reaction system as described in claim 5, characterized in that... The concentration of the substrate fatty acid should not be less than 2 mM.

9. The reaction system as described in claim 5, characterized in that... The amount of P450 monooxygenase added is 3 µM, and the amount of enzyme with dual catalytic functions of alcohol oxidation and aldehyde oxidation added is 5 µM.

10. The system as described in claim 5, characterized in that... The reaction system contains 100 mM H2O2 and 0.1 mM NAD. + 0.1 mM bridged flavin catalyst F4.