Application of INHA gene molecular marker in identifying chicken muscle drip loss traits

By screening the C+849T site on exon 2 of the INHA gene of Ningdu Yellow Rooster, high-quality chicken meat was identified and bred, solving the problem of insufficient research on chicken meat quality traits in existing technologies, improving the drip loss trait of chicken meat, and meeting consumer demand.

CN122189194APending Publication Date: 2026-06-12NANCHANG NORMAL UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANCHANG NORMAL UNIV
Filing Date
2026-02-12
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

There are no existing studies on the role of the INHA gene in chicken meat quality traits, especially reports on its correlation with muscle drip loss traits, which affects the effectiveness of chicken meat quality breeding.

Method used

By screening the C+849T site on exon 2 of the INHA gene in Ningdu Yellow Rooster, it was found that it was significantly associated with 48h drip loss of muscle in chicken meat quality traits. The INHA gene molecular marker was provided for the identification and selection of high-quality chicken meat. The genotype of this site was amplified and sequenced using primer pairs, and the TT genotype was selected as the dominant genotype for breeding.

Benefits of technology

This provides a theoretical basis for the selection and breeding of chicken meat quality traits at the molecular level, and improves the drip loss trait of chicken meat through screening and breeding, thereby meeting consumers' demand for chicken quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189194A_ABST
    Figure CN122189194A_ABST
Patent Text Reader

Abstract

The application discloses application of an INHA gene molecular marker in identification of chicken muscle drip loss traits and belongs to the technical field of genetic engineering. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and a mutation site of the SNP molecular marker is located at the 849th bp of a CDS sequence of an INHA gene. A C / T mutation exists at the site, and the mutation site has CC, CT and TT genotypes. It is found through experiments that the SNP molecular marker is significantly related to 48h drip loss of chicken muscle, and the advantageous genotype of the mutation site of the SNP molecular marker is TT. The application can provide a theoretical basis for local chicken breed meat quality trait breeding and marker-assisted selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to... INHA Application of gene molecular markers in identifying drip loss traits in chicken muscle. Background Technology

[0002] Inhibin (INH) is a heterodimeric glycoprotein hormone secreted by granulosa cells of the female ovary and Sertoli cells of the male testis. It belongs to the transforming growth factor β superfamily and consists of two distinct subunits, α and β, linked by a disulfide bond. INH plays a crucial role in follicle development, oocyte maturation, and embryonic development. INH exists in two forms: INHA (αβA) and INHB (αβB). INHA and INHB have essentially the same functional activity, and at the amino acid level, they are roughly the same except for significant differences in the content of histidine, isoleucine, and lysine.

[0003] Inhibin INHA primarily originates from dominant follicles and luteal cells, produced and secreted by the granulosa layer of large pre-ovulatory follicles. mRNA encoding the α- and βA-subunits is also found in chicken skeletal and cardiac muscle tissues; simultaneously, βA-subunit mRNA has been detected in small intestinal muscle. INHA The gene is located on chromosome 7, contains two exons and one intron, is 1679 bp in length, and has a coding region of 987 bp, encoding 329 amino acids. Researchers both domestically and internationally have discovered the important regulatory role of inhibin in reproductive function in animals such as pigs, cattle, sheep, and mice, and in chickens, it is also largely related to the growth and reproductive traits of hens. Active immunization against INHA leads to increased ovulation in sheep, pigs, chickens, mice, and cattle. INHA It is considered the functional center of inhibin and has the potential to increase the ovulation rate of poultry.

[0004] Numerous research reports indicate that INHA Genes are not only closely related to human reproductive performance, but also to animal reproductive performance. INHA The gene has been confirmed as a major or candidate gene affecting reproductive performance. Single nucleotide polymorphism analysis related to chicken reproductive traits revealed... INHA It may be a candidate gene for improving reproductive traits in chickens. Gui Taotao et al. discovered this through SNP screening. INHA It is likely one of the main genes affecting follicle development and plays a crucial role in chicken follicle development, serving as a suitable molecular marker for selective breeding of egg production. Jin Heng et al. studied the development of Ningdu Yellow Hens... INHA The relationship between gene polymorphism sites and their growth and reproductive traits was further analyzed using correlation analysis, revealing... INHA Genes are closely related to the growth and development of their organisms. Currently, both domestic and international research... INHA Studies on gene polymorphism mainly focus on traits related to growth and reproduction, with few reports on its correlation with poultry meat quality traits.

[0005] The quality of poultry meat is determined by its nutritional value, sensory characteristics, and safety. The content of high-value proteins, cholesterol, vitamins, micronutrients, and unsaturated fatty acids in poultry meat determines its nutritional quality, while basic sensory characteristics include meat color, aroma, and flavor. Large-scale broiler production has been achieved; the current focus is on improving meat quality by modifying various characteristics of broilers. Appearance, texture, juiciness, water content, firmness, tenderness, aroma, and flavor are the most important and easily perceived meat characteristics, influencing consumers' initial and final judgments about meat quality before and after purchase. Quantifiable characteristics of meat, such as water retention, shear strength, drip loss, cooking loss, pH value, shelf life, collagen content, protein solubility, viscosity, and fat binding capacity, are essential for processors involved in manufacturing value-added meat products. Commonly used indicators for evaluating chicken meat quality include meat color, tenderness, water loss rate, water-holding capacity, and pH value. With the improvement of people's living standards, the requirements for chicken meat quality are also increasing, making research on the selective breeding of chicken meat quality traits an inevitable trend. However, it has not yet been seen. INHA Research reports on the role of genes in chicken meat quality traits. Summary of the Invention

[0006] The purpose of this invention is to provide INHA The application of gene molecular markers in identifying the drip loss trait of chicken muscle addresses the problems existing in the current technology. Through screening, Ningdu Yellow Rooster was identified... INHA The C+849T site on exon 2 of the gene is significantly correlated with the 48h drip loss trait of muscle in the evaluation index of chicken meat quality traits, which provides a theoretical basis for the breeding of meat quality traits and marker-assisted selection of local chicken breeds.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a property related to drip loss characteristics of chicken muscle. INHA Gene molecular markers, the INHA The nucleotide sequence of the gene molecular marker is shown in SEQ ID NO.1. INHA The 224th position of the gene molecular marker [i.e. INHA A C / T mutation exists at position 849 of the CDS sequence of the gene (GenBank accession number: NM_001031257.2). The mutation site contains CC, CT and TT genotypes.

[0008] Preferably, the drip loss characteristic of the chicken muscle is the 48-hour drip loss of the chicken muscle.

[0009] The present invention also provides the aforementioned INHA The application of gene molecular markers in identifying the drip loss trait in chicken muscle, the INHA The TT genotype at the mutation site of the gene molecular marker is the dominant genotype.

[0010] The present invention also provides the aforementioned INHA The application of gene molecular markers in chicken breeding, and the preservation of the aforementioned gene molecular markers in chicken breeding. INHA The mutation site of the gene molecular marker is the TT genotype chicken individual.

[0011] Preferably, the water loss characteristics of the chicken muscle are those of 16w Ningdu Yellow Rooster.

[0012] The present invention also provides a method for detecting drip loss characteristics of chicken muscle, comprising the following steps: Genomic DNA was extracted from the chicken to be tested; Amplification of the above using primer pairs INHA Gene molecular markers are used, followed by sequencing, and the sequencing results are analyzed. INHA The genotype of the gene molecular marker mutation site is determined, and then the muscle drip loss trait of the chicken to be tested is determined based on the genotype results.

[0013] Preferably, the nucleotide sequences of the primer pair are as shown in SEQ ID NO.2-3.

[0014] Preferably, the dominant genotype for the chicken muscle drip loss trait is TT.

[0015] Preferably, the water loss characteristics of the chicken muscle are those of 16w Ningdu Yellow Rooster.

[0016] The present invention discloses the following technical effects: This invention will take the 16-week Ningdu Yellow Rooster as the research object and analyze... INHA The correlation between exon 2 polymorphism and meat quality traits was investigated, and a significant correlation was found between the C+849T site and the meat quality traits of Ningdu Yellow Rooster. P <0.05) correlation indicates INHA Genes can be considered as candidate genes affecting the meat quality traits of Ningdu Yellow Rooster meat. Further analysis revealed that the C+849T locus was significantly correlated with 48-hour water loss in the muscle of Ningdu Yellow Rooster meat. P <0.05), and individuals with the CC genotype at this locus showed significant muscle water loss over 48 hours (followed by a dripping agent). P <0.05) was higher than that of individuals with the CT genotype, while there was no significant correlation between individuals with the TT genotype and individuals with the CC or CT genotypes. P>0.05), with the TT genotype being preferred. Therefore, this invention can provide a theoretical basis for the breeding of meat quality traits and marker-assisted selection in local chicken breeds at the molecular level. Attached Figure Description

[0017] Picture 1 The results are shown in the electrophoresis detection of the amplification products; M is the standard DNA molecule, and 1-2 are the amplification products. Picture 2 for INHA Peak diagram of polymorphic variation sites in exon 2 of a gene. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] Example 1 1. Test materials and measured properties The DNA samples used in this experiment were obtained from a natural population of 499 Ningdu Yellow Roosters preserved in a -20℃ freezer at the Jiangxi Provincial Key Laboratory for Genetic Improvement of Local Chicken Breeds. Meat quality traits of the left breast muscle of the 499 16-week-old Ningdu Yellow Roosters were measured, including pH value, meat color (L represents brightness, a represents redness, and b represents yellowness), shear force, and drip loss at 24 and 48 hours.

[0024] pH value: The portable pH meter (PHBJ-260) was calibrated using standard solutions with pH values ​​of 9.18 and 6.86. Within 45 minutes after slaughter, the probe of the pH meter was inserted into the breast muscle of each chicken, ensuring that the probe was embedded in the muscle. When the pH meter reading stabilized, the reading was recorded. This was repeated three times, and the average value was calculated. Generally, the muscle pH value of chickens with good meat quality will be between 6.0 and 6.5.

[0025] Meat color: The color of the exposed breast muscle cross-section was measured 30 minutes after slaughter using a colorimeter (CHROMA METER CR-400). Muscle brightness (L), redness (a), and yellowness (b) were measured. Each sample was measured three times, and the average value was used for subsequent analysis. Meat color is mainly determined by the state and relative content of myoglobin, oxymyoglobin, and metmyoglobin. Brightness is affected by the pH value of the muscle, the content of myoglobin in the muscle affects redness, and the metabolism of lutein affects yellowness. Measuring the meat color can accurately determine its freshness; freshly slaughtered chicken breast meat is generally bright and light red.

[0026] Shear force: Following the People's Republic of China Agricultural Industry Standard NY / T 1180-2006 "Determination of Meat Tenderness - Shear Force Measurement Method", the sample was placed on the blade groove of a digital display muscle tenderizer, with the muscle fibers perpendicular to the blade direction. The instrument was then started to cut the meat sample, and the maximum shear force (peak value) during the cutting process was measured. Each sample was measured three times, and the average value was used for subsequent analysis. The lower the shear force value, the more tender the muscle meat.

[0027] Drip loss: A rectangular muscle sample (W0) measuring 55 mm in length, 50 mm in width, and 15 mm in thickness was weighed. One end of the meat sample was then tied with a thin thread, pulling the muscle fibers downwards. The sample was sealed in an inflatable plastic bag and hung in a refrigerator at 4°C for 24 hours. After 24 hours, the meat sample (W1) was weighed, and the 24-hour drip loss was calculated as follows: W 24h (%) = (W0 - W1) / W0 100%. After storing the meat sample again in the refrigerator for 48 hours under the same conditions, weigh the meat sample again (W2) and calculate the drip loss as W. 48h (%) = (W0 - W2) / W0 100%.

[0028] 2. Test methods 2.1 Primer design and PCR amplification Download chicken from NCBI INHA The genome sequence (GenBank accession number: NM_001031257.2) was used. Upstream and downstream primers were designed using Genetool software to amplify [the genome sequence]. INHA The primer sequences for the 618 bp upstream and downstream fragments of exon 2 of the gene are: F: 5'-GCACGACACCCTGAGCCACT-3' (SEQ ID NO.2), R: 5'-GGGGTGCACGATCCAATTGTC-3' (SEQ ID NO.3). The primers were synthesized by Hunan Qingke Biotechnology Co., Ltd.

[0029] The PCR reaction system was as follows (50 μL): 2 × PCR mix 25 μL, forward and reverse primers 0.4 μL each, DNA template 1.0 μL, ddH2O 23.2 μL.

[0030] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; final extension at 72℃ for 10 min. The PCR products were analyzed by 1% agarose gel electrophoresis to determine if the fragment size met expectations. The analyzed PCR products were then sent to Hunan Qingke Biotechnology Co., Ltd. for direct sequencing using upstream primers.

[0031] 2.2 Data Statistical Analysis Statistical analysis was performed using the SAS 9.0 GLM program, and the model was constructed as follows: Y ij = μ+G i +e ij Among them, Y ij G represents the phenotypic value of the trait, μ is the population mean of the trait, and G is the population mean of the trait. i e represents the genotype effect value. ij The random residual effect was considered. Association analysis between SNP loci and meat quality traits in Ningdu Yellow Roosters was performed, referencing the paper "Regression and Principal Component Analysis of Testicular Weight and Secondary Sexual Characteristics in Ningdu Yellow Roosters at Different Ages" published by Zhou Min et al. Results are expressed as mean ± standard deviation. P <0.05 is used as the criterion for judging a significant difference. P <0.01 is used as the standard for judging that the difference is extremely significant.

[0032] Gene effect analysis methods: Additive effect (a) = (AA-BB) / 2; Dominance effect (d) = AB-(AA+BB) / 2.

[0033] 3. Results and Analysis 3.1 Amplification Results The electrophoretic detection results of the amplification products are as follows: Picture 1 As shown, after direct sequencing of the PCR product and removal of uncertain upstream and downstream sequences, a 556 bp sequence (SEQ ID NO.1) was obtained. Alignment was performed at https: / / asia.ensembl.org / Multi / Tools / Blast?db=corez, and this sequence is... INHA The sequence of exon 2 of the gene.

[0034] SEQ ID NO.1 is: AGGCAGCCGGGAGGGCTCGCCGCTCCGCCGTGCCCTGGTCGCCGGCTGCGCTCAGCCTGCTGCAGCGCCCATCGGAGGACGTGGCCGCCCACACCAACTGCCGCCGGGCCTCCCTCAACATCTCTTTCGAGGAGCTGGGCTGGGACAATTGGATCGTGCACCCCAGCAGCTTCGTTTTCCACTACTGCCACGGGAACTGTGCCGAAGGCCACGGGCTGAGCCA C CGGCTGGGGGTGCAGCTGTGCTGCGCCGCGCTGCCCGGCACCATGCGCTCCGCTGCGTGTCCGCACCACCTCTGATGGTGGCTACTCCTTCAAGTACGAGACGGTGCCCAACATCCTGGCGCAGGACTGCACCTGTGTCTAGCAGCTGGCATGGCACGGCCAGACCC GCATGGATCTCCCCGTTGCCTCTGGACTGCCCCAGTGCCAGATGATGAGCCCATCCCAGGGATGGAGGAGTCACTCACACGGGCACTGTGCAGCCCGGAGCAGGGAGGGACCCAGGTGGAAGTTTTGGTGGTGCCACCCTCCCTTTGACTGCCAGGGTTTCATG.

[0035] In the above sequence, the underlined bases are mutation sites.

[0036] 3.2 INHA Association analysis of exon 2 polymorphism in genes with meat quality traits of Ningdu yellow rooster meat Based on Ningdu Yellow Rooster INHAScreening for polymorphic sites in exon 2 of the gene revealed a C / T mutation (abbreviated as C+849T) at 849bp (see...). Picture 2 Furthermore, it showed a significant correlation (P<0.05) with the meat quality traits of Ningdu Yellow Rooster, as shown in Table 1.

[0037] Table 1 Ningdu Yellow Rooster INHA Association analysis of exon 2 polymorphism sites in genes with meat quality traits Note: In the table, L represents brightness, a represents redness, b represents yellowness, J represents shear strength, and W represents... 24h W represents the water loss over 24 hours. 48h This indicates water loss over 48 hours. This indicates that the difference is highly significant. NS indicates a significant difference, while NS indicates a non-significant difference, and so on.

[0038] 3.3 Association analysis between C+849T locus and meat quality traits Association analysis was performed between the C+849T locus and the pectoral muscle quality traits of 499 individuals in a 16-week Ningdu Yellow Rooster population. The results showed that the C+849T locus was significantly associated with 48-hour drip loss of muscle. P <0.05. Table 2 shows that the 48-hour drip loss in muscle of CC genotype chickens was significant ( P <0.05) was higher than that of individuals with the CT genotype, while there was no significant correlation between individuals with the TT genotype and individuals with the CC or CT genotypes. P >0.05). From the perspective of the mechanism by which this locus affects meat quality traits, its effect on 48-hour drip loss in the muscle of 16-week Ningdu Yellow Roosters is primarily additive. The T allele is beneficial in reducing 48-hour drip loss, with the TT genotype being the most favorable.

[0039] Table 2 Association analysis between C+849T locus and meat quality traits Note: 'a' indicates an additive effect, and 'd' indicates a dominant effect. Different capital letters in peer data indicate highly significant differences. P <0.01), different lowercase letters indicate significant differences ( P <0.05), the same letters indicate no significant difference ( P >0.05).

[0040] The above results show that INHAThe genotype at the C+849T locus affects the expression of muscle quality traits in Ningdu Yellow Roosters, especially the 48-hour drip loss of muscle. Therefore, chicken breeds with superior genotypes can be selected for breeding to provide a certain reference for the selection of meat quality traits in Ningdu Yellow Roosters, and help improve the quality of chicken meat to meet people's needs.

[0041] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker for the INHA gene associated with the drip loss trait in chicken muscle, characterized in that, The nucleotide sequence of the INHA gene molecular marker is shown in SEQ ID NO.

1. A C / T mutation exists at the 224th base of the INHA gene molecular marker, and the mutation site contains CC, CT and TT genotypes.

2. The SNP molecular marker as described in claim 1, characterized in that, The drip loss characteristics of chicken muscle are the drip loss of chicken muscle over 48 hours.

3. The application of the INHA gene molecular marker as described in claim 1 or 2 in identifying the drip loss trait in chicken muscle, characterized in that, The TT genotype at the mutation site of the INHA gene molecular marker is the dominant genotype.

4. The application of the INHA gene molecular marker as described in claim 1 or 2 in chicken breeding, characterized in that, Chicken individuals that retain the TT genotype of the INHA gene molecular marker in chicken breeding.

5. The application as described in claim 3 or 4, characterized in that, The water loss characteristics of chicken muscle dripping were those of 16w Ningdu Yellow Roosters.

6. A method for detecting drip loss characteristics of chicken muscle, characterized in that, Includes the following steps: Genomic DNA was extracted from the chicken to be tested; The INHA gene molecular marker described in claim 1 is amplified using primer pairs, followed by sequencing. The genotype of the mutation site of the INHA gene molecular marker is analyzed based on the sequencing results, and the muscle drip loss trait of the chicken to be tested is determined based on the genotype results.

7. The method as described in claim 6, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2-3.

8. The method as described in claim 6, characterized in that, The dominant genotype for the chicken muscle drip loss trait is TT.

9. The method as described in claim 6, characterized in that, The water loss characteristics of chicken muscle dripping were those of 16w Ningdu Yellow Roosters.