SSR molecular marker for identifying carex varieties and application

By using SSR molecular marker technology and specific primer pairs for PCR amplification, combined with electrophoretic separation, the problem of difficulty in distinguishing morphologically similar sedge varieties has been solved, achieving rapid, accurate, and stable identification of sedge varieties, which is applicable to the identification of closely related species and subspecies types.

CN122189235APending Publication Date: 2026-06-12BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Filing Date
2026-04-28
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately distinguish between morphologically similar sedge species, especially dwarf sedge and lanceolate sedge. Traditional morphological methods are not reliable for distinguishing them, and molecular identification methods are cumbersome or have limited resolution.

Method used

Using SSR molecular marker technology, specific primer pairs were designed to amplify the conserved flanking regions of SSRs by PCR, followed by separation by agarose gel electrophoresis. Fingerprints of sedge varieties were constructed, and identification was performed using 13 target bands and 8 primer pairs.

Benefits of technology

It enables rapid, accurate, and stable identification of sedge species. Based on DNA detection, it is unaffected by external environmental factors, and the results are stable and reliable. It has the advantages of low cost and simple operation, and is suitable for rapid identification of closely related species and subspecies types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189235A_ABST
    Figure CN122189235A_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biotechnology, and particularly relates to SSR molecular markers for identifying Carex varieties and application. The present application provides 13 SSR molecular markers for identifying Carex varieties, primer pairs for PCR amplification of the above-mentioned SSR molecular markers, and a kit and method for identifying Carex varieties. The present application provides a method for rapidly, accurately and stably identifying the SSR molecular markers of Carex varieties; in the method, the electrophoretic bands amplified by PCR are of moderate size, the molecular weight difference between the two target fragments amplified by the same primer pair is moderate, and the bands are easy to be detected and recognized by the operator; the method is based on DNA detection and is not affected by external environment, and the result is stable and reliable; the method has the advantages of accuracy, low cost, simple operation, saving of manpower and material resources, and has a very broad application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to SSR molecular markers for identifying sedge varieties and their applications. Background Technology

[0002] The genus *Carex* Linn., one of the most diverse and widely distributed genera in the Cyperaceae family, not only possesses significant ecological and forage value, but its drought tolerance, tolerance to poor soil, low maintenance, and good ornamental value also make it a highly promising native plant material for urban landscaping and ecological restoration. However, the plants in this genus have similar morphological characteristics, especially during the vegetative stage, making it difficult to reliably distinguish some species, such as *Carex brevicornu* and *Carex lanceolate*, using traditional morphological methods. This severely restricts its scientific introduction, resource evaluation, and landscaping applications.

[0003] Currently, conventional molecular identification methods often suffer from problems such as cumbersome operation, long cycle time, or limited resolution. SSR marker technology, based on microsatellite sequences widely distributed in the genome, uses specific primers to amplify conserved flanking regions of SSRs via PCR, followed by agarose gel electrophoresis separation, to clearly reveal the polymorphism in the number of core repeat units among different individuals. This technology has advantages such as codominant inheritance, high reproducibility, rich polymorphism, and relatively simple operation, making it particularly suitable for rapid identification of closely related species and subspecies types. However, in current research and practice, no method has yet been developed to identify various sedge species using SSRs. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention provides an SSR molecular marker for identifying sedge varieties and its application.

[0005] The SSR molecular markers used for identifying sedge varieties include at least one of the following 13 target bands: Target band 1, 124 bp, with its nucleotide sequence as shown in SEQ ID NO:17 of the sequence listing; Target band 2, 85 bp; Target band 3, 217 bp, with its nucleotide sequence as shown in SEQ ID NO:18 of the sequence listing; Target band 4, 80 bp; Target band 5, 200 bp; Target band 6, 133 bp, with its nucleotide sequence as shown in SEQ ID NO:19 of the sequence listing; Target band 7, 100 bp; Target band 8, 834 bp, with its nucleotide sequence as shown in SEQ ID NO:20 of the sequence listing; Target band 9, 80 bp; Target band 10, 170 bp, with its nucleotide sequence as shown in SEQ ID NO:21 of the sequence listing; Target band 11, 209 bp, with its nucleotide sequence as shown in SEQ ID NO:21 of the sequence listing. As shown in NO:22; target band 12, totaling 197 bp, has its nucleotide sequence as shown in SEQ ID NO:23 in the sequence listing; target band 13, totaling 184 bp, has its nucleotide sequence as shown in SEQ ID NO:24 in the sequence listing.

[0006] The SSR primers used for identifying sedge varieties include at least one of the following eight primer pairs: primer pair Cb2, for amplifying target band 1 and / or target band 2 as described in claim 1; primer pair Cb3, for amplifying target band 3 and / or target band 4 as described in claim 1; primer pair Cb7, for amplifying target band 5 and / or target band 6 as described in claim 1; primer pair Cb12, for amplifying target band 13 as described in claim 1; primer pair Cb16, for amplifying target band 9 and / or target band 10 as described in claim 1; primer pair Cb17, for amplifying target band 11 as described in claim 1; primer pair Cb19, for amplifying target band 7 and / or target band 8 as described in claim 1; and primer pair Cb18, for amplifying target band 12 as described in claim 1.

[0007] The kit for identifying sedge species includes at least one of the eight primer pairs.

[0008] A method for identifying sedge varieties includes: using the genomic DNA of the sample to be tested as a template, and employing the above-described SSR primers or the above-described kit.

[0009] Compared with the prior art, the present invention has the following beneficial effects:

[0010] 1. This invention provides a rapid, accurate, and stable method for identifying sedge species using SSR molecular markers. Different sedge species exhibit stable, characteristic banding patterns at multiple SSR loci, clearly distinguishing morphologically similar species, including *Carex dwarf tuft* and *Carex lanceolate*. Fingerprint mapping based on SSR data further clarifies the genetic relationships between different resources, providing a reliable basis for the rapid molecular identification of native Beijing sedges.

[0011] 2. In the identification method of the present invention, the electrophoretic bands amplified by PCR are of appropriate size, and the molecular weight difference between the two target fragments amplified by the same primer pair is moderate, making them easy for the operator to detect and identify.

[0012] 3. The identification method of the present invention is based on DNA detection, which is not affected by the external environment and will not change with changes in environmental conditions, and its results are stable and reliable.

[0013] 4. The method provided by this invention has the advantages of accuracy, low cost, simple operation, and saving manpower and material resources, and has a very broad application prospect. Attached Figure Description

[0014] Figure 1 This is a UPGMA cluster analysis diagram of the 24 sedge species in Example 1. Detailed Implementation

[0016] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0017] In a first aspect, the present invention provides SSR molecular markers for identifying sedge varieties, including at least one of the following 13 target bands.

[0018] The target band 1, totaling 124 bp, has its nucleotide sequence as shown in SEQ ID NO:17 in the sequence listing.

[0019] Target band 2, totaling 85bp.

[0020] The target band 3, totaling 217 bp, has its nucleotide sequence composition as shown in SEQ ID NO:18 in the sequence listing.

[0021] Target band 4, totaling 80 bp.

[0022] The target band is 5, which is 200bp in length.

[0023] The target band 6, totaling 133 bp, has its nucleotide sequence as shown in SEQ ID NO:19 in the sequence listing.

[0024] The target band is 7, totaling 100 bp.

[0025] The target band 8, totaling 834 bp, has its nucleotide sequence composition as shown in SEQ ID NO:20 in the sequence listing.

[0026] The target band is 9, totaling 80 bp.

[0027] The target band 10, totaling 170 bp, has its nucleotide sequence composition as shown in SEQ ID NO:21 in the sequence listing.

[0028] The target band 11, totaling 209 bp, has its nucleotide sequence composition as shown in SEQ ID NO:22 in the sequence listing.

[0029] The target band 12, totaling 197 bp, has its nucleotide sequence composition as shown in SEQ ID NO:23 in the sequence listing.

[0030] The target band 13, totaling 184 bp, has its nucleotide sequence as shown in SEQ ID NO:24 in the sequence listing.

[0031] SEQ ID NO:17:

[0032] 5'-ACAGACCACATCAGATGCCAAGTGGTACTGGTAGCTACTTGTTTTGATATATATATATTCACATATTTACTATCTATATTTACATTCATACAGATATATATAAACTACCCACCATTTTCATGGG-3'.

[0033] SEQ ID NO:18:

[0034] 5'-GCCCAACCAAAACACAAAGTGAGGTTTAAAAAAAAAAATGTATTATTTCTTGGCCTTGGAGAAGCGAAGGCACCGGTACTTCTCACCGCCAACTGTTATCTCAAGAGCACCGTCAAGATTGTCCTGATTGGATGCTGTACCCATTAGCACGCTCTTTTCTTTCTCTAGGTTTTTCTCTCCATCTTCAGCCTTGCTTCTTGCCTTGCTATTTCTGCC-3'.

[0035] SEQ ID NO:19:

[0036] 5’-TCTTCACATTTGCCTTGTCGCAGCATGGCGCTCTTCCCATGTCTCTACAGAAAGAGAGAGATTCAGAGTAGAGAGAGGGAGAGAGAGAGATGAGAAGAGGTGTGGAGAGTGTAAGTTGCAAACAAGCTGGATC-3’。

[0037] SEQ ID NO:20:

[0038] 5'--3'.

[0039] SEQ ID NO:21:

[0040] 5’-ATGGTGAGGATGCCTTTGACATGCGCAAGCAGATGAAGGGCAGGAGGATGACTCCTGCTTCCCATCACCACCACCACCACCACCATCACCATCATGGCCCTGGTGGATGCTGCGCTGCTGACCATAAGCATGCTGCTGTTGATGCCTCCGCTGCTGCTTCTGCTGTTTCA-3’。

[0041] SEQ ID NO:22:

[0042] 5’-ATGGTAGGTGGAGGCAACAGGAGAGATGACGGTCCTGTCAAGATCGTCAACTCTAATGTTTTTGCGGCGCTAGAAACCCTTAAGAAGAAGAAGAAGTCCGACAAGGAATCATCAAAAAAGGCTTCTTCTAAGCACGGTTCTAGCAAGGGAACTAGTAATACGGACCCTGAGCCTCAACCTGTCATATGGACCCAAACAACTCTCAACGC-3’。

[0043] SEQ ID NO:23:

[0044] 5’-AAAGCATGGATCAACCGAAGTTCCAACTGCATCTGTTCAATCTGCCCACGCACATCCTTCAGTTCTTGAGCTTTATTAATCAAGGTATCAGCAAGCTTGCACAACACATTGCTCACAGCTGCTGCCTCTGCCATGTATTTTCGATTGTGGGAGGGTCTATCTCTCTCTCTCTTTTTTTTTCCTCTTTTACCGGGAGG-3’。

[0045] SEQ ID NO:24:

[0046] 5’-TCCGCTCCGTTTATTGTTTCTCGTCTCCGAAAGAACACCTACACGAAGCACCACCGCTAACTAAAAACCTTACTCCGACCTAAAGAGAGAGCGAAAGAGAGAGAGAGAGGGGTAAAGAGAGAGATGTCGTACGACGATGTGGAGATAGAGGACATGGAATGGAAGGAGGAATTGAAGGCGTACA-3’。

[0047] The above-mentioned sedge varieties are selected from at least one of the following 24 species:

[0048] Foot-footed sedge, loose-spike sedge, straight-spike sedge, water-growing sedge, egg-sac sedge, pointed-tip sedge, egg-spike sedge, heteroscuta sedge, Central Asian sedge, North China sedge, white-glove sedge, Ussuri sedge, flat-stemmed sedge, hemp-root sedge, stream sedge, green sedge, low-tufted sedge, heteroscuta sedge, small-grained sedge, broad-leaved sedge, early spring sedge, duck-green sedge, Japanese sedge, lanceolate-leaved sedge.

[0049] Among them, the aforementioned green sedge, dwarf sedge, and lanceolate sedge are preserved in the National Ornamental Grass Germplasm Resource Center, with accession numbers BJCY-Cb-0002, BJCY-Cb-0003, and BJCY-Cb-0006, respectively; other sedge varieties are preserved in the Institute of Grassland and Flower Research, Beijing Academy of Agricultural and Forestry Sciences. Anyone may freely contact the inventor to obtain the above-mentioned sedge varieties for the purpose of this invention. The contact address is: No. 9, Shuguang Garden Middle Road, Haidian District, Beijing, Postcode: 100097, Contact person: Ms. Yue, Tel: 010-81127878.

[0050] Secondly, the present invention provides SSR primers for identifying sedge varieties, comprising at least one of the following eight primer pairs:

[0051] Primer pair Cb2 is used to amplify target band 1 and / or target band 2:

[0052] Forward primer (SEQ ID NO:1): 5'-CCCATGAAAATGGTGGGTAG-3';

[0053] Reverse primer (SEQ ID NO:2): 5'-ACAGACCACATCAGATGCCA-3'.

[0054] Primer pair Cb3 is used to amplify target band 3 and / or target band 4:

[0055] Forward primer (SEQ ID NO:3): 5'- GGCAGAAATAGCAAGGCAAG-3';

[0056] Reverse primer (SEQ ID NO:4): 5'- GCCCAACCAAAACACAAAGT-3'.

[0057] Primer pair Cb7 is used to amplify target band 5 and / or target band 6:

[0058] Forward primer (SEQ ID NO:5): 5'- GATCCAGCTTGTTTGCAACTT -3';

[0059] Reverse primer (SEQ ID NO:6): 5'-TCTTCACATTTGCCTTGTCG-3'.

[0060] Primer pair Cb12 is used to amplify the target band 13:

[0061] Forward primer (SEQ ID NO:7): 5'-TCCGCTCCGTTTATTGTTTC -3';

[0062] Reverse primer (SEQ ID NO:8): 5'-TGTACGCCTTCAATTCCTCC-3'.

[0063] Primer pair Cb16 is used to amplify target band 9 and / or target band 10:

[0064] Forward primer (SEQ ID NO:9): 5'-ATGGTGAGGATGCCTTTGAC-3';

[0065] Reverse primer (SEQ ID NO:10): 5'-TGAAACAGCAGAAGCAGCAG-3'.

[0066] Primer pair Cb17, used to amplify the target band 11:

[0067] Forward primer (SEQ ID NO:11): 5'-ATGGTAGGTGGAGGCAACAG-3';

[0068] Reverse primer (SEQ ID NO:12): 5'- GCGTTGAGAGTTGTTTGGGT-3'.

[0069] Primer pair Cb19 is used to amplify target band 7 and / or target band 8:

[0070] Forward primer (SEQ ID NO:13): 5'-TGGTAGCATGGATTATGGCA-3';

[0071] Reverse primer (SEQ ID NO:14): 5'- CAGCAACAAGCTCACTGCAT-3'.

[0072] Primer pair Cb18, used to amplify the target band 12:

[0073] Forward primer (SEQ ID NO:15): 5'-CCTCCCGGTAAAAGAGGAAA-3';

[0074] Reverse primer (SEQ ID NO:16): 5'-AAAGCATGGATCAACCGAAG-3'.

[0075] Thirdly, the present invention provides a kit for identifying sedge varieties, the kit comprising at least one of the eight primer pairs described in the second aspect of the present invention.

[0076] Preferably, the kit further includes at least one of the following: PCR amplification buffer, dNTPs, Taq enzyme, and DNA chromogenic dye.

[0077] Fourthly, the present invention provides a method for identifying sedge varieties, the method comprising using genomic DNA of the sample to be tested as a template and performing PCR amplification using the SSR primer set provided in the second aspect of the present invention or the kit provided in the third aspect of the present invention.

[0078] In a preferred embodiment, the method includes the following steps:

[0079] Steps for extracting genomic DNA:

[0080] Leaf samples of the test specimens are preferred as experimental materials, and genomic DNA is preferably extracted using the SDS method.

[0081] PCR amplification steps:

[0082] Using the genomic DNA of the sample to be tested as a template, PCR amplification reaction is performed using at least one of the primer pairs described in the second aspect of the present invention, or the kit described in the third aspect of the present invention, to obtain PCR amplification products.

[0083] The following PCR amplification reaction system (10 μL system) is preferred:

[0084] 2 μL DNA template (50 ng / μL), 5 μL 2×Taq PCR Master Mix, 0.2 μmol / L each of forward and reverse primers, and bring the total volume to 10 μL with ddH2O.

[0085] The following PCR amplification reaction procedure is preferred:

[0086] Pre-denaturation at 94℃ for 3 min; followed by 34 cycles: denaturation at 94℃ for 30 s, annealing at 52~58℃ (adjusted according to the optimal annealing temperature of each SSR primer, preferably 55℃) for 30 s, extension at 72℃ for 1 min; final extension at 72℃ for 10 min; stored at 4℃.

[0087] Detection and judgment steps:

[0088] The PCR amplification products of each sample are detected to determine the type of sample.

[0089] The above detection preferably uses electrophoresis to detect PCR amplification products; the electrophoresis can be agarose gel electrophoresis or polyacrylamide gel electrophoresis. Alternatively, the detection can be performed by sequencing the PCR amplification products.

[0090] The conditions for determining the variety of the sample to be tested are as shown in Table 1:

[0091] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) but yields target band 4 (80bp); PCR amplification of primer pair Cb7 does not yield target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and target band 8 (834bp); PCR amplification of primer pair Cb16 does not yield target band 9 (80bp) but yields target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 does not yield target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp), then the sample to be tested is *Carex acetosa*.

[0092] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) but target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) but target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex spicatum*.

[0093] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and does not yield target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and does not yield target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) but does not yield target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but does yield band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex spicata*.

[0094] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 does not yield target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and does not yield target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and does not yield target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 does not yield target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp), then the sample to be tested is *Carex layuensis*.

[0095] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) but no target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) but no target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) but no target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp), then the sample to be tested is *Carex oocystis*.

[0096] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and no target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields no target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields no target band 12 (197bp); and PCR amplification of primer pair Cb12 yields no target band 13 (184bp), then the sample to be tested is *Carex chinensis*.

[0097] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 does not yield target band 12 (197bp); PCR amplification of primer pair Cb12 does not yield target band 13 (184bp); then the sample to be tested is *Carex ovalis*.

[0098] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) but yields target band 4 (80bp); PCR amplification of primer pair Cb7 does not yield target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 does not yield target band 7 (100bp) and target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) but does not yield target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex heterothorax*.

[0099] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) but yields target band 4 (80bp); PCR amplification of primer pair Cb7 does not yield target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) but does not yield target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 does not yield target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp), then the sample to be tested is *Carex chinensis*.

[0100] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and no target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and no target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and no target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp); then the sample to be tested is *Carex chinensis*.

[0101] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and no target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and no target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); PCR amplification of primer pair Cb12 does not yield target band 13 (184bp); then the sample to be tested is *Carex glabra*.

[0102] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields no target band 12 (197bp); PCR amplification of primer pair Cb12 yields no target band 13 (184bp); then the sample to be tested is *Carex ursuri*.

[0103] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and does not yield target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and does not yield target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp), then the sample to be tested is *Carex styrax*.

[0104] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) but target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) but target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) but target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp), then the sample to be tested is *Carex styrax*.

[0105] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) but target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) but target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp), then the sample to be tested is *Carex spp.*

[0106] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and no target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and no target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and no target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp); then the sample to be tested is *Moss purpurea*.

[0107] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 yields target band 3 (217bp) but target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) but target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) but target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex brevicornu*.

[0108] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 does not yield target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but does not yield target band 8 (834bp); PCR amplification of primer pair Cb16 does not yield target band 9 (80bp) but yields target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex heterospora*.

[0109] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 did not yield target band 1 (124bp) and target band 2 (85bp); PCR amplification of primer pair Cb3 did not yield target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yielded target band 5 (200bp) but did not yield target band 6 (133bp); PCR amplification of primer pair Cb19 yielded target band 7 (100bp) but did not yield target band 8 (834bp); PCR amplification of primer pair Cb16 yielded target band 9 (80bp) but did not yield target band 10 (170bp); PCR amplification of primer pair Cb17 yielded target band 11 (209bp); PCR amplification of primer pair Cb18 did not yield target band 12 (197bp); and PCR amplification of primer pair Cb12 yielded target band 13 (184bp); then the sample to be tested is *Carex spp.*

[0110] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and does not yield target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and does not yield target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and does not yield target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and does not yield target band 10 (170bp); PCR amplification of primer pair Cb17 does not yield target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 does not yield target band 13 (184bp), then the sample to be tested is *Carex latifolia*.

[0111] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and no target band 2 (85bp); PCR amplification of primer pair Cb3 yields no target band 3 (217bp) and no target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and no target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and no target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp), then the sample to be tested is *Carex chinensis*.

[0112] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) but no target band 2 (85bp); PCR amplification of primer pair Cb3 yields no target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields no target band 5 (200bp) and target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) and target band 10 (170bp); PCR amplification of primer pair Cb17 yields no target band 11 (209bp); PCR amplification of primer pair Cb18 yields no target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp), then the sample to be tested is *Carex oleracea*.

[0113] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) but no target band 2 (85bp); PCR amplification of primer pair Cb3 yields no target band 3 (217bp) and no target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) but no target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) but no target band 8 (834bp); PCR amplification of primer pair Cb16 yields target band 9 (80bp) but no target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex japonicus*.

[0114] If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 (124bp) and does not yield target band 2 (85bp); PCR amplification of primer pair Cb3 does not yield target band 3 (217bp) and target band 4 (80bp); PCR amplification of primer pair Cb7 yields target band 5 (200bp) and does not yield target band 6 (133bp); PCR amplification of primer pair Cb19 yields target band 7 (100bp) and does not yield target band 8 (834bp); PCR amplification of primer pair Cb16 does not yield target band 9 (80bp) but yields target band 10 (170bp); PCR amplification of primer pair Cb17 yields target band 11 (209bp); PCR amplification of primer pair Cb18 yields target band 12 (197bp); and PCR amplification of primer pair Cb12 yields target band 13 (184bp); then the sample to be tested is *Carex lanceolata*.

[0115] Table 1: Summary of PCR amplification results of 13 target bands from 24 species of sedges (0 represents no target band amplified, 1 represents target band amplified).

[0116]

[0117] In a fifth aspect, the present invention provides the application of the SSR primer set described in the second aspect, and / or the SSR kit described in the third aspect, and / or the method described in the third aspect, in the identification of sedge varieties.

[0118] Unless otherwise specified, all reagents and materials used in the following examples are products that can be obtained from commercial channels; unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.

[0119] Example 1

[0120] This embodiment describes a method for obtaining SSR primer sets for identifying sedge varieties.

[0121] 1. Materials and Methods

[0122] 1.1 Plant materials

[0123] The 24 native Beijing sedge materials used by the inventors were collected according to the catalogue system of the Flora of China, covering several morphologically closely related species, including Carex humilis and Carex lanceolata. All materials were planted in the germplasm resource nursery of the Beijing Academy of Agricultural and Forestry Sciences. Healthy young leaves were collected during the vigorous growth period, flash-frozen in liquid nitrogen, and then stored in an ultra-low temperature freezer at -80℃ for genomic DNA extraction.

[0124] Table 2: 24 native sedges from Beijing

[0125]

[0126] 1.2 Rapid extraction of genomic DNA

[0127] A rapid DNA extraction method was used to extract genomic DNA from 24 sedge species, which was completed in less than 30 minutes. The steps are as follows: (1) Cut the leaves into 2mL centrifuge tubes, add magnetic beads, and freeze quickly with liquid nitrogen (this step can be omitted if the leaves are tender and easy to extract); (2) Sample with a sampler at 65Hz for 120s, or grind, and then add 200 μL of DNA extraction buffer (the following formula is used for 500mL): 200mM Tris 12.114g, 250mM NaCl 7.31g, 25mM EDTA-2Na 4.653g, 0.5% SDS 2.5g; (3) Incubate in an oven or water bath at 65℃ for 5-10min; (4) Pour out the small steel beads and centrifuge at 12000rpm for 10min, and take 180 μL of the supernatant; (5) Precipitate the DNA, add an equal volume of isopropanol, gently invert and mix, and freeze at -20℃ for 10-15 minutes to accelerate precipitation; (6) Wash the precipitate with 5000L of 70% ethanol, and incubate at 4℃ at 12000rpm. Centrifuge for 2 min, discard the supernatant, blow dry the precipitate in a clean bench, add 30 uL ddH2O to dissolve the DNA, and obtain the genomic DNA of the above 24 sedge varieties.

[0128] 1.3 SSR Marker Analysis

[0129] 1.3.1 SSR Primer Screening

[0130] To establish an SSR marker system suitable for rapid identification of native sedges in Beijing, eight morphologically distinct sedge materials were first selected as initial screening samples. After PCR amplification, the samples were detected by 8% non-denaturing polyacrylamide gel electrophoresis. Based on band clarity, polymorphism information content, and repeatability, eight pairs of SSR core primers with high polymorphism and good stability were finally selected for genotyping analysis of all 24 materials.

[0131] Table 3: Primer Information

[0132]

[0133] In practice, the primer annealing temperature is generally the average of the F and R primer annealing temperatures minus 2°C, ensuring band amplification while minimizing primer dimers. In this example, considering both the initial and final primer annealing temperatures and amplification efficiency, a uniform annealing temperature of 55°C is used for PCR amplification.

[0134] 1.3.2 PCR amplification

[0135] The PCR reaction volume is 10 μL:

[0136] The sample contains 2 μL DNA template (50 ng / μL), 5 μL 2×Taq PCR Master Mix, 0.2 μmol / L forward and reverse primers, and ddH2O to bring the total volume to 10 μL.

[0137] The reaction procedure was as follows: pre-denaturation at 94℃ for 3 min; followed by 34 cycles: denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min; and final extension at 72℃ for 10 min, followed by storage at 4℃.

[0138] 1.3.3 Electrophoresis detection and data analysis

[0139] PCR products were separated by electrophoresis using a 1% agarose gel. After electrophoresis, the allele size (bp) of each locus in each sample was recorded. A 0 / 1 matrix was constructed using the digitized band data, where 0 represents no amplification of the target band and 1 represents amplification of the target band, for subsequent genetic analysis.

[0140] 2. Results and Analysis

[0141] 2.1 Polymorphism Analysis

[0142] SSR amplification was performed on 24 sedge materials. Eight primer pairs were selected, resulting in 13 polymorphic bands, with an average of 1.625 bands amplified per SSR marker. The average number of alleles (Na) was 2.00, the average effective number of alleles (Ne) was 1.640, the average gene diversity (H) was 0.377, the average Shannon information index (I) was 0.560, and the average polymorphism information content (PIC) was 0.315.

[0143] Table 4: Summary of genetic diversity of 24 sedge materials

[0144]

[0145] 2.2 Cluster Analysis

[0146] UPGMA cluster analysis was performed on the 24 materials based on genetic distance. Figure 1 The phylogenetic relationships of all materials were obtained by combining the clustering results. Based on the clustering results, the 24 sedge resources could be divided into 7 groups at the genetic similarity position of 0.66. Group I contained one material, *Carex japonica*, accounting for 4.17% of the 24 sedge resources. Group II contained three materials: *Carex microphylla*, *Carex earlyifolia*, and *Carex lanceolate*, accounting for 12.50% of the 24 sedge resources. Group III contained one material, *Carex heterospora*, accounting for 4.17% of the 24 sedge resources. Group IV contained two materials: *Carex straightifolia* and *Carex valeriana*, accounting for 8.33% of the 24 sedge resources. Group V contained one material, *Carex heterospora*, accounting for 4.17% of the 24 sedge resources. Group VI contains 11 materials: *Carex sparseis*, *Carex ovoidis*, *Carex chinensis*, *Carex spp.*, *Carex spp.*, *Carex ulmoides*, *Carex spp.*, *Carex spp.*, *Carex spp.*, *Carex spp.*, and *Carex spp.*, accounting for 45.83% of the 24 sedge resources. *Carex chinensis* and *Carex spp.* are most closely related. Group VII contains 5 materials: *Carex pedunculata*, *Carex laoyuensis*, *Carex ovoidis*, *Carex spicata*, and *Carex chinensis*, accounting for 20.83% of the 24 sedge resources.

[0147] 2.3 Fingerprint pattern

[0148] Electrophoretic patterns showed that different sedge species exhibited stable characteristic banding patterns at multiple SSR loci (Table 5), which clearly distinguished morphologically similar species, including dwarf sedge and lanceolate sedge.

[0149] Table 5: Primer polymorphism band size

[0150]

[0151] Following this sequence, fingerprint data was constructed based on SSR molecular markers (as shown in Table 6), further clarifying the genetic relationships between various resources and providing a reliable basis for the rapid molecular identification of native Beijing sedges.

[0152] Table 6: Fingerprint data of 24 sedge species

[0153]

[0154] By comparing the fingerprint data (0 / 1 strings, where 0 represents no amplification of the target band and 1 represents amplification of the target band) of the above 24 resources, the following identification conclusions can be drawn:

[0155] (1) Most varieties can be distinguished by the above 8 primer pairs. Using the combination of these 8 primer pairs (Cb2+Cb3+Cb7+Cb19+Cb16+Cb17+Cb18+Cb12), a specific fingerprint pattern can be constructed.

[0156] (2) Different primer pairs play a decisive role in identifying specific similar varieties, and none of them can be omitted.

[0157] (3) Primer pair Cb2 can be used to identify 19 small grain sedge (00...), which is the only variety that did not amplify the target band 1 at this site. With primer Cb2 alone, small grain sedge can be distinguished from the other 23 varieties.

[0158] Primer pair Cb16 was used to distinguish between *Carex 1* and *Carex 9*. These two varieties had identical data in the first eight positions, and were only distinguished by the PCR amplification results using primer pair Cb16.

[0159] Primer pair Cb17 was used to distinguish between 20 broadleaf sedge (...010) and 21 early spring sedge (...111); the data for the first 10 of these two varieties were completely identical, and they could only be distinguished by the PCR amplification results of the last primer pair Cb17, primer pair Cb18, and primer pair Cb12.

[0160] Example 2

[0161] This embodiment describes a method for using the SSR primer set of Example 1 to detect which of the above 24 varieties an unknown sedge species belongs to.

[0162] The sample to be tested in this embodiment is a certain type of sedge in its nutrient stage, collected from the suburbs of Beijing.

[0163] The detection method in this embodiment includes:

[0164] S1. Rapid extraction of genomic DNA from the sample to be tested:

[0165] (1) Cut the leaf of the sample to be tested into a 2mL centrifuge tube, add small steel balls, and freeze quickly with liquid nitrogen to obtain the quick-frozen leaf.

[0166] (2) After grinding the quick-frozen leaf, add 200 μL of DNA extraction solution to obtain a preliminary extract.

[0167] The 500 mL of the above DNA extraction solution contained: 200 mM Tris 12.114 g, 250 mM NaCl 7.31 g, 25 mM EDTA-2Na 4.653 g, and 0.5% SDS 2.5 g.

[0168] (3) The above preliminary extract was incubated in a water bath at 65°C for 5-10 min to obtain the water bath product.

[0169] (4) Centrifuge the product from the water bath at 12,000 rpm for 10 min and collect about 180 μL of the supernatant.

[0170] (5) Add an equal volume of isopropanol to the supernatant above, gently invert and mix; then freeze at -20℃ for 10~15 minutes to accelerate precipitation and obtain the precipitated crude extract;

[0171] (6) Add 500 μL of 70% ethanol solution to the crude extract and wash. Then centrifuge at 12,000 rpm for 2 min at 4 °C. Discard the supernatant and keep the precipitate.

[0172] The precipitate was dried in a clean bench, and then 30 μL of ddH2O was added to dissolve the precipitate to obtain the genomic DNA of the sample to be tested.

[0173] S2, PCR amplification reaction:

[0174] The genomic DNA of the test samples was amplified by PCR using the eight pairs of SSR primers in Table 3 of Example 1 to obtain PCR products.

[0175] The PCR reaction volume is 10 μL:

[0176] 2 μL DNA template (50 ng / μL), 5 μL 2×Taq PCR Master Mix, 0.2 μmol / L each of forward and reverse primers, and bring the total volume to 10 μL with ddH2O.

[0177] The reaction procedure was as follows: pre-denaturation at 94℃ for 3 min; followed by 34 cycles: denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min; and final extension at 72℃ for 10 min, followed by storage at 4℃.

[0178] S3. Electrophoretic detection and data analysis:

[0179] PCR products were separated by electrophoresis using a 1% agarose gel. After electrophoresis, the target bands obtained by 8 pairs of SSR primers were recorded.

[0180] The PCR products of the above-mentioned test samples include:

[0181] Primer pair Cb2 yielded target band 1 (120bp) and did not yield target band 2 (85bp); primer pair Cb3 did not yield target band 3 (210bp) and target band 4 (80bp); primer pair Cb7 yielded target band 5 (200bp) and did not yield target band 6 (133bp); primer pair Cb19 yielded target band 7 (100bp) and did not yield target band 8 (834bp); primer pair Cb16 did not yield target band 9 (80bp) but yielded target band 10 (170bp); primer pair Cb17 yielded target band 11 (209bp); primer pair Cb18 yielded target band 12 (197bp); and primer pair Cb12 yielded target band 13 (180bp).

[0182] Based on the above results, it can be determined that the sample to be tested is *Carex lanceolate*, and its fingerprint data is 1000101001111.

[0183] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. SSR molecular markers for identifying sedge varieties, comprising at least one of the following 13 target bands: The target band 1, which is 124 bp in length, has its nucleotide sequence as shown in SEQ ID NO:17 in the sequence listing. Target band 2, 85bp in total; The target band 3, which is 217 bp in length, has its nucleotide sequence as shown in SEQ ID NO:18 in the sequence listing. Target band 4, 80bp in total; Target band 5, 200bp in total; The target band 6, which is 133 bp in length, has its nucleotide sequence as shown in SEQ ID NO:19 in the sequence listing. Target band 7, 100bp in total; The target band 8, which is 834 bp in length, has its nucleotide sequence as shown in SEQ ID NO:20 in the sequence listing. Target band 9, totaling 80 bp; The target band 10, with a total length of 170 bp, has its nucleotide sequence as shown in SEQ ID NO:21 in the sequence listing. The target band 11, totaling 209 bp, has its nucleotide sequence as shown in SEQ ID NO:22 in the sequence listing; The target band 12, totaling 197 bp, has its nucleotide sequence as shown in SEQ ID NO:23 in the sequence listing; The target band 13, totaling 184 bp, has its nucleotide sequence as shown in SEQ ID NO:24 in the sequence listing.

2. The SSR molecular marker for identifying sedge varieties according to claim 1, characterized in that: The sedge variety is selected from at least one of the following 24 varieties: Foot-footed sedge, loose-spike sedge, straight-spike sedge, water-growing sedge, egg-sac sedge, pointed-tip sedge, egg-spike sedge, heteroscuta sedge, Central Asian sedge, North China sedge, white-glove sedge, Ussuri sedge, flat-stemmed sedge, hemp-root sedge, stream sedge, green sedge, low-tufted sedge, heteroscuta sedge, small-grained sedge, broad-leaved sedge, early spring sedge, duck-green sedge, Japanese sedge, lanceolate-leaved sedge.

3. SSR primers for identifying sedge varieties, including at least one of the following eight primer pairs: Primer pair Cb2 is used to amplify target band 1 and / or target band 2 as described in claim 1; Primer pair Cb3 is used to amplify target band 3 and / or target band 4 as described in claim 1; Primer pair Cb7 is used to amplify target band 5 and / or target band 6 as described in claim 1; Primer pair Cb12 is used to amplify the target band 13 as described in claim 1; Primer pair Cb16 is used to amplify target band 9 and / or target band 10 as described in claim 1; Primer pair Cb17 is used to amplify the target band 11 as described in claim 1; Primer pair Cb19 is used to amplify target band 7 and / or target band 8 as described in claim 1; Primer pair Cb18 is used to amplify the target band 12 as described in claim 1.

4. The SSR primers for identifying sedge varieties according to claim 3, characterized in that: The primer pair Cb2 includes: Forward primer: 5'-CCCATGAAAATGGTGGGTAG-3'; Reverse primer: 5'-ACAGACCACATCAGATGCCA-3'; The primer pair Cb3 includes: Forward primer: 5'- GGCAGAAATAGCAAGGCAAG -3'; Reverse primer: 5'- GCCCAACCAAAACACAAAGT-3'; The primer pair Cb7 includes: Forward primer: 5'- GATCCAGCTTGTTTGCAACTT -3'; Reverse primer: 5'-TCTTCACATTTGCCTTGTCG-3'; The primer pair Cb12 includes: Forward primer: 5'-TCCGCTCCGTTTATTGTTTC -3'; Reverse primer: 5'-TGTACGCCTTCAATTCCTCC-3'; The primer pair Cb16 includes: Forward primer: 5'-ATGGTGAGGATGCCTTTGAC-3'; Reverse primer: 5'-TGAAACAGCAGAAGCAGCAG-3'; The primer pair Cb17 includes: Forward primer: 5'-ATGGTAGGTGGAGGCAACAG-3'; Reverse primer: 5'- GCGTTGAGAGTTGTTTGGGT-3'; The primer pair Cb19 includes: Forward primer: 5'-TGGTAGCATGGATTATGGCA-3'; Reverse primer: 5'- CAGCAACAAGCTCACTGCAT -3'; The primer pair Cb18 includes: Forward primer: 5'-CCTCCCGGTAAAAGAGGAAA-3'; Reverse primer: 5'-AAAGCATGGATCAACCGAAG-3'.

5. A kit for identifying sedge species, including: At least one of the eight primer pairs described in claim 3 or 4.

6. The kit for identifying sedge species according to claim 5, characterized in that: The kit also includes at least one of the following: PCR amplification buffer, dNTPs, Taq enzyme, and DNA chromogenic dye.

7. A method for identifying sedge varieties, characterized in that: The method includes: using the genomic DNA of the sample to be tested as a template, and employing the SSR primers as described in claim 3 or 4, or the kit as described in claim 5 or 6.

8. The method for identifying sedge varieties according to claim 7, characterized in that: The method includes the following steps: Steps for extracting genomic DNA: Extract genomic DNA from the sample to be tested; PCR amplification steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification reaction is performed using at least one pair of the SSR primer pairs described in claim 3 or 4, or the kit described in claim 5 or 6, to obtain PCR amplification products; Detection and judgment steps: The PCR amplification products are detected to determine the type of the sample to be tested.

9. The method for identifying sedge varieties according to claim 8, characterized in that: The PCR amplification step includes the following procedures: Pre-denaturation at 94℃ for 3 min; followed by 34 cycles: denaturation at 94℃ for 30 s, annealing at 52~58℃ for 30 s, extension at 72℃ for 1 min; final extension at 72℃ for 10 min; stored at 4℃.

10. The method for identifying sedge varieties according to claim 8 or 9, characterized in that: If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primers yields target band 1 and target band 2; PCR amplification of Cb3 with primers does not yield target band 3 but yields target band 4; PCR amplification of Cb7 with primers does not yield target bands 5 and 6; PCR amplification of Cb19 with primers yields target bands 7 and 8; PCR amplification of Cb16 with primers does not yield target band 9 but yields target band 10; PCR amplification of Cb17 with primers does not yield target band 11; PCR amplification of Cb18 with primers does not yield target band 12; and PCR amplification of Cb12 with primers does not yield target band 13, then the sample to be tested is *Carex chinensis*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair does not yield target band 3 but yields target band 4; PCR amplification of Cb7 with primer pair yields target band 5 but does not yield target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but does not yield band 8; PCR amplification of Cb16 with primer pair yields target band 9 and target band 10; PCR amplification of Cb17 with primer pair does not yield target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields target band 13; then the sample to be tested is *Carex spicatum*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields target band 3 but not target band 4; PCR amplification of primer pair Cb7 yields target band 5 but not target band 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target bands 9 and 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Carex spicata*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair yields target band 3 and target band 4; PCR amplification of Cb7 with primer pair does not yield target band 5 and target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but does not yield target band 8; PCR amplification of Cb16 with primer pair yields target band 9 but does not yield target band 10; PCR amplification of Cb17 with primer pair does not yield target band 11; PCR amplification of Cb18 with primer pair does not yield target band 12; and PCR amplification of Cb12 with primer pair does not yield target band 13, then the sample to be tested is *Carex latifolia*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields target band 4 but not target band 3; PCR amplification of primer pair Cb7 yields target bands 5 and 6 but not target bands 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target band 9 but not target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Carex oocystis*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields target bands 3 and 4; PCR amplification of primer pair Cb7 yields target bands 5 and 6 but not target bands 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target bands 9 and 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12 but not target band 13; then the sample to be tested is *Carex chinensis*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 and target band 2; PCR amplification of primer pair Cb3 yields target band 3 and target band 4; PCR amplification of primer pair Cb7 yields target band 5 and target band 6; PCR amplification of primer pair Cb19 yields target band 7 but does not yield target band 8; PCR amplification of primer pair Cb16 yields target band 9 and target band 10; PCR amplification of primer pair Cb17 does not yield target band 11; PCR amplification of primer pair Cb18 does not yield target band 12; and PCR amplification of primer pair Cb12 does not yield target band 13, then the sample to be tested is *Carex ovoides*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair does not yield target band 3 but yields target band 4; PCR amplification of Cb7 with primer pair does not yield target band 5 and target band 6; PCR amplification of Cb19 with primer pair does not yield target band 7 and target band 8; PCR amplification of Cb16 with primer pair yields target band 9 but does not yield target band 10; PCR amplification of Cb17 with primer pair does not yield target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields target band 13; then the sample to be tested is *Carex heterothalamus*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair does not yield target band 3 but yields target band 4; PCR amplification of Cb7 with primer pair does not yield target bands 5 and 6; PCR amplification of Cb19 with primer pair yields target bands 7 and 8; PCR amplification of Cb16 with primer pair yields target band 9 but does not yield target band 10; PCR amplification of Cb17 with primer pair does not yield target band 11; PCR amplification of Cb18 with primer pair does not yield target band 12; and PCR amplification of Cb12 with primer pair does not yield target band 13, then the sample to be tested is *Carex chinensis*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields target bands 3 and 4; PCR amplification of primer pair Cb7 yields target band 5 but not target band 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target band 9 but not target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 does not yield target band 13; then the sample to be tested is *Carex chinensis*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair yields target band 3 and target band 4; PCR amplification of Cb7 with primer pair yields target band 5 but no target band 6; PCR amplification of Cb19 with primer pair yields target band 7 and target band 8; PCR amplification of Cb16 with primer pair yields target band 9 but no target band 10; PCR amplification of Cb17 with primer pair yields no target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields no target band 13, then the sample to be tested is *Carex glabra*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair yields target band 3 and target band 4; PCR amplification of Cb7 with primer pair yields target band 5 and target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but no target band 8; PCR amplification of Cb16 with primer pair yields target band 9 and target band 10; PCR amplification of Cb17 with primer pair yields target band 11; PCR amplification of Cb18 with primer pair yields no target band 12; and PCR amplification of Cb12 with primer pair yields no target band 13, then the sample to be tested is *Carex ursuri*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair does not yield target band 3 and target band 4; PCR amplification of Cb7 with primer pair yields target band 5 but does not yield target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but does not yield target band 8; PCR amplification of Cb16 with primer pair yields target band 9 and target band 10; PCR amplification of Cb17 with primer pair does not yield target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair does not yield target band 13; then the sample to be tested is *Carex styrax*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair yields target band 4 but not target band 3; PCR amplification of Cb7 with primer pair yields target band 5 but not target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but not target band 8; PCR amplification of Cb16 with primer pair yields target band 9 but not target band 10; PCR amplification of Cb17 with primer pair yields target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields target band 13; then the sample to be tested is *Carex styrax*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair does not yield target band 3 but yields target band 4; PCR amplification of Cb7 with primer pair yields target band 5 but does not yield target band 6; PCR amplification of Cb19 with primer pair yields target band 7 and target band 8; PCR amplification of Cb16 with primer pair yields target band 9 and target band 10; PCR amplification of Cb17 with primer pair yields target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields target band 13; then the sample to be tested is *Carex sphaerocephala*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields target bands 3 and 4; PCR amplification of primer pair Cb7 yields target band 5 but not target band 6; PCR amplification of primer pair Cb19 yields target bands 7 and 8; PCR amplification of primer pair Cb16 yields target band 9 but not target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 does not yield target band 13; then the sample to be tested is *Moss purpurea*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair yields target band 4 but not target band 3; PCR amplification of Cb7 with primer pair yields target band 5 but not target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but not target band 8; PCR amplification of Cb16 with primer pair yields target band 9 but not target band 10; PCR amplification of Cb17 with primer pair yields target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields target band 13, then the sample to be tested is *Carex brevicornu*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of Cb2 with primer pair yields target band 1 and target band 2; PCR amplification of Cb3 with primer pair does not yield target band 3 and target band 4; PCR amplification of Cb7 with primer pair does not yield target band 5 and target band 6; PCR amplification of Cb19 with primer pair yields target band 7 but does not yield target band 8; PCR amplification of Cb16 with primer pair does not yield target band 9 but yields target band 10; PCR amplification of Cb17 with primer pair does not yield target band 11; PCR amplification of Cb18 with primer pair yields target band 12; and PCR amplification of Cb12 with primer pair yields target band 13; then the sample to be tested is *Carex heterospora*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 fails to yield target band 1 and target band 2; PCR amplification of primer pair Cb3 fails to yield target band 3 and target band 4; PCR amplification of primer pair Cb7 yields target band 5 but fails to yield target band 6; PCR amplification of primer pair Cb19 yields target band 7 but fails to yield target band 8; PCR amplification of primer pair Cb16 yields target band 9 but fails to yield target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 fails to yield target band 12; and PCR amplification of primer pair Cb12 yields target band 13; then the sample to be tested is *Carex spp.* If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields neither target band 3 nor target band 4; PCR amplification of primer pair Cb7 yields target band 5 but not target band 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target band 9 but not target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Carex latifolia*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields neither target band 3 nor target band 4; PCR amplification of primer pair Cb7 yields target band 5 but not target band 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target band 9 but not target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Carex chinensis*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but does not yield target band 2; PCR amplification of primer pair Cb3 does not yield target bands 3 and 4; PCR amplification of primer pair Cb7 does not yield target bands 5 and 6; PCR amplification of primer pair Cb19 yields target band 7 but does not yield target band 8; PCR amplification of primer pair Cb16 yields target bands 9 and 10; PCR amplification of primer pair Cb17 does not yield target band 11; PCR amplification of primer pair Cb18 does not yield target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Carex oleracea*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but does not yield target band 2; PCR amplification of primer pair Cb3 does not yield target bands 3 and 4; PCR amplification of primer pair Cb7 yields target band 5 but does not yield target band 6; PCR amplification of primer pair Cb19 does not yield target band 7 but yields target band 8; PCR amplification of primer pair Cb16 does not yield target band 9 but yields target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 does not yield target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Sedge japonica*. If the electrophoresis results simultaneously meet the following criteria: PCR amplification of primer pair Cb2 yields target band 1 but not target band 2; PCR amplification of primer pair Cb3 yields neither target band 3 nor target band 4; PCR amplification of primer pair Cb7 yields target band 5 but not target band 6; PCR amplification of primer pair Cb19 yields target band 7 but not target band 8; PCR amplification of primer pair Cb16 yields target band 9 but not target band 10; PCR amplification of primer pair Cb17 yields target band 11; PCR amplification of primer pair Cb18 yields target band 12; and PCR amplification of primer pair Cb12 yields target band 13, then the sample to be tested is *Carex lanceolata*.