Algae in which a lipase gene and a diacylglycerol acyltransferase gene are modified, and method for producing triglyceride using the algae

Abstract

Provided is a means for increasing the triglyceride storage amount in an oil and fat-high-storing alga. The solution is an alga characterized by (1) reduced expression of a Class 3 lipase gene and (2) introduction of an exogenous diacylglycerol acyltransferase gene or enhanced expression of an endogenous diacylglycerol acyltransferase gene.

Description

Technical Field

[0001] This invention relates to algae that accumulate high levels of triglycerides, and a method for manufacturing triglycerides using the algae. Background Technology

[0002] The reduction of nutrients leads to decreased proliferation and accumulation of lipids such as triglycerides (TAG) in various plants and algae. Algae have a larger biomass content than plants, which is advantageous in biofuel production and the production of useful lipids (Non-Patent Literature 1). Research on using algae-derived TAG as a raw material for biofuel production, as well as industrial and food products, is developing globally. However, with industrial progress, high production costs are currently a problem. Therefore, further technological development is indispensable for reducing production costs.

[0003] TAG accumulation is regulated through lipid decomposition and lipid synthesis. Lipases are known proteins involved in TAG decomposition, and diacylglycerol acyltransferases (DGATs) are known proteins involved in TAG synthesis. *Nannochloropsis* (hereinafter referred to as "Nannochloropsis"), a microalga of the class *Nannochloropsis*, has been reported to accumulate a certain amount of TAG during normal cultivation, but further accumulates significantly under nutrient-deficient conditions. The fatty acid composition of TAG is simple and suitable for use as fuel (Non-Patent Literature 1, Non-Patent Literature 2). It also possesses characteristics such as the ability to be cultured in seawater, the ability to cultivate at high densities, low-cost production, and established genetic engineering techniques (Non-Patent Literature 3, Non-Patent Literature 4). TGL and SDP1, known as major TAG lipases in budding yeasts and higher plants, both possess a Patatin-like domain (Non-Patent Literature 5, Non-Patent Literature 6, Non-Patent Literature 7). There are reports that when the expression of the AtSDP1 homolog gene from the diatom *Phaeodactylum tricornutum* was suppressed by 20%-40% via RNAi, the amount of TAG doubled (Non-Patent Literature 8). *Microcystis globulus* contains lipases TGL1 and TGL2 with the same domain structure. Results from creating a TGL1 / TGL2 double mutant confirmed an increase in TAG accumulation on day 2 of the initial culture period (Non-Patent Literature 9). However, no increase in TAG accumulation was confirmed in the later stages of culture under nutrient-deficient conditions; therefore, it is considered that the main TAG decomposition in *Microcystis globulus* is due to unknown lipases other than TGL1 and TGL2. Furthermore, the inventors have reported, to date, introducing the DGAT2 gene from *Chlamydomonas reinhardtii*, which is involved in TAG synthesis, into *Microcystis globulus*, resulting in overexpression under nutrient-deficient conditions and an increase in TAG accumulation (Patent Literature 1). However, there are no examples of strains using the high-oil-producing algae *Microcystis globulus* to simultaneously inhibit the function of proteins involved in algal TAG decomposition and enhance the expression of proteins involved in TAG synthesis.

[0004] Existing technical documents

[0005] Patent documents

[0006] Patent Document 1: International Publication No. 2015 / 137449

[0007] Non-patent literature

[0008] Non-patent literature 1: Plant J. 54, 621-639, (2008)

[0009] Non-patent literature 2: Biotechnol. Bioeng. 102, 100-112, (2009)

[0010] Non-patent literature 3: Proc. Natl. Acad. Sci. USA 108, 21265-21269, (2011)

[0011] Non-patent literature 4: Genes Cells 25, 695-702, (2020)

[0012] Non-patent literature 5: Plant Cell 18, 665-675, (2006)

[0013] Non-patent literature 6: J. Biol. Chem. 278, 23317-23323, (2003)

[0014] Non-patent literature 7: J. Biol. Chem. 280, 37301-37309, (2005)

[0015] Non-patent literature 8: Biochim. Biophys. Acta 1861, 239-248, (2016)

[0016] Non-patent literature 9: Biochim. Biophys. Acta 1864, 1185-1193, (2019) Summary of the Invention

[0017] The problem that the invention aims to solve

[0018] Micrococcus microcarpa is a high-lipid-accumulating algae compared to other algae, but further technological development is desired to reduce production costs. This invention was made against this backdrop, with the objective of providing a means to increase the TAG accumulation in high-lipid-accumulating algae such as Micrococcus microcarpa.

[0019] Methods for solving problems

[0020] Genetically modified strains of *Microcystis globulus* that disrupt TGL1 and TGL2, homologs of SDP1, a major TAG lipase in plants, do not achieve practical levels of TAG production enhancement (Biochim. Biophys. Acta 1864, 1185-1193, (2019)). Therefore, the inventors conducted repeated and in-depth research to achieve the above objectives, focusing on Class 3 lipases (Pfam#PF01764) as novel TAG lipases. This structure represents the α / β hydrolase folding domain of ferulic acid esterase A from *Aspergillus niger* (J. Mol. Biol. 338, 495-506, (2004)), triglyceride lipase OBL1 from *Arabidopsis thaliana* (New Phytol 217, 1062-1076, (2018)), and diacylglycerol lipase α from humans (Proc Natl Acad Sci USA 113, 26-33, (2016)). Based on the Pfam domain search, 23 class 3 lipases were identified in *Microcystis aeruginosa*. Gene-disrupted strains were created using genome editing for No3LIP7 and No3LIP14, and gene-disrupted strains were created using gene recombination for No3LIP6 and No3LIP10. Increased TAG accumulation in the later stages of culture was successfully achieved in strains with disrupted No3LIP7, No3LIP14, No3LIP6, and No3LIP10 genes. To further increase TAG accumulation, expression enhancement of genes related to TAG synthesis was performed. The genes to be introduced were DGAT1 and DGAT2, which are associated with fish that feed on algae. Two genes, CodDGAT1 and CodDGAT2, were artificially synthesized. A strong expression construct for this gene was inserted into the LDSP promoter and LDSP terminator regions of *Microcystis aeruginosa* and introduced into the No3LIP14 strain with disrupted genes. The result was a successful further increase in TAG accumulation. This invention solves the previously described problems by combining novel lipase gene disruption with strong DGAT gene expression.

[0021] The present invention provides the following [1] to [8].

[0022] [1] An algae characterized by the following (1) and (2), (1) The expression of type 3 lipase genes is reduced. (2) The expression of the introduced diacylglycerol acyltransferase gene is enhanced.

[0023] [2] The algae according to [1] are characterized in that the algae belong to the genus Micrococcus.

[0024] [3] According to the algae described in [1], the third type of lipase gene is characterized by being a gene encoding a protein of (a), (b) or (c) below. (a) A protein consisting of the amino acid sequence indicated by sequence number 2, 4, 6 or 8. (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues have been substituted, added, or deleted in the amino acid sequence shown in sequence numbers 2, 4, 6, or 8, and possessing lipase activity. (c) A protein consisting of an amino acid sequence having more than 40% homology with the amino acid sequence indicated by sequence number 2, 4, 6 or 8 and having lipase activity.

[0025] [4] According to the algae described in [1], the foreign diacylglycerol acyltransferase gene is a gene encoding a protein of (a), (b) or (c) below. (a) A protein consisting of the amino acid sequence indicated by sequence number 10 or 12. (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues have been substituted, added, or deleted in the amino acid sequence shown in sequence number 10 or 12, and which has diacylglycerol acyltransferase activity. (c) A protein consisting of an amino acid sequence having more than 40% homology with the amino acid sequence shown in sequence number 10 or 12 and having diacylglycerol acyltransferase activity.

[0026] [5] The algae according to [1] are characterized in that the endogenous diacylglycerol acyltransferase gene is a gene encoding a protein of (a), (b) or (c) below. (a) A protein consisting of the amino acid sequence indicated by sequence number 14, 16, 18, 20, 22 or 24, (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues have been replaced, added, or deleted in the amino acid sequence indicated by sequence numbers 14, 16, 18, 20, 22, or 24, and which has diacylglycerol acyltransferase activity. (c) A protein consisting of an amino acid sequence having more than 60% homology with the amino acid sequence indicated by sequence number 14, 16, 18, 20, 22 or 24 and having diacylglycerol acyltransferase activity.

[0027] [6] According to the algae described in [1], the algae are characterized in that, when cultured under phosphorus-deficient conditions, the proportion of oleic acid in the triglycerides is reduced and the proportion of palmitic acid is increased compared with that of the wild-type strain.

[0028] [7] A method for manufacturing triglycerides, characterized in that the algae described in any one of [1] to [6] are cultivated, the algae are made to produce triglycerides, and the produced triglycerides are collected.

[0029] [8] The method for manufacturing triglycerides according to [7] is characterized in that algae are cultured under phosphorus-deficient conditions.

[0030] The effects of the invention

[0031] This invention provides a novel algae. This algae is useful in TAG production due to its high accumulation of TAG. Furthermore, the TAG produced from this algae has a lower proportion of oleic acid (C18:1) and a higher proportion of palmitic acid (C16:0) compared to wild-type strains, making it suitable as a raw material for biofuels. Attached Figure Description

[0032] Figure 1 This is a diagram showing the constructs used to disrupt the No3LIP6 and No3LIP10 genes.

[0033] Figure 2 This is a diagram showing the growth and development of a strain with the No3LIP7 gene disrupted. This indicates a significant difference between WT and No3LIP7. This indicates a significant difference between the upper and lower sides. This indicates that there are significant differences among the three (p<0.05, Tukey test, n=4, error bar is SE).

[0034] Figure 3 This is a graph showing the TAG accumulation in strains with the No3LIP7 gene disruption (p<0.05, Tukey test, n=4, error bars are SE).

[0035] Figure 4 This is a graph showing the fatty acid composition of the TAG in the No3LIP7 gene-disrupted strain (p<0.05, Tukey test, n=4, error bars are SE).

[0036] Figure 5 This is a diagram showing the growth and development of a strain with the No3LIP14 gene disrupted. This indicates a significant difference between WT and No3LIP14. This indicates a significant difference between the upper and lower sides (p<0.05, Tukey test, n=4, error bar is SE).

[0037] Figure 6 This is a graph showing the TAG accumulation in strains with the No3LIP14 gene disruption (p<0.05, Tukey test, n=4, error bars are SE).

[0038] Figure 7 This is a graph showing the fatty acid composition of the TAG in the No3LIP14 gene-disrupted strain (p<0.05, Tukey test, n=4, error bars are SE).

[0039] Figure 8 This is a graph showing the growth and development and TAG accumulation of the No3LIP6 gene-damaged strain (p<0.05, Tukey test, n=4, error bars are SE).

[0040] Figure 9 This is a graph showing the growth and development and TAG accumulation of the No3LIP10 gene-damaged strain (p<0.05, Tukey test, n=4, error bars are SE).

[0041] Figure 10 This is a diagram showing the constructs used to enhance the TAG production system.

[0042] Figure 11 It is a diagram showing the growth and development of codDGAT1 / LIP14 and codDGAT2 / LIP14. This indicates that WT is significantly different from all others. This indicates a significant difference between odDGAT1 / LIP14B1-4 and all other values. This indicates a significant difference between the upper and lower sides (p<0.05, Tukey test, error bar is SE, usually n=3 for medium and n=4 for phosphorus-deficient medium).

[0043] Figure 12 This is a graph showing the TAG accumulation of codDGAT1 / LIP14 and codDGAT2 / LIP14 (p<0.05, Tukey test, error bar is SE, normal medium n=3, phosphorus-deficient medium n=4).

[0044] Figure 13 This is a graph showing the fatty acid composition of the TAGs of codDGAT1 / LIP14 and codDGAT2 / LIP14 (p<0.05, Tukey test, error bars are SE, n=4).

[0045] Figure 14 This is a graph showing the light / temperature conditions for high-density aerated culture. A. Light / temperature control program used in culture. Solid lines represent light intensity, and dashed lines represent temperature. B. Culture conditions for pre-culture and master culture.

[0046] Figure 15This is a comparison chart of biomass quantity in wild-type strains, parental strains, codDGAT1 / LIP14, and codDGAT2 / LIP14. A. Changes in biomass quantity per unit of culture medium over time. B. Changes in biomass quantity per cell over time. This indicates a significant difference between WT and CodDGAT2. The following statements indicate a significant difference between WT and CodDGAT1 and CodDGAT2. C. Biomass per unit of culture medium on day 7 of culture. D. Biomass per cell on day 7 of culture. n=3, error bar is SE. p<0.05 (Tukey test).

[0047] Figure 16 This is a comparison chart of TAG accumulation in wild-type strains, parental strains, codDGAT1 / LIP14, and codDGAT2 / LIP14. A. Changes in TAG accumulation per unit of culture medium over time. The results showed a significant difference between WT and CodDGAT2. B. TAG accumulation per unit of culture medium on day 10 of the culture start. n=3, error bar is SE. p<0.05 (Tukey test).

[0048] Figure 17 This is a graph showing the fatty acid composition of TAGs in wild-type strains, parental strains, codDGAT1 / LIP14, and codDGAT2 / LIP14 (p<0.05, Tukey test, error bars are SE, n=3). Detailed Implementation

[0049] The present invention will now be described in detail.

[0050] The algae used in this invention are preferably algae belonging to the genus *Nannochloropsis*, but other algae may also be used. Examples of algae belonging to the genus *Nannochloropsis* include *Nannochloropsis oceanica*, *Nannochloropsis gaditana*, *Nannochloropsis salina*, *Nannochloropsis oculata*, *Nannochloropsis atomus*, *Nannochloropsis maculata*, *Nannochloropsis granulata*, *Nannochloropsis limnetica*, *Nannochloropsis maritima*, and *Nannochloropsis australis*.

[0051] The algae of this invention have the following two characteristics.

[0052] The first characteristic is the reduced expression of type 3 lipase genes. Type 3 lipases possess a domain with α / β hydrolase folding. Therefore, based on this domain (e.g., accession number PF01764 in the Pfam database), type 3 lipase genes in specific algae can be identified. Type 3 lipase genes are preferably type 3 triglyceride lipases.

[0053] Specific examples of Class 3 lipase genes include No3LIP7, No3LIP14, No3LIP6, No3LIP10, or genes corresponding to these genes in various algae. The base sequences of No3LIP7, No3LIP14, No3LIP6, and No3LIP10 are shown in sequence numbers 1, 3, 5, and 7, respectively, and the amino acid sequences of the proteins encoded by these genes are shown in sequence numbers 2, 4, 6, and 8, respectively. As genes corresponding to No3LIP7, No3LIP14, No3LIP6, or No3LIP10, genes encoding (b) and (c) can be listed: (b) a protein with lipase activity consisting of an amino acid sequence in which 1 to 50 amino acid residues have been substituted, added, or deleted in the amino acid sequence shown in sequence numbers 2, 4, 6, or 8; and (c) a protein with lipase activity consisting of an amino acid sequence having more than 40% homology with the amino acid sequence shown in sequence numbers 2, 4, 6, or 8.

[0054] In the protein of (b), the number of amino acid residues that are replaced, added or deleted is not particularly limited as long as it is 1 to 50, but it is preferably about 1 to 30, more preferably about 1 to 10, further preferably about 1 to 5, and particularly preferably about 1, 2, 3 or 4.

[0055] In the protein of (c), the homology with the amino acid sequences shown in sequence numbers 2, 4, 6, or 8 is not particularly limited as long as it is 40% or more, but preferably 50% or more, more preferably 60% or more, further preferably 70% or more, and particularly preferably 80% or more. The homology value can also be higher, for example, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more. Furthermore, the homology of the amino acid sequences can be calculated using the BLASTP program provided by NCBI (National Center of Biotechnology Information).

[0056] Blast searches were performed on the amino acid sequences shown in sequences 2, 4, 6, and 8. The results showed that sequence 2 (No. 3LIP 7) had approximately 70% homology in *Nannochloropsis gaditana*, sequence 4 (No. 3LIP 14) had approximately 40% homology in both *Nannochloropsis gaditana* and *Nannochloropsis salina*, sequence 6 (No. 3LIP 6) had approximately 80% homology in both *Nannochloropsis gaditana* and *Nannochloropsis salina*, and sequence 8 (No. 3LIP 10) had approximately 60% homology in *Nannochloropsis gaditana* and approximately 80% homology in *Nannochloropsis salina*. The protein (salina) has approximately 70% homology. Therefore, it is considered that the gene encoding the protein (c) (the gene with more than 40% homology at the amino acid level) contains genes corresponding to No3LIP7, No3LIP14, No3LIP6, and No3LIP10 in algae belonging to the genus *Salina*.

[0057] In the algae of this invention, the expression of type 3 lipase genes is reduced. However, "reduced expression of type 3 lipase genes" here means that the expression level of type 3 lipase genes is lower compared with wild-type strains, and also includes cases where type 3 lipase genes are not expressed at all. In addition, the reduction in expression can affect genes in the genome (e.g., gene modification using genome editing, mutation introduction using radiation irradiation) or it can not affect genes in the genome (e.g., gene expression suppression using RNAi, antisense methods).

[0058] Examples of modifications to class 3 lipase genes include gene deletion (gene damage), introduction of mutations into protein-coding regions, and introduction of mutations into expression control regions.

[0059] The second characteristic is the introduction of an exogenous DGAT gene, or the enhancement of the expression of an endogenous DGAT gene. This second characteristic can be either the introduction of an exogenous gene or the enhancement of the expression of an endogenous gene, but since algae with enhanced expression of the endogenous DGAT gene are generally not considered recombinant organisms, they can be cultured outdoors, which is preferred in this respect.

[0060] DGAT exists in two isoenzymes, DGAT1 and DGAT2. Either isoenzyme can be used in this invention. DGAT genes are known to be of plant or animal origin, and any of these can be used as a foreign DGAT gene.

[0061] Specific examples of foreign DGAT genes include CodDGAT1, CodDGAT2, or genes similar to these. The base sequences of CodDGAT1 and CodDGAT2 are shown in sequence numbers 9 and 11, respectively, and the amino acid sequences of the proteins encoded by these genes are shown in sequence numbers 10 and 12, respectively. As genes similar to CodDGAT1 or CodDGAT2, genes encoding (b) and (c) can be listed: (b) proteins with DGAT activity consisting of amino acid sequences in which 1 to 50 amino acid residues have been substituted, added, or deleted in the amino acid sequences shown in sequence numbers 10 or 12; and (c) proteins with DGAT activity consisting of amino acid sequences with more than 40% homology to the amino acid sequences shown in sequence numbers 10 or 12.

[0062] In the protein of (b), the number of amino acid residues that are replaced, added or deleted is not particularly limited as long as it is 1 to 50, but it is preferably about 1 to 30, more preferably about 1 to 10, further preferably about 1 to 5, and particularly preferably about 1, 2, 3 or 4.

[0063] In the protein of (c), the homology with the amino acid sequence shown in sequence number 10 or 12 is not particularly limited as long as it is 40% or more, but preferably 50% or more, more preferably 60% or more, further preferably 70% or more, and particularly preferably 80% or more. The homology value can also be higher, for example, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more.

[0064] Because endogenous DGAT genes are known in a large number of algae, the expression of these DGAT genes can be enhanced in this invention. Among algae belonging to the genus *Nannochloropsis*, endogenous DGAT genes such as DGAT1A, DGAT2A, and DGAT2B are known. The base sequences of DGAT1A, DGAT2A, and DGAT2B of *Nannochloropsis oceanica* strain NIES-2145 are shown in sequence numbers 13, 15, and 17, respectively, and the amino acid sequences of the proteins encoded by these genes are shown in sequence numbers 14, 16, and 18, respectively. Furthermore, the base sequences of DGAT1A, DGAT2A, and DGAT2B of *Nannochloropsis oceanica* strain IMET1 have been published (Wei, H. et al., *Biotechnol Biofuels* 10, 174 (2017)). The accessions in GenBank (KY073295.1, KX867956.1, and KX867957.1, respectively) are shown as sequence numbers 19, 21, and 23, respectively. The amino acid sequences of the proteins encoded by these genes are shown as sequence numbers 20, 22, and 24, respectively. In this invention, the genes of the NIES-2145 strain and IMET1 strain described above, or genes similar to these genes, can be used. As similar genes, genes encoding (b) and (c) can be listed: (b) a protein consisting of an amino acid sequence in which 1 to 50 amino acid residues are replaced, added, or deleted in the amino acid sequence shown in sequence numbers 14, 16, 18, 20, 22, or 24, and having DGAT activity; (c) a protein consisting of an amino acid sequence having more than 60% homology with the amino acid sequence shown in sequence numbers 14, 16, 18, 20, 22, or 24, and having DGAT activity.

[0065] In the protein of (b), the number of amino acid residues that are replaced, added or deleted is not particularly limited as long as it is 1 to 50, preferably about 1 to 30, more preferably about 1 to 10, further preferably about 1 to 5, and particularly preferably about 1, 2, 3 or 4.

[0066] In the protein of (c), the homology with the amino acid sequences shown in sequence numbers 14, 16, 18, 20, 22, or 24 is not particularly limited as long as it is 60% or more, but preferably 70% or more, more preferably 80% or more, further preferably 90% or more, and particularly preferably 95% or more. The homology value can also be higher, for example, 97% or more, 98% or more, or 99% or more.

[0067] The method for enhancing the expression of the endogenous DGAT gene is not particularly limited. For example, the promoter and terminator of the endogenous DGAT gene can be replaced with promoters and terminators that can achieve strong protein expression. The promoters and terminators that can achieve strong protein expression are not particularly limited, because if exogenous promoters or terminators are used, the resulting algae are essentially recombinant organisms; therefore, endogenous promoters and terminators are preferred. Furthermore, the promoters and terminators that can achieve strong protein expression can be those that can achieve strong protein expression under normal conditions, or those that can only achieve strong protein expression under special conditions such as phosphorus deficiency.

[0068] Specific examples of promoters capable of achieving robust protein expression include LDSP promoters derived from algae of the genus *Microcystis*, and specific examples of terminators capable of achieving robust protein expression include LDSP terminators derived from algae of the genus *Microcystis*. The base sequences of LDSP promoters and terminators derived from algae of the genus *Microcystis* are shown in sequence numbers 25 and 26, respectively. The promoters and terminators that can be used are not limited to these. For example, promoters and terminators of the LHC gene, FCP gene, VCP1 gene, elongation factor 1-α gene, actin gene, tubulin β gene, or tubulin α gene can be used as promoters and terminators capable of achieving robust protein expression under normal conditions. Furthermore, promoters and terminators of the SQD2 gene can be used as promoters and terminators capable of achieving robust protein expression under phosphorus-deficient conditions.

[0069] As a property of the algae of the present invention, it can be listed that (1) TAG is highly accumulated in cells under any conditions, including normal culture conditions and phosphorus-deficient conditions, and (2) when cultured under phosphorus-deficient conditions, the proportion of oleic acid (C18:1) in TAG is reduced and the proportion of palmitic acid (C16:0) is increased compared with wild-type strains.

[0070] The method for manufacturing TAGs according to the present invention is characterized by cultivating the algae of the present invention described above, causing the algae to produce TAGs, and collecting the produced TAGs.

[0071] The algae of this invention can also be cultured under normal conditions (conditions that do not cause phosphorus deficiency), but to increase TAG accumulation, it is preferable to culture them under phosphorus-deficient conditions. Culture conditions other than phosphorus can be appropriately selected depending on the type of algae. For example, when culturing algae of the genus *Microcystis*, the culture medium can be F2N medium, HD medium, or a medium from which phosphorus has been removed, etc., the culture temperature can be around 15–30°C, and the light intensity during culture can be 10–2000 μmol photons / m². 2 / Second.

[0072] As a method for collecting TAG produced in algae, common methods for recovering TAG accumulated in cells can be listed, such as methods for recovering TAG by drying, freezing, breaking, filtering, centrifuging, and solvent extraction of algal cells.

[0073] Example

[0074] The present invention will be described in more detail below through embodiments, but the present invention is not limited to these embodiments.

[0075] Experimental materials

[0076] The algae *Nannochloropsis* NIES-2145 (hereinafter referred to as "N.2145"), belonging to the class *Nanochloropsis*, was used. This algal strain was available from the National Institute for Environmental Studies (http: / / www.nies.go.jp / ).

[0077] Used genes

[0078] As novel lipase genes, a search was conducted using the transcript data of *Nannochloropsis oceanica* CCMP1779v2.0 (https: / / phycocosm.jgi.doe.gov / Nanoce1779_2 / Nanoce1779_2.home.html) for genes containing the Lipase class 3 domain (Pfam#PF01764), with 23 genes selected as candidates. Among these, based on expression patterns, No3LIP7, No3LIP14, No3LIP6, and No3LIP10 were prioritized.

[0079] codDGAT1 and codDGAT2 were obtained as follows: using human DGAT1 and human DGAT2 as queries, they were determined based on the publicly available sequence of Atlantic cod (Gadus morhua, Atlantic cod) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_902167405.1 / ), and then artificially synthesized using codons from *Gastrodia elata* via Eurofins Scientific.

[0080] The sequences of each gene are recorded in the sequence listing. The sequences of No3LIP7, No3LIP14, No3LIP6, No3LIP10, codDGAT1, and codDGAT2 are recorded in sequence numbers 1, 3, 5, 7, 9, and 11, respectively.

[0081] Experimental Operation

[0082] 1. Cultivation conditions

[0083] F2N medium was used as the usual liquid culture medium for N. 2145 culture, except for high-density aerated culture. Plate culture used a medium obtained by adding agar to F2N medium to a concentration of 0.8%.

[0084] Dissolve 440 mg Na₂EDTA·2H₂O, 316 mg FeCl₃·6H₂O, 1.2 mg CoSO₄·7H₂O, 2.1 mg ZnSO₄·7H₂O, 18 mg MnCl₂·4H₂O, 0.7 mg CuSO₄·5H₂O, and 0.7 mg Na₂MoO₄·2H₂O in 100 mL of ion-exchanged water and store as f / 2 metal at 4 °C. Dissolve 121.14 g of tris(hydroxymethyl)aminomethane in 900 mL of ion-exchanged water, adjust the pH to 7.6 with HCl, then adjust to 1 L. Store the resulting solution as 1 M Tris-HCl (pH 7.6) at 4 °C. Dissolve 7.5 mg NaNO₃, 26.745 mg NH₄Cl, 3 mg NaH₂PO₄·2H₂O, and vitamin B... 120.25 μg of biotin, 0.25 μg of thiamine hydrochloride (Th HCl), 50 μg of f / 2 metal, 0.5 mL of 1M Tris-HCl (pH 7.6) were dissolved in 98.5 mL of artificial seawater, membrane sterilized, and then used as F2N medium. Daigo artificial seawater SP (FUJIFILM) was used. NaH2PO4 was removed from the F2N medium to make it a phosphorus-deficient medium. Only strains obtained by introducing codDGAT1 or codDGAT2 into No3LIP14#6B-6 were subjected to 30 μmol photons / m² when cultured in normal medium. 2 / second, 23℃, 120 minutes -1 Rotary culture was performed, with three points of culture observed at each location. For other strains, each liquid culture medium was used, with a concentration of 50–60 μmol photons / m². 2 / second, 23℃, 120 minutes -1 Rotation culture. Culture was conducted at 4 points. The initial cell concentration for each line was 3 × 10⁻⁶. 6 Cells / mL. Cell count was measured using CellDrop BF (DeNovix).

[0085] HD medium is used in high-density aerated culture as the medium for conventional liquid culture.

[0086] 222 mg ZnSO4·7H2O, 79 mg CuSO4·5H2O, 15 mg MoO3, 2.86 g H3BO3, and 1.81 g MnCl2·4H2O were dissolved in 1 L of ion-exchanged water and stored at 4 °C as stock solution A-5. A solution obtained by dissolving 2.5 g KNO3, 0.25 g Na2HPO4, 0.075 g Fe-EDTA, and 5 mL of stock solution A-5 in 500 mL of ion-exchanged water was mixed with a solution obtained by dissolving Daigo artificial seawater SP (FUJIFILM) in 500 mL of ion-exchanged water. After autoclaving, 2 mL of vitamin mixture was added, and this mixture was used as HD medium. The vitamin mixture contained vitamin B... 12 0.6 μg of biotin, 0.3 μg of thiamine hydrochloride, and 60 μg of thiamine hydrochloride were dissolved in 10 mL of deionized water and used after membrane sterilization. Na₂HPO₄ was removed from HD medium to create a phosphorus-deficient medium, reducing the Na₂HPO₄ content to 0.125 g, thus creating a 1 / 2 phosphorus medium. For routine culture, 5 mL of culture medium that had been cultured for 7 days was added to 50 mL of HD medium, and the medium was incubated at 700 μmol photons / m². 2 At 25°C, 2% CO2 is ventilated at a rate of 15 mL / min.

[0087] Cells that had been cultured normally for 7 days were cultured at 1×10⁻⁶. 8 The cells were passaged in 500 mL of phosphorus 1 / 2 medium at a rate of 1 cell / mL. Figure 14 Under controlled light irradiation and incubation temperature, the cells were pre-cultured for 4 days with 2% CO2 aeration at 450 mL / min. Then, the cells were incubated at 2 × 10⁻⁶ cells / min. 8 Cells / mL were passaged in 500 mL of phosphorus-deficient medium to... Figure 14 Under controlled light irradiation and incubation temperature, and with 2% CO2 aeration at 450 mL / min, cells were cultured for 10 days. Phosphorus-deficient conditions were also tested at three different times. Cell counts were measured using a flow cytometer RF-500 (Sysmex).

[0088] 2. Lipid extraction

[0089] In addition to samples cultured under high-density aeration, 1 mL of culture medium obtained from culture in normal or phosphorus-deficient medium was collected on each day and stored frozen at -80°C.

[0090] For frozen cells, add 1.5 mL of chloroform and 3 mL of methanol, resuspending the cells every 10 minutes while incubating at room temperature for 1 hour. Centrifuge at 1000×g using a horizontal rotor for 5 minutes, and collect 5.5 mL of the supernatant as the first extraction. Add 0.26 mL of 1% (w / v) KCl, 0.4 mL of chloroform, and 0.8 mL of methanol to the precipitate, resuspending it and centrifuging at 1000×g using a horizontal rotor for 5 minutes, collecting 1.46 mL of the supernatant as the second extraction. Combine the first and second extractions, further add 2.16 mL of 1% (w / v) KCl and 1.9 mL of chloroform, resuspending it and centrifuging at 1000×g using a horizontal rotor for 5 minutes, collecting the lower layer as the lipid extract. Dry the lipid extract, dissolve it in chloroform:methanol = 2:1, and store at -20℃.

[0091] For samples cultured in high-density aeration, 10 mL of culture medium obtained from culturing in phosphorus-deficient medium was collected on each day, the cells were recovered, and the samples were frozen and stored at -80°C.

[0092] Frozen cells were suspended in 0.8 mL of ion-exchanged water, and 1 mL of chloroform and 2 mL of methanol were added and stirred. The mixture was then incubated at room temperature for 1 hour. 1 mL of chloroform and 1 mL of ion-exchanged water were added to suspend the cells, and the mixture was centrifuged at 1000×g for 5 minutes using a horizontal rotor to remove the water-methanol layer (upper layer). The chloroform layer (lower layer) was transferred to a new glass tube. Meanwhile, 1.5 mL of chloroform was added to the original glass tube for resuscitation. The original resuscitation tube and the new tube containing the chloroform layer were centrifuged together at 1000×g for 5 minutes using a horizontal rotor. After centrifugation, the chloroform layer from the new tube was transferred to other tubes whose weights were measured. The chloroform layer from the original tube was recovered and centrifuged at 1000×g for 5 minutes using a horizontal rotor. This recovered chloroform layer was combined with the previous chloroform extract to obtain the lipid extract. The lipid extract was dried using a vacuum concentrator, dissolved in chloroform at a concentration of 10 mg / mL, and stored at -20°C.

[0093] 3. Lipid Analysis

[0094] For samples other than those cultured under high-density aeration, the lipid extract was spotted onto a thin-layer silica plate and developed for 45 minutes with a developing buffer of 160 mL hexane, 40 mL diethyl ether, and 4 mL acetic acid. The TAG (transferase indices) was confirmed under UV irradiation using 0.001% (w / v) primrose yellow. The silica containing the TAG was cut off, and 50 μL of 1 mM icosanoic acid and 500 μL of 1.5 M hydrochloric acid / methanol were added. After resuscitation, the mixture was incubated at 85 °C for 1 hour to methylate the fatty acids. 500 μL of hexane was added, and after resuscitation, the mixture was centrifuged at 1000 × g using a horizontal rotor for 5 minutes to recover the methylated fatty acids from the upper layer. 500 μL of hexane was added again to the lower layer, and after resuscitation, the mixture was centrifuged at 1000 × g using a horizontal rotor for 5 minutes to recover the upper layer. The recovered methylated fatty acids were dried and then dissolved in 100 μL of hexane as the gas chromatographic sample. Gas chromatography was used to test the SHIMADZU GC-2030 system with HR-SS-10 (0.25) x25m) (SHINWA CHEMICAL INDUSTRIES, LTD.) and carried out.

[0095] For samples cultured at high density aeration, the lipid extract was spotted onto a thin-layer silica plate and developed for 35 minutes with a developing buffer of 160 mL hexane, 40 mL diethyl ether, and 4 mL acetic acid. The TAG (transferase inhibitor) was confirmed under UV irradiation using 0.001% (w / v) primrose yellow. The silica containing the TAG was cut off, and 10 μL of 5 mM icosanoic acid and 2.5 mL of 1.5 M hydrochloric acid / methanol were added. After resuscitation, the mixture was incubated at 85 °C for 2.5 hours to methylate the fatty acids. 2.5 mL of hexane was added, and the mixture was incubated to recover the methylated fatty acids from the upper layer. The recovered methylated fatty acids were dried and dissolved in 100 μL of hexane as the gas chromatography sample. The gas chromatography setup was SHIMADZU GC-2014 with HR-SS-10 (0.25) x25m) (SHINWA CHEMICALINDUSTRIES, LTD.) and carried out.

[0096] 4. Determination of biomass (dry weight of cells)

[0097] Collect 10 mL of culture medium obtained from phosphorus-deficient culture on each day, transfer it to a 50 mL tube, and centrifuge at 4670 G at 25 °C for 10 minutes. After centrifugation, carefully remove the supernatant without removing the cells. Resuspend the remaining precipitate in H2O and transfer it to a 1.5 mL tube that has been weighed. Centrifuge at 7000 G at 25 °C for 10 minutes. Remove the supernatant without removing the cells, place the tube in a high-temperature dryer, and dry at 105 °C for 5 hours with the cap open. Remove the 1.5 mL tube from the high-temperature dryer and measure the biomass using an electronic balance.

[0098] 5. Method for preparing lipase-destroying strains

[0099] In the disruption of class 3 lipase genes No3LIP14 and No3LIP7, genome editing tools such as transcriptional activator-like effector (TALE) nucleases (TALENs) were used. TALENs are artificial nucleases that combine the TALE domain of a target-designing DNA-binding protein derived from plant pathogens with the FokI nuclease domain derived from marine bacteria. The TALE domain has 16–18 repeats of a 34-amino acid TALE repeat, with each TALE repeat recognizing one base of DNA. TALENs can be used to insert two TALENs, L-TALEN and R-TALEN, to perform a single DNA double-strand cut. In this experiment, the platinum TALEN (PtTALEN) system, whose activity was further enhanced by modifying the 4th and 32nd amino acids of the TALE repeat, was used. TALEN target sequences for each gene were searched using a web tool such as TAL Effector Nucleotide Targeter 2.0 (https: / / tale-nt.cac.cornell.edu). Two PtTALEN target sequences were designed for NoLIP14, and PtTALEN pairs corresponding to these target sequences were constructed using the Golden Gate method. The cleavage activity of each PtTALEN was investigated using cultured cells. An integrated PtTALEN expression vector for *Nicotilus micranthum* was constructed. The LIP14_A vector (L-TALEN: TCAGTCTGCGGCATGCCC, spacer: TTGTGTCGGGCGCGC, LR-TALEN: CAGCCGCCGTGGCTGCGA), which showed higher activity, was introduced into *Nicotilus micranthum* via electroporation. Genomic DNA was extracted from the resulting colonies, and PCR amplification was performed near the target sequences. Mutation introduction at the target sites was investigated by direct sequencing. Two frameshift mutant strains of No3LIP14 were obtained (6B-6 strain (13-base deletion) and 6B-10 strain (17-base deletion)). For No3LIP7, two PtTALENs were initially constructed. After confirming their activity in cultured cells, mutation introduction in Micrococcus microcarpa was attempted, but mutation introduction could not be detected.Therefore, two PtTALEN target sequences were further designed, and two frameshift mutants (3-4-1 (4-base deletion) and 3-12-1 (2-base insertion)) were obtained by using an integrated PtTALEN vector with LIP7_D (L-TALEN: TTCCAGCAGCAGCCAGTA spacer: TCATCGTCGCTCACC R-TALEN: ACCAAGCCCGCAGCACCA) as the target.

[0100] Furthermore, the sequences used in mutation introduction are listed in sequence numbers 27–32 of the sequence listing.

[0101] The disruption of the class 3 lipase genes No3LIP6 and No3LIP10 is achieved through gene recombination. Using the N.2145 genome as a template, the promoter region proLHC of LHC, the terminator region terFCP of FCP, the upstream region LIP6LF of No3LIP6, the downstream region LIP6RF of No3LIP6, the upstream region LIP10LF of No3LIP10, and the downstream region LIP10RF of No3LIP10 were amplified by PCR.

[0102] For screening of gene-transferred strains, proLHCAph8terFCP was prepared by ligating proLHC and terFCP together with the paromomycin resistance gene (Aph8 from Streptomyces rimosus). The product obtained by ligating proLHCAph8terFCP together with LIP6LF and LIP6RF was used as the construct deltalip6ParoR for disrupting the No3LIP6 gene, and the product obtained by ligating proLHCAph8terFCP together with LIP10LF and LIP10RF was used as the construct deltalip10ParoR for disrupting the No3LIP10 gene. Figure 1 ).

[0103] PCR was performed using a solution prepared by suspending 10 μL of 5×PrimeSTAR GXL Buffer, 4 μL of a 2.5 mM mixture of dNTPs, 1 μL of 10 μM primer F, 1 μL of 10 μM primer R, 1 μL of genomic solution, 1 μL of PrimeSTAR GXL DNA polymerase, and 32 μL of sterile deionized water.

[0104] PCR is performed through the following reaction cycle.

[0105] Step 1: 94℃ for 2 minutes

[0106] Step 2: Perform 30 cycles of 98℃ for 10 seconds, 60℃ for 15 seconds, and 68℃ for 1 minute per kb.

[0107] The following primers are used.

[0108] LIP6LF_F CTGGTAGATGGGCAGGTGTGAG

[0109] LIP6LF_R AAGTTAACACAACGAAGCGCCG

[0110] LIP6RF_F GCCTGACTTGCCCCAATCCTAC

[0111] LIP6RF_R GGAACAGGAGCTTCATATTC

[0112] LIP10LF_FGGTGAGATAATGGGGCAAATGC

[0113] LIP10LF_R GGTCTTGGCGCCTCCGTTTGCG

[0114] LIP10RF_F TGGAGCCCGGACGTTTAGAGAC

[0115] LIP10RF_R CACCTCTTCATCTCAGGTTGACC

[0116] proLHC_F GGTGGAGTGAGATAGCAGGAGCAT

[0117] proLHC_R GCTTGGGAAAGAAGGAGGGAGTTG

[0118] terFCP_F GCCGCAGCCTCTTGGGTGAAGTGT

[0119] terFCP_R AATACAACCGAAAAGAATAAGGAG

[0120] Furthermore, the sequences used in mutation introduction are listed in sequence numbers 33–44 of the sequence listing.

[0121] 6. Methods for constructing DGAT overexpression

[0122] Using the N.2145 genome as a template, the promoter region proLDSP of LDSP, the terminator region terLDSP of LDSP, the promoter region proLHC of LHC, and the terminator region terFCP of FCP were amplified by PCR. These regions were then ligated with the codDGAT1 or codDGAT2 gene sandwiched between proLDSP and terLDSP to create proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP. For gene selection, the hygromycin resistance gene (Aph7 from Streptomyces hygroscopicus) was sandwiched between proLHC and terFCP to create proLHCAph7terFCP. The product that connects proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP to the upstream domain of proLHCAph7terFCP is used as the constructs codDGAT1HygR and codDGAT2HygR for TAG production system enhancement. Figure 10 ).

[0123] PCR was performed using a solution prepared by suspending 10 μL of 5×PrimeSTAR GXL Buffer, 4 μL of a 2.5 mM mixture of dNTPs, 1 μL of 10 μM primer F, 1 μL of 10 μM primer R, 1 μL of genomic solution, 1 μL of PrimeSTAR GXL DNA polymerase, and 32 μL of sterile deionized water.

[0124] PCR is performed through the following reaction cycle.

[0125] Step 1: 94℃ for 2 minutes

[0126] Step 2: Perform 30 cycles of 98℃ for 10 seconds, 60℃ for 15 seconds, and 68℃ for 1 minute / kb.

[0127] The following primers are used.

[0128] proLDSP_F GTCTCTAAGATGGAGTGGATGGAG

[0129] proLDSP_R TGTTGATGCGGGCTGAGATTGGTG

[0130] terLDSP_F GAAAGATCCAAGAGAGACGAGTAG

[0131] terLDSP_R TAAGCTCACCGGCTTTTCTTACAC

[0132] proLHC_F GGTGGAGTGAGATAGCAGGAGCAT

[0133] proLHC_R GCTTGGGAAAGAAGGAGGGAGTTG

[0134] terFCP_F GCCGCAGCCTCTTGGGTGAAGTGT

[0135] terFCP_R AATACAACCGAAAAGAATAAGGAG

[0136] In addition, the sequences of the primers used in PCR are recorded in sequence numbers 45–52 of the sequence listing.

[0137] 7. Electroporation method for gene delivery

[0138] Gene transfer into *Microcystis globulus* was performed using electroporation. The electroporator was ELEPO21 (Nepa Gene Co., Ltd.).

[0139] Microcystis thuringiensis was cultured in F2N liquid medium at a concentration of 30 μmol photons / m 2 / second, 23℃, 120 minutes -1 Rotate the culture medium for 7–10 days, until the cell concentration reaches 2–3 × 10⁻⁶ cells / day. 6 Cells were passaged in 400 mL of F2N liquid medium at a rate of 1 cell / mL and cultured further. The cell count in the logarithmic growth phase was measured after 2–4 days of culture, confirming a result of 1 × 10⁶ cells / mL. 7 The cell density was approximately 100 cells / mL. The culture medium was centrifuged at 5500×g for 10 minutes at 4°C, and the cell pellet was collected. Ice-cooled 375mM sorbitol was added to the pellet, and the cells were washed again by centrifugation at 5500×g for 10 minutes at 4°C as a desalting treatment. After washing the cells with sorbitol solution four times, the cells were resuspended in sorbitol solution and adjusted to a concentration of 1×10⁻⁶ cells / mL. 10 Cells / mL. Add 20 μL of cell suspension, 1 μL of DNA to be introduced (1~0.1 μg / μL), and 49 μL of 375 mM sorbitol, adjusting the total volume to 70 μL. Mix and transfer to a 0.1 mm wide electroporation cell. Let stand for 10 minutes, then ice-cool for 5 minutes. Wipe away any moisture from the ice-cooled electroporation cell, remove any air bubbles, and then place it in the chamber. Press the Ω button to measure the resistance value. The electroporation conditions are set as follows.

[0140] Puncture pulse: Voltage 2000V, pulse width 5ms, pulse interval 50ms, 1 pulse, polarity +

[0141] Transfer pulse: Voltage 150V, pulse width 50ms, pulse interval 50ms, number of pulses 5, polarity + / -

[0142] Immediately after electroporation, the cell suspension was removed from the electroporation chamber using a dropper and transferred to a 15 mL Corning centrifuge tube containing 5 mL of F2N medium for resuscitation. The centrifuge tube cap was loosened and secured with medical tape. Two layers of paper towels were wrapped around the side to create a low-light condition (~5 μmol photons / m²). 2 Recovery culture was performed with shaking for 48 hours (per second). The top agar was autoclaved and cooled to 60°C. 5 mL was transferred to a 50 mL Corning tube, cooled, and then the culture medium was added. After mixing, the total volume was immediately spread onto F2N plates containing screening antibiotics, allowing the agar to solidify. F2N liquid medium containing 0.4% agar was used as the top agar. After solidification, the agar was rotated at 20 μmol photons / m 2 Incubate at 23°C for 3–6 weeks at a constant speed (0.5 m / s) for drug screening. Colonies appearing on plates containing the drug are transferred to new plates using sterilized toothpicks to create transformants.

[0143] Experimental results

[0144] 1. Comparison of growth and development and TAG in patients with No3LIP7 gene disruption

[0145] It is known that *Microcystis globulus* also converts carbon sources into TAGs that accumulate in intracellular oil droplets during normal culture. It is known that TAG accumulation further increases under phosphorus-deficient conditions. Therefore, the growth, development, and TAG accumulation of the No3LIP7 gene-disrupted strains 3-4-1 and 3-12-1 under normal and phosphorus-deficient conditions were compared with wild-type strains. F2N medium was used as the normal culture medium, and Na2HPO4 was removed from F2N medium to create a phosphorus-deficient medium. The culture was carried out in Erlenmeyer flasks using rotation culture, with an initial cell concentration of 3 × 10⁻⁶ cells. 6 Cells / mL.

[0146] like Figure 2 As shown on the left, the growth and development of gene-damaged strains in normal culture medium are slightly worse than those of wild-type strains, but as... Figure 2 The right-hand side shows no significant difference in growth and development in phosphorus-deficient media. (As shown...) Figure 3 As shown on the left, the TAG accumulation per unit of culture medium in the gene-damaged strain was found to be increased compared to the wild-type strain at day 11, the later stage of culture. Comparison per cell also revealed that the TAG accumulation in the gene-damaged strain was increased compared to the wild-type strain even in the later stages of culture. In phosphorus-deficient media where TAG accumulation was increased, such as… Figure 3As shown on the right, the TAG accumulation per unit of culture medium in the gene-damaged strain increased compared to the wild-type strain on day 7, but no significant increase in TAG accumulation per cell was observed. The amount of unsaturated fatty acids in the TAG affects its shelf life and the quality of the hydrogenated fuel; therefore, the fatty acid composition of the TAG in the gene-damaged strain was compared with that of the wild-type strain. In normal culture medium, such as... Figure 4 As shown on the left, a decrease in the C16:1 ratio and an increase in the C16:0 ratio were observed compared to the wild-type strain on day 7 of culture. In phosphorus-deficient media, such as... Figure 4 As shown on the right, a decrease in the C18:1 ratio was observed compared to the wild-type strain on days 4, 7, and 12 of culture.

[0147] 2. Comparison of growth and development and TAG in patients with No3LIP14 gene disruption

[0148] Similar to the No3LIP7 gene-disrupted strain, the growth, development, and TAG accumulation of the No3LIP14 gene-disrupted 6B-6 and 6B-10 strains under normal culture conditions and phosphorus-deficient conditions were also compared with wild-type strains. Figure 5 As shown on the left, the growth and development of the wild-type strain in the later stages of culture in a normal culture medium were poor, but as Figure 5 As shown on the right, no significant differences in growth and development were observed in the phosphorus-deficient culture medium. Figure 6 As shown on the left, the TAG accumulation per unit of culture medium in the gene-damaged strain increased compared to the wild-type strain on days 4 and 7 of culture. On a per-cell basis, the TAG accumulation in the gene-damaged strain increased compared to the wild-type strain on days 7 and 11, which are later stages of culture. In phosphorus-deficient media where TAG accumulation increased, such as… Figure 6 As shown on the right, the TAG accumulation per unit of culture medium was found to increase on day 7 compared to the wild-type strain. On a per-cell basis, the TAG accumulation in the gene-damaged strain increased on days 7 and 11, which are later stages of culture, compared to the wild-type strain. Comparing the fatty acid composition of the TAG in the gene-damaged strain with that in the wild-type strain revealed that in normal culture media... Figure 7 As shown on the left, the C16:1 ratio decreases, and the C16:0 ratio increases. This was observed in phosphorus-deficient media... Figure 7 As shown on the right, the proportions of C18:0 and C18:1 decrease, while the proportion of C16:0 increases.

[0149] Comparison of growth and development with TAG caused by No3LIP6 gene disruption

[0150] Similar to the No3LIP7 and No3LIP14 gene-disrupted strains, the growth, development, and TAG accumulation under phosphorus deficiency conditions of the No3LIP6 gene-disrupted 1F6 and 6A4 strains were also compared with wild-type strains. Figure 8 As shown on the left, no significant difference in growth and development was observed in the phosphorus-deficient medium. Figure 8 As shown in the upper right, the TAG accumulation per unit of culture medium in gene-damaged strains in phosphorus-deficient medium increased compared to wild-type strains on day 14, which is the later stage of culture. Figure 8 As shown in the bottom right, even on a per-cell basis, the TAG accumulation in the gene-damaged strain increased on day 14 compared to the wild-type strain.

[0151] Comparison of growth and development with TAG in patients with No3LIP10 gene disruption

[0152] Similar to the No3LIP7 and No3LIP14 gene-disrupted strains, the growth, development, and TAG accumulation under phosphorus-deficient conditions of the No3LIP10 gene-disrupted strains 4E3 and 8F3 were also compared with wild-type strains. Figure 9 As shown on the left, no significant differences in growth and development were observed in the phosphorus-deficient culture medium. Figure 9 As shown in the upper right, the TAG accumulation per unit of culture medium in the gene-damaged 4E3 strain was found to be increased compared to the wild-type strain on day 14, which is the later stage of culture. Figure 9 As shown in the lower right, there was no significant difference in TAG accumulation per cell between the gene-damaged strain and the wild-type strain.

[0153] 3. Creation of DGAT expression enhancers for further TAG accumulation enhancement

[0154] By disrupting the No3LIP7, No3LIP14, No3LIP6, and No3LIP10 genes, an increase in TAG accumulation was successfully achieved. Compared to strains disrupted by the No3LIP7 and No3LIP10 genes, strains with disrupted No3LIP14 and No3LIP6 genes showed a significant increase in TAG accumulation during the later stages of phosphorus-deficient culture. Furthermore, unlike strains with disrupted No3LIP6, No3LIP7, and No3LIP10 genes, strains with disrupted No3LIP14 genes exhibited a decrease in the C16:1 ratio and an increase in the C16:0 ratio in TAG at any culture day, while showing a decrease in the C18:0 and C18:1 ratios in phosphorus-deficient culture. Therefore, a reduction in the proportion of unsaturated fatty acids in TAG, a longer shelf life for TAG, and improved quality of hydrogenated fuels can be expected. Therefore, to further enhance TAG accumulation, No3LIP14#6B-6, which showed a significant increase in TAG accumulation in the later stages of phosphorus-deficient culture, was used as a parent strain for gene introduction to enhance TAG synthesis. Diacylglycerol acyltransferase (DGAT) is an enzyme that catalyzes the final step in TAG biosynthesis. DGAT is an enzyme widely found in animals and plants, and two types, DGAT1 and DGAT2, have been reported. Previously, the inventors discovered a promoter pSQD2a that is strongly expressed under phosphorus-deficient conditions and developed a method for promoting TAG accumulation in Chlamydomonas under phosphorus-deficient conditions by introducing the gene into Chlamydomonas through ligation with the DGTT4 gene, one of the DGAT2 genes of Chlamydomonas (Japanese Patent Application Publication No. 2014-68638). Furthermore, a method for promoting TAG accumulation in Micrococcus microcarpa under phosphorus-deficient conditions was developed by introducing the pSQD2a gene, which is ligated with the DGTT4 gene, into Micrococcus microcarpa (International Publication No. 2015 / 137449). In this study, the inventors focused on introducing the DGAT1 and DGAT2 genes from fish that feed on algae, and artificially synthesized the two genes codDGAT1 and codDGAT2. Using the N.2145 genome as a template, the promoter region proLDSP of LDSP, the terminator region terLDSP of LDSP, the promoter region proLHC of LHC, and the terminator region terFCP of FCP were amplified by PCR. The codDGAT1 or codDGAT2 gene was then linked by proLDSP and terLDSP to create proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP.For screening of gene-transferred strains, proLHCAph7terFCP was prepared by linking proLHC and terFCP with a hygromycin resistance gene (Aph7 from Streptomyces hygroscopicus). Then, proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP was linked upstream of proLHCAph7terFCP to create constructs codDGAT1HygR and codDGAT2HygR for TAG production system enhancement. Figure 10 ).Will Figure 10 Genes were introduced into the construct No3LIP14#6B-6 via electroporation, resulting in 88 strains of each type selected using hygromycin. For the codDGAT1 / LIP14 strain with introduced codDGAT1HygR, genomes were recovered from 22 of the 88 strains, and gene introduction was confirmed in 16 strains by PCR. The strains with confirmed gene introduction were then cultured statically in a small-scale (2 mL) phosphorus-deficient medium, revealing increased TAG accumulation per cell in 9 of the 16 strains compared to the parental LIP14TALEN strain. For the codDGAT2 / LIP14 strain with introduced codDGAT2HygR, genomes were recovered from 26 of the 88 strains, and gene introduction was confirmed in 20 strains by PCR. The strains with confirmed gene introduction were then cultured statically in a small-scale (2 mL) phosphorus-deficient medium, revealing increased TAG accumulation per cell in 16 of the 20 strains compared to the parental LIP14TALEN strain. Two strains each with particularly high TAG accumulation and no growth or development problems were selected as codDGAT expression enhancers: codDGAT1 / LIP14#B7-3, codDGAT1 / LIP14#B8-4, codDGAT2 / LIP14#B1-4, and codDGAT2 / LIP14#B5-4.

[0155] 4. Comparison of growth, development, and TAG between codDGAT1 / LIP14 and codDGAT2 / LIP14

[0156] For codDGAT1 / LIP14#B7-3, codDGAT1 / LIP14#B8-4, codDGAT2 / LIP14#B1-4, and codDGAT2 / LIP14#B5-4, growth and TAG accumulation under normal culture conditions and phosphorus-deficient conditions were compared with wild-type strains. Figure 11 As shown on the left, in normal culture medium, the codDGAT1-introduced and codDGAT2-introduced strains showed poorer growth and development compared to wild-type strains. Figure 11As shown on the right, codDGAT2 / No3LIP14TALEN#B1-4 showed poor growth and development compared to other strains in phosphorus-deficient medium. Figure 12 As shown on the left, it was found that the TAG accumulation per unit of culture medium in the codDGAT-introduced strain increased significantly towards the later stages of culture, with the TAG accumulation in codDGAT2 / No3LIP14TALEN#B1-4 being three times that of the wild-type strain. Even on a per-cell basis, the TAG accumulation in the codDGAT-introduced strain increased significantly towards the later stages of culture, with the TAG accumulation in codDGAT2 / No3LIP14TALEN#B1-4 exceeding five times that of the wild-type strain. In phosphorus-deficient media where TAG accumulation is prone to occur, it was found that on day 7, the TAG accumulation per unit of culture medium in both codDGAT1 / No3LIP14TALEN#B7-3 and codDGAT2 / No3LIP14TALEN#B1-4 was higher than that of the wild-type strain. On a per-cell basis, after day 5, the TAG accumulation in codDGAT2 / No3LIP14TALEN#B1-4 was also higher than that of the wild-type strain. The fatty acid composition of TAG in codDGAT-introduced strains with increased TAG accumulation in phosphorus-deficient medium was compared with that of wild-type strains. The results showed that, for example... Figure 13 As shown, the proportion of C18:1 decreased and the proportion of C16:0 increased throughout the period from day 3 to day 9.

[0157] 5. Growth and development in high-density aerated culture systems and comparison with TAG.

[0158] For practical application, the amount of biomass and TAG accumulation under strong light conditions and high-density conditions for outdoor culture become important. Therefore, the inventors compared biomass and TAG accumulation under high-density aerated culture conditions in a phosphorus-deficient medium. High-density continuous culture used HD medium as the usual liquid culture medium. Aeration with 2% CO2 was maintained at 450 mL / min, and the initial cell concentration at the start of the phosphorus-deficient culture was 2 × 10⁻⁶ cells / min. 8 Cells / mL. Due to the different culture conditions compared to previous methods, light intensity and temperature were adjusted accordingly. Figure 14 They were cultivated with such meticulous control as in China.

[0159] biomass quantity Figure 15 As shown, for the codDGAT2 introduced strain, the biomass per unit of culture medium and per cell was significantly higher than that of the wild-type strain and the parent strain (No3LIP14#6B-6) on days 6, 7, and 10 under phosphorus-deficient conditions. For the codDGAT1 / LIP14#B8-4 strain, the biomass per cell was higher than that of the wild-type strain on days 6 and 7 under phosphorus-deficient conditions. Figure 16As shown in A and 16B, for the codDGAT2 / LIP14#B1-4 strain, the TAG accumulation per unit of culture medium was higher on day 10 under phosphorus-deficient conditions compared to the wild-type strain. These results indicate that even under high-density aerated culture conditions, the combination of LIP14 gene disruption with codDGAT1 or codDGAT2 gene expression increased biomass and TAG accumulation. Furthermore, a comparison of the fatty acid composition of the TAG in the codDGAT-introduced strain with that in the wild-type strain revealed that, even under high-density aerated culture conditions, the fatty acid composition remained higher. Figure 17 As shown, on days 7 and 10, which correspond to the later stages of cultivation, the C18:1 ratio decreased and the C16:0 ratio increased.

[0160] 6. Summary

[0161] By disrupting the newly discovered TAG decomposition genes No3LIP7, No3LIP14, No3LIP6, and No3LIP10, increased TAG accumulation in the later stages of culture was successfully achieved under both normal and phosphorus-deficient conditions. Further increases in TAG accumulation were achieved by introducing the TAG synthesis genes codDGAT1 or codDGAT2 into the TAG decomposition gene disruptor strain No3LIP14#6B-6. In particular, codDGAT2 / No3LIP14#B1-4 successfully increased TAG accumulation by more than 5 times that of the wild-type strain in the later stages of normal culture and by 1.5 times in the later stages of phosphorus-deficient culture. Increased biomass and TAG accumulation were also observed even under near-industrial-use high-density continuous culture conditions. Furthermore, it was found that under phosphorus-deficient conditions, the strain obtained by introducing codDGAT into No3LIP14#6B-6 showed a 1-3% decrease in the C16:1 ratio, a 3-5% decrease in the C18:1 ratio, and a 3-5% increase in the C16:0 ratio in TAG compared to the wild-type strain. Even under high-density aerated culture conditions, the C18:1 ratio was found to be 3-5% lower and the C16:0 ratio 3-5% higher. Due to the reduction in unsaturated bonds in TAG, a longer shelf life and improved quality of hydrogenated fuels can be expected. Furthermore, the increase in C16, which is more suitable for diesel fuel materials than C18, can lead to an increased proportion of diesel produced from TAG. This invention, combining novel lipase gene disruption and strong DGAT gene expression, achieves the production of biofuels from algae, particularly *Microcystis aeruginosa*, which are larger than plant biomass, and reduces production costs for useful lipid production, making it a highly useful method.

[0162] Industry availability

[0163] This invention can be utilized in industries related to fuels, etc.

Claims

1. An algae, characterized in that, The following (1) and (2), (1) The expression of type 3 lipase genes is reduced. (2) The expression of the introduced diacylglycerol acyltransferase gene is enhanced.

2. The algae according to claim 1, characterized in that, The algae belong to the genus *Micrococcus*.

3. The algae according to claim 1, characterized in that, Type 3 lipase genes are genes that encode proteins of (a), (b), or (c) below. (a) A protein consisting of the amino acid sequence indicated by sequence number 2, 4, 6 or 8. (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues have been substituted, added, or deleted in the amino acid sequence shown in sequence numbers 2, 4, 6, or 8, and possessing lipase activity. (c) A protein consisting of an amino acid sequence having more than 40% homology with the amino acid sequence indicated by sequence number 2, 4, 6 or 8 and having lipase activity.

4. The algae according to claim 1, characterized in that, The foreign diacylglycerol acyltransferase gene is a gene that encodes a protein of (a), (b), or (c) below. (a) A protein consisting of the amino acid sequence indicated by sequence number 10 or 12. (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues have been substituted, added, or deleted in the amino acid sequence shown in sequence number 10 or 12, and which has diacylglycerol acyltransferase activity. (c) A protein consisting of an amino acid sequence having more than 40% homology with the amino acid sequence shown in sequence number 10 or 12 and having diacylglycerol acyltransferase activity.

5. The algae according to claim 1, characterized in that, Endogenous diacylglycerol acyltransferase genes are genes that encode proteins of (a), (b), or (c) below. (a) A protein consisting of the amino acid sequence indicated by sequence number 14, 16, 18, 20, 22 or 24, (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues have been replaced, added, or deleted in the amino acid sequence indicated by sequence numbers 14, 16, 18, 20, 22, or 24, and which has diacylglycerol acyltransferase activity. (c) A protein consisting of an amino acid sequence having more than 60% homology with the amino acid sequence indicated by sequence number 14, 16, 18, 20, 22 or 24 and having diacylglycerol acyltransferase activity.

6. The algae according to claim 1, characterized in that, When cultured under phosphorus-deficient conditions, the proportion of oleic acid in triglycerides decreased and the proportion of palmitic acid increased compared to wild-type plants.

7. A method for manufacturing triglycerides, characterized in that, Cultivate the algae according to any one of claims 1 to 6, cause the algae to produce triglycerides, and collect the produced triglycerides.

8. The method for manufacturing triglycerides according to claim 7, characterized in that, Algae are cultured under phosphorus-deficient conditions.

Images