A LAMP-CRISPR primer composition, kit and detection method for detecting staphylococcus aureus

By designing a specific primer combination and sgRNA using a LAMP-CRISPR/Cas12b combined isothermal reaction system, the problems of rapid and accurate detection of Staphylococcus aureus were solved, achieving efficient, specific and sensitive detection, suitable for emergency and point-of-care applications.

CN122214523APending Publication Date: 2026-06-16BEIHANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIHANG UNIV
Filing Date
2026-05-19
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Current technologies cannot achieve rapid and accurate detection of Staphylococcus aureus, especially in emergency and bedside testing, where they suffer from low sensitivity, poor specificity, complex operation, and high cost.

Method used

By combining LAMP amplification with CRISPR/Cas12b technology, a specific LAMP primer composition and sgRNA were designed to construct a one-step isothermal reaction system. Utilizing the high specificity of Cas12b recognition and cleavage characteristics, efficient and specific detection can be achieved.

Benefits of technology

The test can be completed within 40 minutes, with 100% specificity and improved sensitivity, making it suitable for emergency and bedside testing, reducing false positive rates, lowering patient mortality, and reducing antibiotic use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122214523A_ABST
    Figure CN122214523A_ABST
Patent Text Reader

Abstract

The application discloses a LAMP-CRISPR primer composition, a kit and a detection method for detecting staphylococcus aureus, and belongs to the technical field of molecular detection. The LAMP primer and the Cas12b-sgRNA specific recognition sequence are cooperatively designed, the LAMP primer group shown in the nucleotide sequence such as SEQ ID NO. 1-5 and the sgRNA shown in SEQ ID NO. 8 are provided, a LAMP-CRISPR primer composition is formed, and a kit is made with a CRISPR / Cas12b system. The LAMP amplification is combined with the CRISPR / Cas12b, a one-step constant-temperature reaction system is constructed, the amplification and detection process is significantly shortened, high specificity and high sensitivity are simultaneously achieved, and problems such as long time consumption, poor specificity, inability of multiple detection, difficulty in bedside application and the like of the sepsis pathogenic bacteria detection technology are effectively solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology, and in particular to a LAMP-CRISPR primer composition, kit, and detection method for detecting Staphylococcus aureus. Background Technology

[0002] Staphylococcus aureus ( Staphylococcus aureus Staphylococcus aureus (MRSA) is a common Gram-positive coccus. When the body's immunity is weakened or the blood barrier is severely compromised, this bacterium invades the bloodstream and causes sepsis. Patients often present with systemic inflammatory responses such as high fever, chills, tachycardia, and shortness of breath. Severe cases may present with septic shock and multiple organ dysfunction. Some patients may also develop skin lesions or abscesses, endocarditis, and other complications. MRSA is one of the main pathogens causing sepsis, accounting for 20-30% of community-acquired sepsis and 30-40% of hospital-acquired bloodstream infections; MRSA-associated sepsis has a particularly poor prognosis, with a mortality rate as high as 40-50%. Due to its rapid progression and dire prognosis, timely and accurate etiological testing is crucial. Early rapid diagnosis can quickly identify the causative agent and drug resistance characteristics, guiding clinicians to promptly select targeted antimicrobial drugs, effectively shortening the treatment window, reducing organ failure, and lowering the mortality rate by 20-30%. Therefore, establishing a rapid diagnostic system is of key significance for improving the prognosis of Staphylococcus aureus sepsis.

[0003] From a clinical application perspective, existing detection technologies cannot meet the requirements for rapid and accurate diagnosis. Microbial culture, as the accepted standard, is time-consuming, and its sensitivity decreases significantly in the early stages of infection or after antibiotic use. While qPCR has high sensitivity, its complex procedures require sophisticated instruments and specialized personnel, making rapid testing in emergency or clinical settings impossible. Next-generation sequencing technology is highly susceptible to interference from human nucleic acid contamination, has a long testing cycle (at least 48 hours), and is costly, making it difficult to meet the rapid diagnostic needs of critically ill patients. The time delay between sample collection and result reporting in existing technologies forces physicians to adopt empirical broad-spectrum antibiotic strategies in the early stages of treatment, increasing the risk of adverse reactions in patients.

[0004] From a technical perspective, traditional PCR technology relies on complex thermal cycling equipment, making rapid on-site detection difficult. While loop-mediated isothermal amplification (LAMP) can achieve efficient amplification through the strand displacement activity of BST DNA polymerase under isothermal conditions of 60-65℃, with a shorter reaction time, it has significant technical drawbacks: First, primer design is complex, requiring operators to design 4-6 primers targeting 6 specific regions of the target sequence. Simultaneously, strict avoidance of primer dimer formation and non-specific binding is crucial, making primer design far more challenging than PCR primers. Second, LAMP relies on the strong strand displacement activity of BST DNA polymerase, making it prone to misbinding to non-target sites due to partial primer complementarity. Furthermore, this error is solidified and exponentially amplified under isothermal conditions, unlike PCR which can correct it through high-temperature denaturation cycles. Third, dimers or hairpin structures may form between the 4-6 primers in the reaction system. These can be recognized and extended by the BST enzyme, resulting in false positives. Non-specific amplification also consumes reaction components, inhibiting true target amplification, leading to decreased sensitivity or unreliable results at low copy numbers. While the CRISPR / Cas system has brought new advances to molecular diagnostics, different Cas proteins have different characteristics: Cas13 recognizes RNA targets and is suitable for RNA pathogen detection; although Cas12a can trans-cleave ssDNA reporter molecules to amplify signals, its temperature tolerance is limited and its compatibility with higher temperature isothermal amplification technologies such as LAMP is limited; while Cas12b maintains activity at 55-65℃, has higher cleavage specificity and lower nonspecific background noise, making it an ideal partner for the LAMP system, current technologies have not yet fully solved the technical bottlenecks in the combined application of LAMP and CRISPR / Cas12b, such as system optimization, primer design complexity, and nonspecific amplification.

[0005] LAMP, with its high amplification efficiency and mild reaction conditions, exhibits excellent detection sensitivity, enabling rapid detection of low-abundance target molecules. However, while possessing high sensitivity, this method is susceptible to non-specific amplification and aerosol contamination, resulting in a certain probability of false positives, thus limiting its detection specificity to some extent. Therefore, there is an urgent need to combine two technologies to reduce interference and provide a detection method that simultaneously possesses high sensitivity and high specificity. Summary of the Invention

[0006] The purpose of this invention is to provide a LAMP-CRISPR primer composition, kit, and detection method for detecting Staphylococcus aureus, in order to solve the problems existing in the prior art. This invention combines LAMP amplification with CRISPR / Cas12b to construct a one-step isothermal reaction system, which significantly shortens the amplification and detection process, while possessing high specificity and high sensitivity. It effectively solves the problems of long detection time, poor specificity, inability to perform multiplex detection, and difficulty in point-of-care application in the detection technology of sepsis pathogens.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a LAMP-CRISPR primer composition for detecting Staphylococcus aureus, comprising a LAMP primer set and sgRNA; The LAMP primer set includes B3 as shown in SEQ ID NO.1, F3 as shown in SEQ ID NO.2, BIP as shown in SEQ ID NO.3, FIP as shown in SEQ ID NO.4, and LB as shown in SEQ ID NO.5; The nucleotide sequence of the sgRNA is shown in SEQ ID NO.8.

[0008] The present invention also provides the application of the above-described LAMP-CRISPR primer composition in the preparation of products for detecting Staphylococcus aureus.

[0009] Furthermore, the product is a reagent kit.

[0010] The present invention also provides a kit for detecting Staphylococcus aureus, comprising the above-described LAMP-CRISPR primer composition.

[0011] Furthermore, it also includes the Cas12b protein.

[0012] Furthermore, it also includes positive and negative controls; The positive control is a plasmid containing a Staphylococcus aureus-specific target gene, and the negative control is sterile, enzyme-free water.

[0013] Furthermore, it also includes Bst DNA polymerase, dNTPs, LAMP reaction buffer, and MgSO4.

[0014] The present invention also provides the application of the above-described LAMP-CRISPR primer composition or the above-described kit in the detection of Staphylococcus aureus for non-disease diagnostic purposes.

[0015] The present invention also provides a method for detecting Staphylococcus aureus for non-disease diagnostic purposes, comprising the following steps: Extract nucleic acid from the sample to be tested; Using the nucleic acid as a template, LAMP-CRISPR / Cas12b isothermal detection was performed using the above-mentioned kit to obtain the detection results; If an amplification curve is observed when analyzing the test results, then Staphylococcus aureus is present in the sample to be tested.

[0016] Furthermore, the reaction procedure for the LAMP-CRISPR / Cas12b isothermal detection is a reaction at 58°C for 40 min.

[0017] The present invention discloses the following technical effects: The LAMP-CRISPR primer composition of the present invention enables accurate detection of Staphylococcus aureus. There is no cross-interference between the independent LAMP primer set and sgRNA sequence corresponding to the pathogen, which is suitable for the detection needs of clinical septic infection caused by Staphylococcus aureus. This invention combines the high-efficiency isothermal amplification characteristics of LAMP with the high-specificity recognition and cleavage characteristics of CRISPR / Cas12b. Cas12b is used to compensate for the defects of non-specific amplification in LAMP technology, which can significantly reduce the false positive rate and make the detection specificity reach 100%. At the same time, the trans-cleavage activity of Cas12b can amplify the signal and improve the detection sensitivity. The primer composition of the present invention is suitable for constant temperature reaction conditions of 60-65℃. LAMP amplification and Cas12b cutting can be completed in the same system and at the same temperature, without the need for complex thermal cycling equipment. The entire detection process from sample processing to result determination can be completed within 40 minutes. It is easy to operate and does not require professional technicians. It is suitable for POCT detection scenarios such as emergency rooms and bedside. The primer composition of this invention has a simple preparation process and high stability. sgRNA can be prepared in batches in vitro and stored at low temperatures for a long time. The detection kit prepared based on this primer composition is convenient to transport and use, has low detection cost, and is suitable for use in primary healthcare institutions and large-scale clinical screening. It can provide a basis for the accurate use of antibacterial drugs in the early stage of sepsis caused by Staphylococcus aureus, reduce the mortality rate of sepsis patients, reduce the use of empirical broad-spectrum antibiotics, and alleviate the problem of bacterial resistance. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a graph showing the fluorescence detection results under a negative control. Figure 2 For template concentrations of 10 3 copies / μL, 10 2 copies / μL, 10 1 Figure of LAMP-CRISPR detection results at copies / μL; Figure 3 This is a graph showing the specific detection results of the LAMP combined with CRISPR / Cas12b method; Figure 4 This is a graph showing the fluorescence detection results of clinical samples. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Example 1 1. Extraction of Staphylococcus aureus DNA (1) Take 2 mL of bacterial culture medium, centrifuge at 10000 rpm (11500×g) for 1 min, and aspirate the supernatant as much as possible.

[0026] (2) Add 200 μL of buffer to the bacterial pellet and shake until the bacterial cells are completely suspended. Add 50 μL of lysozyme and incubate at 37°C for at least 30 min.

[0027] (3) Add 20 μL of proteinase K solution to the tube and mix well.

[0028] (4) Add 220 μL of buffer solution, shake for 15 s, place at 70 °C for 10 min, the solution should become clear, and then briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0029] (5) Add 220 μL of anhydrous ethanol and shake well for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0030] (6) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column, place the adsorption column into a collection tube, centrifuge at 12000 rpm (13400×g) for 30s, discard the waste liquid, and place the adsorption column into the collection tube.

[0031] (7) Add 500 μL of buffer to the adsorption column, centrifuge at 12000 rpm (13400×g) for 30 s, discard the waste liquid, and put the adsorption column into the collection tube.

[0032] (8) Add 600 μL of washing solution to the adsorption column, centrifuge at 12000 rpm (13400×g) for 30 s, discard the waste liquid, and put the adsorption column into the collection tube.

[0033] (9) Repeat step (8).

[0034] (10) Place the adsorption column back into the collection tube, centrifuge at 12000 rpm (13400×g) for 2 min, and discard the waste liquid. Place the adsorption column at room temperature for 2-5 min to thoroughly dry any residual rinsing liquid in the adsorption material.

[0035] (11) Transfer the adsorption column into a clean centrifuge tube, add 50 μL of water dropwise to the middle of the adsorption membrane, incubate at room temperature for 3 min, centrifuge at 12000 rpm (13400 × g) for 2 min, and collect the solution into the centrifuge tube. Staphylococcus aureus DNA is obtained.

[0036] 2. LAMP primers, kits, and LAMP-CRISPR detection method 2.1 LAMP primer design Primers were designed using the website https: / / primerexplorer.eiken.co.jp / v5_manual / index.html, resulting in a set of LAMP primers with the following nucleotide sequences: B3: AGATTGAGGTAGTGGTGAC, SEQ ID NO.1; F3: GAAATCAATCGCATTTTAACTGA, SEQ ID NO.2; BIP: ATTACAAAAAGAACAGCCAGACTCACTACTTTTCTATAACCACGTCCT, SEQ ID NO.3; FIP: TGGGTTATCAAATCGTGGATCATCTAGTGATAGAACTGTAGGCAC, SEQ ID NO.4; LB:TCTACTTCCACACGTGTAACGA, SEQ ID NO.5.

[0037] 2.2 Preparation of sgRNA 2.2.1 Primer synthesis: Specific primers for Staphylococcus aureus sgRNA were designed based on the isothermal amplification product sequence. The primers are as follows: F: 5'-TAATACGACTCACTATAGGGTCTAGAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGA-3', SEQ ID NO.6; R: 5'-AGAAGAAGTTGAAGAATTACGTGCCACTTCTCAGATTTGAGAAGCTCAACGGGCTTT-3', SEQ ID NO.7.

[0038] 2.2.2 Synthesis of Transcription Template PCR amplification was performed using sgRNA primers. The reagent preparation and amplification procedure for the reaction system are shown in Table 1.

[0039] Table 1 Reagent Preparation The reaction program was as follows: pre-denaturation at 95℃ for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 15 s / kb, 35 cycles; and complete extension at 72℃ for 5 min.

[0040] 2.2.3 Transcription and purification of RNA The double-stranded DNA obtained from the amplification in 2.2.2 was transcribed and the RNA was purified. The reagents used for transcription are shown in Table 2.

[0041] Table 2. Preparation of Transcription Reagents The transcription kit was purchased from Nanjing Novizan (catalog number: DD4201); Procedure: React at 37℃ for 12 hours. After the reaction is complete, add DNase I and digest at 37℃ for 15 minutes to remove template DNA.

[0042] 2.2.4 RNA purification RNA purification was performed using Novizan RNA magnetic beads (catalog number: N412) following these steps: (1) Take the VAHTS RNA Clean Beads out of 2-8℃ 30 minutes in advance, equilibrate to room temperature, and invert or vortex to mix the magnetic beads thoroughly.

[0043] (2) Add the corresponding volume of VAHTS RNA Clean Beads according to the original RNA solution volume. The volume of RNA Clean Beads = 1.8 × the original RNA solution volume.

[0044] (3) Use a pipette to blow ten times to mix thoroughly.

[0045] (4) Incubate at room temperature for 5 minutes to allow the RNA to bind to the magnetic beads.

[0046] (5) Place the sample on a magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant.

[0047] (6) Keep the sample in the magnetic rack at all times, add 200 μL of freshly prepared 80% ethanol (prepared with nuclease-free H2O) to rinse the magnetic beads, being careful not to blow the beads apart; incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat the previous step, rinsing a total of 2 times.

[0048] (7) Keep the sample in the magnetic rack at all times, and open the lid to air dry the magnetic beads for 8 minutes.

[0049] (8) Remove the sample from the magnetic rack, add an appropriate volume of Nuclease-free H2O, and mix thoroughly by pipetting 10 times. Let stand at room temperature for 5 minutes.

[0050] (9) Place the sample on a magnetic rack for 5 minutes. After the solution becomes clear, carefully transfer the supernatant into a new Nuclease-free centrifuge tube.

[0051] (10) The transcription product was stored at -80°C for later use.

[0052] The synthesized sgRNA sequence is: GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACGUAAUUCUUCAACUUCUUCU, SEQ ID NO.8.

[0053] 2.3 LAMP-CRISPR / Cas12b isothermal amplification reaction The LAMP primers designed in 2.1 and the sgRNA prepared in 2.2 were used for isothermal amplification. The reaction system is shown in Table 3 (total volume 10 μL).

[0054] Table 3 Isothermal amplification reaction system 3. Methods and results of fluorescence detection 3.1 Detection Method Centrifuge the prepared reaction tubes and place them in a real-time quantitative PCR detector (Agilent). Set the program to: 58℃ for 1 min (fluorescence signal acquisition) for 40 cycles. 3.2 Test Results According to the experimental results, the presence of an amplification curve indicates a positive result, while the absence of an amplification curve indicates a negative result; for example... Figure 1 As shown, the actual sample showed an amplification curve, while the negative control did not show amplification.

[0055] 4. Specific detection a) System configuration: The detection system for four different pathogens—Staphylococcus aureus, Escherichia coli, Acinetobacter baumannii, and Pseudomonas aeruginosa—was prepared according to Table 3. 1 μL of extracted bacterial genomic DNA was added to each DNA template for detection. The bacterial genomic DNA extraction method is as follows: (1) Take 2 ml of bacterial culture medium, centrifuge at 10,000 rpm (~11,500×g) for 1 min, and aspirate the supernatant as much as possible.

[0056] (2) Add 200 μL of buffer to the bacterial pellet and shake until the bacterial cells are completely suspended. Add 50 μL of lysozyme and incubate at 37°C for at least 30 min.

[0057] (3) Add 20 μL of proteinase K solution to the tube and mix well.

[0058] (4) Add 220 μL of buffer solution, shake for 15 sec, place at 70°C for 10 min, the solution should become clear, and then briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0059] (5) Add 220 μl of anhydrous ethanol and shake well for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0060] (6) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column (place the adsorption column in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, discard the waste liquid, and place the adsorption column into the collection tube.

[0061] (7) Add 500 μL of buffer to the adsorption column, centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0062] (8) Add 600 μL of washing solution to the adsorption column, centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0063] (9) Repeat step (8).

[0064] (10) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and discard the waste liquid. Place the adsorption column at room temperature for 2-5 min to thoroughly dry any residual rinsing liquid in the adsorption material.

[0065] (11) Transfer the adsorption column into a clean centrifuge tube, add 50 μL of water dropwise to the middle of the adsorption membrane, incubate at room temperature for 3 min, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and collect the solution into the centrifuge tube. The bacterial genome is obtained.

[0066] b) Detection method: Centrifuge the prepared reaction tubes, place them in a qPCR instrument, and set the program as follows: 58℃ for 1 min (fluorescence signal acquisition), for a total of 40 min.

[0067] c) Conclusion: As Figure 3 As shown in the data, the detection data indicates that this method has 100% specificity for detecting the genomes of the aforementioned pathogens.

[0068] 5. Sensitivity Testing a) System configuration: Refer to Table 3 for system configuration. Add 10 μL of DNA Template to each system. 3 copies, 10 2 copies and 10 1 The recombinant plasmids carrying the target gene were used for detection.

[0069] (1) Take 2 ml of bacterial culture medium, centrifuge at 10,000 rpm (~11,500×g) for 1 min, and aspirate the supernatant as much as possible.

[0070] (2) Add 200 μL of buffer to the bacterial pellet and shake until the bacterial cells are completely suspended. Add 50 μL of lysozyme and incubate at 37°C for at least 30 min.

[0071] (3) Add 20 μL of proteinase K solution to the tube and mix well.

[0072] (4) Add 220 μL of buffer solution, shake for 15 sec, place at 70°C for 10 min, the solution should become clear, and then briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0073] (5) Add 220 μl of anhydrous ethanol and shake well for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0074] (6) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column (place the adsorption column in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, discard the waste liquid, and place the adsorption column into the collection tube.

[0075] (7) Add 500 μL of buffer to the adsorption column, centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0076] (8) Add 600 μL of washing solution to the adsorption column, centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0077] (9) Repeat step (8).

[0078] (10) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and discard the waste liquid. Place the adsorption column at room temperature for 2-5 min to thoroughly dry any residual rinsing liquid in the adsorption material.

[0079] (11) Transfer the adsorption column into a clean centrifuge tube, add 50 μL of water dropwise to the middle of the adsorption membrane, incubate at room temperature for 3 min, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and collect the solution into the centrifuge tube. The bacterial genome is obtained.

[0080] b) Detection method: Centrifuge the prepared reaction tubes, place them in a qPCR instrument, and set the program as follows: 58℃ for 1 min (fluorescence signal acquisition), for a total of 40 min.

[0081] c) Conclusion: As Figure 2 As shown, the detection results indicate that Staphylococcus aureus nucleic acid can be detected within 30 minutes, with a detection sensitivity as low as 10. 1 copies / μL.

[0082] 6. Clinical Samples a) System configuration: Refer to Table 3 for system configuration. Add 1 μL of extracted clinical sample genome to the DNA Template (clinical samples were obtained from Sir Run Run Shaw Hospital affiliated to Zhejiang University School of Medicine / Beijing University of Agriculture Hospital). The clinical sample genome extraction method is as follows: (1) Take 2 ml of bacterial culture medium, centrifuge at 10,000 rpm (~11,500×g) for 1 min, and aspirate the supernatant as much as possible.

[0083] (2) Add 200 μL of buffer to the bacterial pellet and shake until the bacterial cells are completely suspended. Add 50 μL of lysozyme and incubate at 37°C for at least 30 min.

[0084] (3) Add 20 μL of proteinase K solution to the tube and mix well.

[0085] (4) Add 220 μL of buffer solution, shake for 15 sec, place at 70°C for 10 min, the solution should become clear, and then briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0086] (5) Add 220 μl of anhydrous ethanol and shake well for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0087] (6) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column (place the adsorption column in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, discard the waste liquid, and place the adsorption column into the collection tube.

[0088] (7) Add 500 μL of buffer to the adsorption column, centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0089] (8) Add 600 μL of washing solution to the adsorption column, centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0090] (9) Repeat step (8).

[0091] (10) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and discard the waste liquid. Place the adsorption column at room temperature for 2-5 min to thoroughly dry any residual rinsing liquid in the adsorption material.

[0092] (11) Transfer the adsorption column into a clean centrifuge tube, add 50 μL of water dropwise to the middle of the adsorption membrane, incubate at room temperature for 3 min, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and collect the solution into the centrifuge tube. The bacterial genome is obtained.

[0093] b) Detection method: Centrifuge the prepared reaction tubes, place them in a qPCR instrument, and set the program as follows: 58℃ for 1 min (fluorescence signal acquisition), for a total of 40 min.

[0094] c) Conclusion: A total of 1 clinical sample was tested, such as Figure 4 As shown.

[0095] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A LAMP-CRISPR primer composition for detecting Staphylococcus aureus, characterized in that, Including LAMP primer set and sgRNA; The LAMP primer set includes B3 as shown in SEQ ID NO.1, F3 as shown in SEQ ID NO.2, BIP as shown in SEQ ID NO.3, FIP as shown in SEQ ID NO.4, and LB as shown in SEQ ID NO.5; The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

8.

2. The use of the LAMP-CRISPR primer composition of claim 1 in the preparation of a product for detecting Staphylococcus aureus.

3. The application as described in claim 2, characterized in that, The product in question is a reagent kit.

4. A kit for detecting Staphylococcus aureus, characterized in that, Includes the LAMP-CRISPR primer composition of claim 1.

5. The kit according to claim 4, characterized in that, It also includes the Cas12b protein.

6. The kit according to claim 4, characterized in that, It also includes positive and negative controls; The positive control is a plasmid containing a Staphylococcus aureus-specific target gene, and the negative control is sterile, enzyme-free water.

7. The kit according to claim 4, characterized in that, It also includes Bst DNA polymerase, dNTPs, LAMP reaction buffer, and MgSO4.

8. The use of the LAMP-CRISPR primer composition of claim 1 or the kit of any one of claims 4-7 in the detection of Staphylococcus aureus for non-disease diagnostic purposes.

9. A method for detecting Staphylococcus aureus for non-disease diagnostic purposes, characterized in that, Includes the following steps: Extract nucleic acid from the sample to be tested; Using the nucleic acid as a template, LAMP-CRISPR / Cas12b isothermal detection was performed using the kit described in any one of claims 4-7 to obtain the detection results; If an amplification curve is observed when analyzing the test results, then Staphylococcus aureus is present in the sample to be tested.

10. The method as described in claim 9, characterized in that, The reaction procedure for the LAMP-CRISPR / Cas12b isothermal detection is 58°C for 40 min.