Nucleic acid molecules for the treatment of neuropsychiatric disorders and uses thereof
By using nucleic acid molecules to regulate the IL-6 signaling pathway, a recombinant expression system and lipid nanoparticles were developed to prepare drugs, overcoming the shortcomings of existing drugs in improving symptoms of neuropsychiatric diseases and achieving effective treatment and diagnosis of schizophrenia and depression.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE FIRST AFFILIATED HOSPITAL OF MEDICAL COLLEGE OF XIAN JIAOTONG UNIV
- Filing Date
- 2025-09-01
- Publication Date
- 2026-06-16
Smart Images

Figure CN122214337A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a nucleic acid molecule for treating neuropsychiatric diseases and its applications, belonging to the field of biotechnology. Background Technology
[0002] Neuropsychiatric disorders are a complex group of diseases with diverse clinical symptoms and comorbid mechanisms. Taking schizophrenia as an example, its main manifestations include positive symptoms such as delusions, confused thinking, hallucinations, and abnormal behavior; negative symptoms such as diminished will, decreased interest, slowed thinking, and social withdrawal; and cognitive impairment—these are known as the three core symptoms of schizophrenia. Epidemiological data shows that the incidence of schizophrenia in adults is approximately 1%, and patients' families bear high healthcare costs. Typically, schizophrenia does not exist in isolation; it shares similar clinical manifestations and comorbid mechanisms with other neuropsychiatric disorders. For example, bipolar disorder can also present with manic episodes with or without depression; patients with depression may also exhibit low mood, decreased interest, and lack of energy; patients with autism may experience cognitive impairment and social withdrawal; patients with anxiety disorders may experience various forms of anxiety symptoms; and patients with post-traumatic stress disorder may also experience anxiety, depression, and varying degrees of cognitive impairment. These neuropsychiatric disorders have complex pathogenesis and similar clinical manifestations, thus sharing many commonalities in their pathogenesis. In clinical treatment, the medications used may be the same or similar. For example, chlorpromazine can be used to treat schizophrenia as well as mania; olanzapine can treat schizophrenia and is also applicable to autism. In clinical practice, these drugs have been found to play an important role in the treatment of schizophrenia, effectively improving the positive symptoms. However, their effects on the negative symptoms and cognitive impairment of schizophrenia are very limited. Therefore, it is crucial to find new drugs and new targets for treating schizophrenia and other neuropsychiatric disorders. In-depth research into the common pathogenesis of these diseases will help develop more effective and targeted treatments, thereby improving patient prognosis and quality of life.
[0003] MicroRNAs (miRNAs) are a class of endogenous non-coding RNAs ranging from 19 to 25 nt in length, playing a crucial role in regulating protein biosynthesis. miRNAs bind to target gene mRNA molecules through a short core sequence, leading to mRNA degradation or inhibited translation. A single miRNA can regulate hundreds of target genes encoding different proteins, and the body contains thousands of miRNAs. Studies have shown that miRNAs participate in a wide range of cellular activities, such as cell proliferation, differentiation, apoptosis, signal transduction, and the cell cycle. In neuropsychiatric disorders, miRNAs play an important regulatory role. For example, in schizophrenia, miR-137 is a highly expressed miRNA in the human brain, involved in adult neurogenesis, dendritic development, and neuronal maturation, while also regulating the proliferation and differentiation of neural stem cells during neural development. Gene association analysis has found that mutations in miR-137 and its target gene CACNA1C increase susceptibility to schizophrenia in the population. Animal studies have also demonstrated that partial knockout of miR-137 can induce synaptic dysfunction, stereotyped behaviors, learning and memory impairments, and decreased social skills in mice. Furthermore, downregulated miR-132 in schizophrenia patients is associated with altered regulation of neurodevelopmental genes (including DNMT3A, GATA2, and DPYSL3), and miR-212, co-transcribed with miR-132, is also found to be downregulated in schizophrenia patients. In the temporal cortex of schizophrenia patients, upregulated miR-181b expression has been shown to be associated with downregulated expression of numerous schizophrenia-related genes. Notably, miRNAs play similar regulatory roles in other neuropsychiatric disorders. For example, in patients with depression, abnormal expression of multiple miRNAs, such as miR-135 and miR-16, is closely related to altered expression of depression-related genes such as serotonin receptors and brain-derived neurotrophic factor. In autistic patients, abnormal expression of miRNAs such as miR-132 and miR-181b is associated with altered expression of genes related to mutation development and function. These studies suggest that similar or even identical miRNA regulatory mechanisms may exist in neuropsychiatric disorders. Therefore, further exploration of miRNAs may lead to the discovery of more effective and targeted new drugs and targets for the treatment of schizophrenia and other neuropsychiatric disorders. Summary of the Invention
[0004] To address the above problems, the present invention provides a nucleic acid molecule for treating neuropsychiatric diseases, the nucleic acid molecule comprising a core sequence of nucleotide sequences such as “GAGGUAG”;
[0005] Alternatively, the nucleic acid molecule may contain a complementary sequence transcribed using the core sequence as a template;
[0006] Alternatively, the nucleic acid molecule may be a derived sequence derived from the core sequence or complementary sequence, in which one or more nucleotides have been substituted, deleted, or added, while retaining the biological function of the source sequence.
[0007] In one embodiment of the present invention, when nucleotide substitution is used in the derived sequence, the number of substituted nucleotides does not exceed five.
[0008] In one embodiment of the present invention, the nucleic acid molecule is a non-coding RNA containing a core sequence of nucleotide sequences such as “GAGGUAG”.
[0009] In one embodiment of the present invention, the nucleic acid molecule comprises a non-coding RNA with a nucleotide sequence as shown in any one of SEQ ID NO. 1 to 3.
[0010] In one embodiment of the present invention, the nucleic acid molecule is a non-coding RNA with a nucleotide sequence as shown in any one of SEQ ID NO. 1 to 3.
[0011] In one embodiment of the present invention, the target of the nucleic acid molecule for treating neuropsychiatric diseases includes interleukin-6 (IL-6). IL-6 is a pleiotropic cytokine encoded by the IL6 gene located on chromosome 7.
[0012] In one embodiment of the present invention, without limiting the invention, the nucleic acid molecule treats neuropsychiatric diseases by regulating signaling pathways related to IL-6 transduction.
[0013] In one embodiment of the present invention, the IL-6 transduction-related signaling pathway includes classical signaling pathways and / or the JAK / STAT3 signaling pathway mediated by soluble IL-6 receptor (sIL-6R) / glycoprotein 130 (gp130).
[0014] The present invention also provides a recombinant expression system for expressing the above-mentioned nucleic acid molecules.
[0015] In one embodiment of the present invention, the recombinant expression system includes a recombinant expression vector or a host cell; the recombinant expression vector carries the aforementioned nucleic acid molecule; the host cell's genome is integrated with the aforementioned nucleic acid molecule, or the host cell is transfected with a recombinant expression vector carrying the aforementioned nucleic acid molecule.
[0016] In one embodiment of the present invention, the recombinant expression vector includes a viral vector carrying the above-mentioned nucleic acid molecules, a plasmid vector carrying the above-mentioned nucleic acid molecules, or an artificial chromosome carrying the above-mentioned nucleic acid molecules.
[0017] In one embodiment of the present invention, the viral vector includes at least one of adeno-associated virus vector, flavivirus vector, retrovirus vector, bacteriophage vector, adenovirus vector, vaccinia virus vector, hybrid virus vector, baculovirus vector, herpes simplex virus vector, or lentivirus vector.
[0018] In one embodiment of the present invention, the plasmid vector includes at least one of pLKO.1 plasmid, pcDNA6.2 plasmid, PGEM-3zf plasmid, PUC19 plasmid, or PUC57 plasmid.
[0019] In one embodiment of the present invention, the host cell includes at least one of prokaryotic cells or eukaryotic cells.
[0020] In one embodiment of the present invention, the eukaryotic cells include primary cells.
[0021] In one embodiment of the present invention, the eukaryotic cells include at least one of SH-SY5Y cells, Neuro-2a cells, PC12 cells, CATH.a cells, 293T cells, 293FT cells, NIH / 3T3 cells, or L929 cells.
[0022] The present invention also provides the use of the above-mentioned nucleic acid molecules or the above-mentioned recombinant expression system in the preparation of medicaments for the prevention and / or treatment of neuropsychiatric diseases.
[0023] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia (SCZ), major depressive disorder (MDD), bipolar disorder (BD), anxiety disorder (ANX), or autistic spectrum disorder (ASD).
[0024] In one embodiment of the present invention, when the neuropsychiatric disorder is schizophrenia, the prevention and / or treatment of the neuropsychiatric disorder includes improving the positive symptoms, negative symptoms and / or cognitive impairment of schizophrenia.
[0025] In one embodiment of the present invention, the improvement of positive symptoms of schizophrenia includes improvement of abnormal activity levels and / or improvement of abnormal information processing; the improvement of negative symptoms of schizophrenia includes improvement of anxiety-like behavior, improvement of depression-like behavior, and / or improvement of social impairment.
[0026] In one embodiment of the present invention, the improvement of activity abnormalities includes the improvement of voluntary activity abnormalities; the improvement of information processing abnormalities includes the improvement of pre-pulse suppression defects.
[0027] In one embodiment of the invention, when the neuropsychiatric disorder is depression, the prevention and / or treatment of the neuropsychiatric disorder includes improving the core symptoms of depression.
[0028] In one embodiment of the invention, the improvement of core symptoms of depression includes improvement of depressive-like behaviors.
[0029] In one embodiment of the present invention, the improvement of depressive-like behavior includes increasing the sucrose preference index, reducing immobility time and / or improving social impairment.
[0030] In one embodiment of the invention, the drug further contains pharmaceutically acceptable excipients.
[0031] In one embodiment of the present invention, the pharmaceutically acceptable excipient includes a drug carrier; the drug carrier includes at least one of microcapsules, microspheres, nanoparticles or liposomes.
[0032] In one embodiment of the present invention, the nanoparticles include at least one of lipid nanoparticles (LNPs) or nanobubbles.
[0033] In one embodiment of the present invention, the drug for preventing and / or treating neuropsychiatric diseases is the above-mentioned nucleic acid molecule encapsulated in lipid nanoparticles or the above-mentioned recombinant expression system.
[0034] In one embodiment of the present invention, the lipid nanoparticles comprise ionizable lipids, cholesterol, cofactor lipids, and polyethylene glycol (PEG) lipids.
[0035] In one embodiment of the present invention, the ionizable lipid comprises cationic liposome SM-102; the auxiliary lipid comprises distearate phosphatidylcholine (DSPC); and the polyethylene glycol lipid comprises PEG-DMG-2000.
[0036] The present invention also provides a medicament for the prevention and / or treatment of neuropsychiatric disorders, wherein the medicament comprises the above-mentioned nucleic acid molecule or the above-mentioned recombinant expression system.
[0037] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0038] In one embodiment of the present invention, when the neuropsychiatric disorder is schizophrenia, the prevention and / or treatment of the neuropsychiatric disorder includes improving the positive symptoms, negative symptoms and / or cognitive impairment of schizophrenia.
[0039] In one embodiment of the present invention, the improvement of positive symptoms of schizophrenia includes improvement of abnormal activity levels and / or improvement of abnormal information processing; the improvement of negative symptoms of schizophrenia includes improvement of anxiety-like behavior, improvement of depression-like behavior, and / or improvement of social impairment.
[0040] In one embodiment of the present invention, the improvement of activity abnormalities includes the improvement of voluntary activity abnormalities; the improvement of information processing abnormalities includes the improvement of pre-pulse suppression defects.
[0041] In one embodiment of the invention, when the neuropsychiatric disorder is depression, the prevention and / or treatment of the neuropsychiatric disorder includes improving the core symptoms of depression.
[0042] In one embodiment of the invention, the improvement of core symptoms of depression includes improvement of depressive-like behaviors.
[0043] In one embodiment of the present invention, the improvement of depressive-like behavior includes increasing the sucrose preference index, reducing immobility time and / or improving social impairment.
[0044] In one embodiment of the invention, the drug further contains pharmaceutically acceptable excipients.
[0045] In one embodiment of the present invention, the pharmaceutically acceptable excipient includes a drug carrier; the drug carrier includes at least one of microcapsules, microspheres, nanoparticles or liposomes.
[0046] In one embodiment of the present invention, the nanoparticles include at least one of lipid nanoparticles (LNPs) or nanobubbles.
[0047] In one embodiment of the present invention, the drug for preventing and / or treating neuropsychiatric diseases is the above-mentioned nucleic acid molecule encapsulated in lipid nanoparticles or the above-mentioned recombinant expression system.
[0048] In one embodiment of the present invention, the lipid nanoparticles comprise ionizable lipids, cholesterol, cofactor lipids, and polyethylene glycol (PEG) lipids.
[0049] In one embodiment of the present invention, the ionizable lipid comprises cationic liposome SM-102; the auxiliary lipid comprises distearate phosphatidylcholine (DSPC); and the polyethylene glycol lipid comprises PEG-DMG-2000.
[0050] The present invention also provides the application of the above-mentioned nucleic acid molecules or the above-mentioned recombinant expression system in screening drugs for the prevention and / or treatment of neuropsychiatric diseases.
[0051] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia (SCZ), major depressive disorder (MDD), bipolar disorder (BD), anxiety disorder (ANX), or autistic spectrum disorder (ASD).
[0052] In one embodiment of the present invention, the application includes the following steps:
[0053] Step 1: Apply the compound to be screened together with the above-mentioned nucleic acid molecules to a cell model or animal model; or, apply the compound to be screened together with the above-mentioned recombinant expression system to a cell model or animal model.
[0054] Step 2: Detect changes in indicators related to neuropsychiatric diseases in cell models or animal models;
[0055] Step 3: Screen for drugs for the prevention and / or treatment of neuropsychiatric disorders based on changes in indicators.
[0056] In one embodiment of the present invention, the indicators related to neuropsychiatric diseases include at least one of neurotransmitter levels, neuronal activity, behavioral indicators, protein expression levels, or gene expression levels; the protein expression levels include the expression levels of IL-6 transduction-related markers.
[0057] In one embodiment of the present invention, the IL-6 transduction-related markers include soluble IL-6 receptor (sIL-6R), glycoprotein 130 (gp130), and / or phosphorylated signal transducer and transcription activator 3 (p-STAT3).
[0058] In one embodiment of the present invention, the drug is an adjuvant drug that can enhance the therapeutic effect of the above-mentioned nucleic acid molecules.
[0059] The present invention also provides a method for screening drugs for the prevention and / or treatment of neuropsychiatric disorders, the method comprising the following steps:
[0060] Step 1: Apply the compound to be screened together with the above-mentioned nucleic acid molecules to a cell model or animal model, or apply the compound to be screened together with the above-mentioned recombinant expression system to a cell model or animal model.
[0061] Step 2: Detect changes in indicators related to neuropsychiatric diseases in cell models or animal models;
[0062] Step 3: Screen for drugs for the prevention and / or treatment of neuropsychiatric disorders based on changes in indicators.
[0063] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia (SCZ), major depressive disorder (MDD), bipolar disorder (BD), anxiety disorder (ANX), or autistic spectrum disorder (ASD).
[0064] In one embodiment of the present invention, the indicators related to neuropsychiatric diseases include at least one of neurotransmitter levels, neuronal activity, behavioral indicators, protein expression levels, or gene expression levels; the protein expression levels include the expression levels of IL-6 transduction-related markers.
[0065] In one embodiment of the present invention, the IL-6 transduction-related markers include soluble IL-6 receptor (sIL-6R), glycoprotein 130 (gp130), and / or phosphorylated signal transducer and transcription activator 3 (p-STAT3).
[0066] In one embodiment of the present invention, the drug is an adjuvant drug that can enhance the therapeutic effect of the above-mentioned nucleic acid molecules.
[0067] The present invention also provides a molecular marker for diagnosing neuropsychiatric disorders, the molecular marker comprising the above-mentioned nucleic acid molecules.
[0068] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0069] This invention also provides the application of reagents for detecting the above-mentioned molecular markers in test samples in the preparation of products for diagnosing neuropsychiatric diseases.
[0070] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0071] In one embodiment of the present invention, the product includes a test kit.
[0072] In one embodiment of the present invention, the detection kit includes primers, probes or antibodies for detecting the aforementioned molecular markers in the sample to be tested.
[0073] In one embodiment of the present invention, the diagnosis of neuropsychiatric disorders includes the following steps:
[0074] Step 1: Detect the levels of the above molecular markers in the patient's body;
[0075] Step 2: Analyze the test results obtained in Step 1 and calculate the probability value of the disease;
[0076] Step 3: Determine whether the patient has a neuropsychiatric disease based on the disease probability value calculated in Step 2.
[0077] In one embodiment of the present invention, step one includes: detecting the relative expression levels and CT values of the above-mentioned molecular markers in the patient's body.
[0078] In one embodiment of the present invention, step two includes: based on the detection results obtained in step one, using a binary logistic regression model to output a disease probability value between 0 and 1, whereby the disease probability value represents the likelihood that the patient has a neuropsychiatric disease.
[0079] The mathematical expression of the binary logistic regression model is P(Y=1)=1 / (1+e^-(β0+β1X1+β2X2));
[0080] In the formula, P(Y=1) is the probability that the patient has a neuropsychiatric disease, X1 is the relative expression level of miR-0701, X2 is the CT value of miR-0701, β0 is the intercept term, and β1 and β2 are the regression coefficients corresponding to X1 and X2.
[0081] In one embodiment of the present invention, the training process of the binary logistic regression model includes: using the maximum likelihood estimation method, training based on data from patients and healthy control groups with known diagnostic results; the training data includes the relative expression level of miR-0701, CT value, and corresponding diagnostic result (disease / health) of each sample to be tested; and as more data accumulates, the model parameters (β0, β1, β2) are updated periodically to improve its predictive accuracy.
[0082] In one embodiment of the present invention, step three includes: setting 0.5 as a decision threshold; if the disease probability value calculated in step two is >0.5, then the sample to be tested is classified into a disease group (schizophrenia or depression); if the disease probability value calculated in step two is <0.5, then the sample to be tested is classified into a healthy group.
[0083] The present invention also provides a product for diagnosing neuropsychiatric disorders, the product comprising reagents for detecting the aforementioned molecular markers in a sample to be tested.
[0084] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0085] In one embodiment of the present invention, the product includes a test kit.
[0086] In one embodiment of the present invention, the detection kit includes primers, probes or antibodies for detecting the aforementioned molecular markers in the sample to be tested.
[0087] The present invention also provides an evaluation model for diagnosing neuropsychiatric disorders, the evaluation model including a detection module, a data analysis module and an assessment module;
[0088] The detection module is used to detect the levels of the aforementioned molecular markers in the sample to be tested;
[0089] The data analysis module is used to analyze the detection results output by the detection module and calculate the probability value of the disease.
[0090] The assessment module is used to classify the test sample into a disease group or a healthy group based on the disease probability value output by the data analysis module.
[0091] In one embodiment of the present invention, the evaluation model further includes a database module; the database module is used to store molecular marker level data for disease groups and healthy groups.
[0092] In one embodiment of the present invention, the detection module is used to detect the relative expression level and CT value of the above-mentioned molecular markers in the sample to be tested.
[0093] In one embodiment of the present invention, the process by which the data analysis module analyzes and calculates the detection results output by the detection module includes:
[0094] The binary logistic regression model outputs a disease probability value between 0 and 1, which represents the likelihood that the sample belongs to the disease group.
[0095] The mathematical expression of the binary logistic regression model is P(Y=1)=1 / (1+e^-(β0+β1X1+β2X2));
[0096] In the formula, P(Y=1) is the probability that the sample belongs to the disease group, X1 is the relative expression level of miR-0701, X2 is the CT value of miR-0701, β0 is the intercept term, and β1 and β2 are the regression coefficients corresponding to X1 and X2.
[0097] In one embodiment of the present invention, the training process of the binary logistic regression model includes: using the maximum likelihood estimation method, training based on data from patients and healthy control groups with known diagnostic results; the training data includes the relative expression level of miR-0701, CT value, and corresponding diagnostic result (disease / health) of each sample to be tested; and as more data accumulates, the model parameters (β0, β1, β2) are updated periodically to improve its predictive accuracy.
[0098] In one embodiment of the present invention, the process by which the evaluation module classifies a disease group or a healthy group based on the disease probability value output by the data analysis module includes:
[0099] Set 0.5 as the decision threshold; if the disease probability value output by the data analysis module is >0.5, the sample to be tested will be classified into the disease group (schizophrenia or depression); if the disease probability value output by the data analysis module is <0.5, the sample to be tested will be classified into the healthy group.
[0100] This invention also provides the application of reagents for detecting the above-mentioned molecular markers in test samples in the preparation of products for evaluating the therapeutic effects of neuropsychiatric diseases and / or monitoring the progression of neuropsychiatric diseases.
[0101] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0102] In one embodiment of the present invention, the product includes a test kit.
[0103] In one embodiment of the present invention, the detection kit includes primers, probes or antibodies for detecting the aforementioned molecular markers in the sample to be tested.
[0104] In one embodiment of the present invention, the evaluation of the treatment effect of neuropsychiatric diseases includes the following steps:
[0105] Step 1: Detect the levels of the above molecular markers in the patient's body before and after treatment;
[0106] Step 2: Compare the changes in molecular marker levels before and after treatment to assess the treatment effect.
[0107] In one embodiment of the present invention, the monitoring of the progression of neuropsychiatric diseases includes: periodically detecting the levels of molecular markers in the patient's body, analyzing their trends over time, and assessing the disease progression; and / or, detecting the levels of molecular markers during symptom remission periods to assess the risk of relapse.
[0108] This invention also provides the application of the above-mentioned nucleic acid molecules or molecular markers in the prevention, personalized treatment and gene therapy of neuropsychiatric diseases.
[0109] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0110] In one embodiment of the present invention, the application includes: identifying individuals at high risk based on the expression levels of the aforementioned molecular markers in the patient's body and administering prophylactic agents; determining drug sensitivity based on the expression levels of the aforementioned molecular markers in the patient's body and developing individualized treatment plans; and / or treating the patient using a gene therapy vector containing the aforementioned nucleic acid molecules.
[0111] In one embodiment of the present invention, the treatment of a patient using a gene therapy vector containing the above-mentioned nucleic acid molecules includes: treating the patient using a drug delivery system capable of targeting and delivering the gene therapy vector containing the above-mentioned nucleic acid molecules to the central nervous system.
[0112] The present invention also provides an application system for the prevention, personalized treatment and gene therapy of neuropsychiatric diseases, the application system including a risk assessment module, a personalized treatment module and a gene therapy module;
[0113] The risk assessment module is used to identify high-risk individuals and formulate prevention strategies based on the expression levels of the aforementioned molecular markers in patients.
[0114] The personalized treatment module is used to determine drug sensitivity and formulate personalized treatment plans based on the expression levels of the above molecular markers in the patient's body;
[0115] The gene therapy module is used to design and implement gene therapy strategies based on the aforementioned nucleic acid molecules.
[0116] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0117] In one embodiment of the present invention, the gene therapy strategy includes treating the patient using a gene therapy vector containing the aforementioned nucleic acid molecules.
[0118] In one embodiment of the present invention, the treatment of a patient using a gene therapy vector containing the above-mentioned nucleic acid molecules includes: treating the patient using a drug delivery system capable of targeting and delivering the gene therapy vector containing the above-mentioned nucleic acid molecules to the central nervous system.
[0119] This invention also provides the application of the above-mentioned nucleic acid molecules in research and development related to neuropsychiatric diseases.
[0120] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0121] In one embodiment of the present invention, the application includes: constructing a transgenic animal model expressing the above-mentioned nucleic acid molecules; evaluating the effects of the above-mentioned nucleic acid molecules on neural plasticity and neurotransmitter balance; establishing a drug screening platform based on the above-mentioned nucleic acid molecules; developing epigenetic regulatory applications utilizing the above-mentioned nucleic acid molecules; studying the application of the above-mentioned nucleic acid molecules in the preparation of functional foods with neuroprotective effects; and / or developing an artificial intelligence model based on patient data to predict drug responses to the above-mentioned nucleic acid molecules.
[0122] The present invention also provides a comprehensive platform for research and development related to neuropsychiatric diseases, the comprehensive platform including an animal model module, a mechanism research module, a drug screening module and an application development module;
[0123] The animal model module is used to construct transgenic animals expressing the above-mentioned nucleic acid molecules;
[0124] The mechanism study module is used to evaluate the effects of the aforementioned nucleic acid molecules on nervous system function;
[0125] The drug screening module is used to establish a screening system based on the above-mentioned nucleic acid molecules;
[0126] The application development module is used to explore the applications of the above-mentioned nucleic acid molecules in epigenetic regulation, functional food preparation, and artificial intelligence prediction.
[0127] In one embodiment of the present invention, the neuropsychiatric disorder includes at least one of schizophrenia, depression, bipolar disorder, anxiety disorder, or autism spectrum disorder.
[0128] The technical solution of this invention has the following advantages:
[0129] 1. This invention provides a nucleic acid molecule for treating neuropsychiatric disorders, the nucleic acid molecule comprising a core sequence with a nucleotide sequence such as “GAGGUAG”. Studies have shown that the nucleic acid molecule exhibits significant therapeutic effects in multiple neuropsychiatric disorder models. In MK-801-induced SCZ model mice, it significantly improves abnormal activity levels (manifested as increased spontaneous activity), abnormal information processing (manifested as pre-pulse inhibition deficiency), anxiety-like behavior, depression-like behavior, social impairment, and cognitive dysfunction. Similarly, in ketamine-induced SCZ model mice, this nucleic acid molecule also effectively improves abnormal activity levels (manifested as decreased spontaneous activity), abnormal information processing (manifested as pre-pulse inhibition deficiency), anxiety-like behavior, depression-like behavior, social impairment, and cognitive dysfunction. Furthermore, in a chronic stress-restraint-induced major depressive disorder (MDD) model mouse, this nucleic acid molecule significantly improves depression-like behavior (manifested as decreased sucrose preference index, increased immobility time, and social impairment). These results demonstrate that this nucleic acid molecule can effectively improve not only the positive and negative symptoms and cognitive impairment of schizophrenia, but also the core symptoms of other neuropsychiatric disorders such as depression, showing broad therapeutic potential. Furthermore, overexpression of this nucleic acid molecule in the medial prefrontal cortex (mPFC) of normal mice did not induce schizophrenia symptoms, preliminarily confirming its potential safety. Therefore, this nucleic acid molecule shows great promise for the preparation of therapeutic drugs for neuropsychiatric disorders.
[0130] 2. This invention also provides a molecular marker for diagnosing neuropsychiatric disorders, wherein the molecular marker comprises a nucleic acid molecule; the nucleic acid molecule contains a core sequence with a nucleotide sequence such as “GAGGUAG”. Studies have shown that the expression of the nucleic acid molecule is decreased in the peripheral blood of patients with schizophrenia and depression. Furthermore, studies have shown that when using the nucleic acid molecule in peripheral blood as a molecular marker for the diagnosis of neuropsychiatric disorders, the area under the curve (AUC) is 0.82 for schizophrenia (SCZ) with a 95% confidence interval (CI) of 0.745–0.895, and the AUC is 0.84 for major depressive disorder (MDD) with a CI of 0.768–0.912. These data indicate that using the nucleic acid molecule as a molecular marker for the diagnosis of neuropsychiatric disorders has high accuracy. Therefore, the nucleic acid molecule has great application potential in the preparation of products for diagnosing neuropsychiatric disorders. Attached Figure Description
[0131] Figure 1 miR-0701 expression was decreased in the peripheral blood of SCZ patients. Figure 1In the figures, (a) shows the expression changes of miR-0701 in peripheral blood of SCZ patients before and after treatment; (b) shows the expression changes of miR-0701 in peripheral blood of chronic SCZ patients; and (c) shows the expression changes of miR-0701 in peripheral blood of MDD patients before and after treatment. *P<0.05, **P<0.01, ***P<0.001. Data are expressed as mean ± standard error. Independent samples t-test or t' test was used to compare SCZ with Control, and paired samples t-test was used to compare SCZ with SCZ-treated.
[0132] Figure 2 Peripheral blood miR-0701 as a biomarker predicts diagnostic classification of schizophrenia (SCZ) and depression (MDD). Figure 2 In the table, (a) shows the prediction results matrix for the control group (CTR) and the schizophrenia group (SCZ), correctly predicting 44 CTRs and 38 SCZs, and mispredicting 12 CTRs and 6 SCZs; (b) shows the ROC curve distinguishing between the control group (CTR) and the schizophrenia group (SCZ), with an area under the curve (AUC) of 0.82 and a 95% confidence interval (CI) of 0.745 to 0.895; (c) shows the prediction results matrix for the control group (CTR) and the depression group (MDD), correctly predicting 44 CTRs and 40 MDDs, and mispredicting 10 CTRs and 6 MDDs; (d) shows the ROC curve distinguishing between the control group (CTR) and the depression group (MDD), with an area under the curve (AUC) of 0.84 and a 95% confidence interval (CI) of 0.768 to 0.912. The ROC curves are plotted in gray-blue, representing the relationship between sensitivity and 1-specificity. The area under the curve (AUC) represents the predictive accuracy of the biomarker for the two neuropsychiatric disorders. The 95% confidence interval (CI) indicates the confidence range of the biomarker's predictive accuracy for the two neuropsychiatric disorders. The diagonal dashed line represents the predictive power of random guessing.
[0133] Figure 3 Ketamine-induced mice exhibited reduced activity levels, anxiety and depression-like behaviors, as well as cognitive impairment and pre-pulse inhibition defects. Figure 3In the study, (a) showed a decrease in spontaneous activity in ketamine-induced mice during the OFT test; (b) showed a decrease in time spent in the central region in ketamine-induced mice; (c) showed a decrease in time spent in the open arm during the EPM test in ketamine-induced mice; (d) showed a deficit in short-term memory during the NOR test in ketamine-induced mice; (e) showed a deficit in long-term memory during the NOR test in ketamine-induced mice; (f) showed a deficit in pre-pulse inhibition in ketamine-induced mice; and (g and h) showed a significant increase in immobility time in the TST and FST tests in ketamine-induced mice. *P<0.05, **P<0.01, ***P<0.001. Data are presented as mean ± standard error and analyzed using an independent samples t-test, n=7.
[0134] Figure 4 MK-801-induced mice exhibited increased activity, anxiety and depression-like behaviors, as well as cognitive impairment and prepulse inhibition defects. Figure 4 In the study, (a) showed increased spontaneous activity in the OFT test in the MK-801 group; (b) showed decreased dwell time in the central region in the MK-801 group; (c) showed decreased dwell time in the open arm in the EPM test in the MK-801 group; (d) showed short-term memory deficit in the NOR test in the MK-801 group; (e) showed long-term memory deficit in the NOR test in the MK-801 group; (f) showed pre-pulse inhibition deficit in the MK-801 group; and (g and h) showed a significant increase in immobility time in the TST and FST tests in the MK-801 group. *P<0.05, **P<0.01, ***P<0.001. Data are expressed as mean ± standard error and analyzed using an independent samples t-test, n=10.
[0135] Figure 5 Chronic stress and restraint induce depressive-like behavior in mice. Figure 5 In the table, (a) shows the effect of chronic stress on the sugar water preference score in mice during the sugar water preference test; (b) shows the effect of chronic stress on the immobility time in mice during the TST test; and (c) shows the effect of chronic stress on the immobility time in mice during the FST test. *P<0.05, **P<0.01, ***P<0.001. Data are expressed as mean ± standard error. One-way ANOVA was used, n=9.
[0136] Figure 6 Expression levels of miR-0701 in peripheral blood and mPFC of SCZ and MDD model mice. Figure 6In the table, (a) and (b) represent the expression levels of miR-0701 in the peripheral blood of ketamine- and MK-801-induced SCZ mice; (d) and (e) represent the expression levels of miR-0701 in the mPFC of ketamine- and MK-801-induced SCZ mice; and (c) and (f) represent the expression levels of miR-0701 in the peripheral blood and mPFC of mice exhibiting depressive-like behavior induced by chronic stress restraint. *P<0.05, **P<0.01, ***P<0.001. Data are expressed as mean ± standard error and analyzed using an independent samples t-test. n = 7–9 (in the ketamine experiment, n = 7 for peripheral blood and mPFC results; in the MK-801 experiment, n = 10 for peripheral blood and n = 9 for mPFC results; and in the CRS experiment, n = 9 for peripheral blood and mPFC results).
[0137] Figure 7 The effects of decreased miR-0701 expression in mPFC on positive symptoms (voluntary activity), negative symptoms (anxiety-like and depression-like behaviors), cognitive impairment, and prepulse inhibition deficiency in mice. Figure 7 In the study, (a) the effect of decreased miR-0701 expression in the mPFC on spontaneous activity in mice; (b) the effect of decreased miR-0701 expression in the mPFC on the time mice spent in the central region; (c) the effect of decreased miR-0701 expression in the mPFC on the time mice spent in open-arm position; (d) the effect of decreased miR-0701 expression in the mPFC on short-term and long-term memory in mice during the NOR experiment; (e) the effect of decreased miR-0701 expression in the mPFC on immobility time in the TST experiment; (f) the effect of decreased miR-0701 expression in the mPFC on immobility time in the FST experiment; and (g) the effect of decreased miR-0701 expression in the mPFC on prepulse inhibition in mice. *P<0.05, **P<0.01, ***P<0.001, compared with the Control group. Data are expressed as mean ± standard error, and independent samples t-test and Mann-Whitney test were used, n=11.
[0138] Figure 8 Effects of elevated expression of miR-0701, miR-0701a, and miR-0701b in mPFC on MK-801-induced spontaneous activity in SCZ mice. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+MK-801. Data are expressed as mean ± standard error. One-way ANOVA was used, n=7.
[0139] Figure 9 The effect of increased expression of miR-0701, miR-0701a and miR-0701b in mPFC on negative symptoms (anxiety-like and depression-like behaviors) in SCZ mice. Figure 9 In the figures, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the time mice spend in the central region; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the time mice spend in the open arm; (c) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the immobility time of mice in the TST; and (d) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the immobility time of mice in the FST. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+Saline, # represents comparison with Control+MK-801. Data are expressed as mean ± standard error. One-way ANOVA was used, n=7.
[0140] Figure 10 Effects of overexpression of miR-0701, miR-0701a and miR-0701b in mPFC on cognitive impairment in MK-801-induced SCZ mice. Figure 10 In the figure, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on short-term memory in SCZ mice; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on long-term memory (b) in SCZ mice. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+MK-801. Data are expressed as mean ± standard error. One-way ANOVA was used, n=7.
[0141] Figure 11 Effects of overexpression of miR-0701, miR-0701a and miR-0701b in mPFC on MK-801-induced prepulse inhibition deficiency in SCZ mice. Figure 11In the table, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under different 70 dB prepulse stimuli; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under 75 dB prepulse stimuli; and (c) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under 80 dB prepulse stimuli. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+MK-801. Data are expressed as mean ± standard error. One-way ANOVA was used, n=7.
[0142] Figure 12 Effects of elevated expression of miR-0701, miR-0701a, and miR-0701b in mPFC on ketamine-induced spontaneous activity in SCZ mice. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+ketamine. Data are expressed as mean ± standard error. One-way ANOVA was used, n=8.
[0143] Figure 13 Effects of overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC on ketamine-induced negative symptoms (anxiety-like and depression-like behaviors) in SCZ mice. Figure 13In the figures, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the time mice spend in the central region; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the time mice spend in the open arm; (c) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the immobility time of mice in the TST; and (d) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the immobility time of mice in the FST. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+ketamine. Data are expressed as mean ± standard error. One-way ANOVA was used, n=8.
[0144] Figure 14 Effects of overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC on ketamine-induced cognitive impairment in SCZ mice. Figure 14 In the figure, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on short-term memory in SCZ mice; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on long-term memory (b) in SCZ mice. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+ketamine. Data are expressed as mean ± standard error. One-way ANOVA was used, n=8.
[0145] Figure 15 Effects of overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC on ketamine-induced prepulse inhibition deficiency in SCZ mice. Figure 15In the table, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under a prepulse stimulus of 70 dB; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under a prepulse stimulus of 75 dB; and (c) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under a prepulse stimulus of 80 dB. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01, ###P<0.001, * represents comparison with Control+saline, # represents comparison with Control+ketamine. Data are expressed as mean ± standard error. One-way ANOVA was used, n=8.
[0146] Figure 16 Effects of overexpression of miR-0701, miR-0701a and miR-0701b in mPFC on depressive-like behavior in mice under chronic stress. Figure 16 In the above, (a, d, g) represent the effects of increased expression of miR-0701, miR-0701a, and miR-0701b in mPFC on the sucrose preference score in mice during the sucrose preference test, respectively; (b, e, h) represent the effects of increased expression of miR-0701, miR-0701a, and miR-0701b in mPFC on immobility time in mice during the TST test, respectively; and (c, f, i) represent the effects of increased expression of miR-0701, miR-0701a, and miR-0701b in mPFC on immobility time in mice during the FST test, respectively. *P<0.05, **P<0.01, ***P<0.001. Data are expressed as mean ± standard error. One-way ANOVA was used, with n=9–11 (n=10 for miR-0701, n=9 for miR-0701a, and n=11 for miR-0701b).
[0147] Figure 17 The effect of elevated expression of miR-0701, miR-0701a, and miR-0701b in mPFC on spontaneous activity levels in normal mice. No statistical significance was found in ns. Data are expressed as mean ± standard error. One-way ANOVA was used, n = 7–8 (Control group n = 7, other groups n = 8).
[0148] Figure 18 Effects of increased expression of miR-0701, miR-0701a, and miR-0701b in mPFC on anxiety-like and depression-like behaviors in mice. Figure 18In the study, (a) showed the effect of elevated expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the time mice spent in the central region; (b) showed the effect of elevated expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the time mice spent in the open arm region; (c) showed the effect of elevated expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the immobility time of mice in the TST (Thinning Tunneling Stimulation); and (d) showed the effect of elevated expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the immobility time of mice in the FST (Front-Terminal Stimulation Stimulation). No statistically significant differences were found in ns. Data are expressed as mean ± standard error. One-way ANOVA was used, with n = 7–8 (n = 7 for the control group and n = 8 for the other groups).
[0149] Figure 19 Effects of increased expression of miR-0701, miR-0701a, and miR-0701b in mPFC on cognitive function in mice. Figure 19 In the figure, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on short-term memory in mice; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on long-term memory in mice (b). No statistical significance was found in ns. Data are expressed as mean ± standard error. One-way ANOVA was used, with n = 7–8 (control group n = 7, other groups n = 8).
[0150] Figure 20 Effects of overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC on prepulse inhibition in normal mice. Figure 20 In the figure, (a) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under a prepulse stimulus of 70 dB; (b) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under a prepulse stimulus of 75 dB; and (c) shows the effect of increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC on the shock reflex in mice under a prepulse stimulus of 80 dB. No statistical significance was found in ns. Data are expressed as mean ± standard error. One-way ANOVA was used, with n = 7–8 (control group n = 7, other groups n = 8).
[0151] Figure 21 : Predict downstream target genes of miR-0701 by using overlapping genes from four databases.
[0152] Figure 22 Candidate target genes are further overlapped with mRNAs that differ from those in the LIBD data.
[0153] Figure 23 IL-6 expression was elevated in the PFC of SCZ patients in CMC and HBCC. HS was a healthy control group, and SCZ was a patient with schizophrenia, 361 vs 514, using an independent samples t-test.
[0154] Figure 24 IL-6 expression was elevated in the PFC of SCZ patients in LIBD. HS was a healthy control group, and SCZ was a patient with schizophrenia, 175 vs 318, using an independent samples t-test.
[0155] Figure 25 IL-6 expression was elevated in the peripheral blood of SCZ patients, and decreased after treatment.
[0156] Figure 26 qPCR was used to detect changes in IL-6 expression when miR-0701 was regulated. Figure 26 In the table, (a) shows the change in IL-6 expression when miR-0701 expression was decreased in mPFC as detected by qPCR; (b) shows the change in IL-6 expression when miR-0701 was overexpressed in mPFC as detected by qPCR. *P<0.05, **P<0.01, ***P<0.001. Data are expressed as mean ± standard error and analyzed using independent samples t-tests, n=5 and 8.
[0157] Figure 27 The core sequence and IL-63'UTR are complementary. Detailed Implementation
[0158] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0159] For any experimental steps or conditions not specified in the following examples, the procedures or conditions described in the literature in this field can be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.
[0160] Experimental Example 1
[0161] The specific process is as follows:
[0162] 1. Research Materials and Methods
[0163] 1.1 Recruitment of patients with schizophrenia and depression, as well as healthy control volunteers.
[0164] This study recruited five groups of schizophrenia patients and healthy controls from five different medical institutions in China, as well as one group of depression patients and healthy controls.
[0165] The inclusion criteria for the schizophrenia patient group were: age 18–60 years, diagnosed by a psychiatrist with schizophrenia meeting the DSM-5 diagnostic criteria. Patients with pre- and post-treatment states were all hospitalized during acute episodes for patient rotation. Chronic patients were defined as those in a stable phase who had not experienced exacerbations of psychotic symptoms in the past 3 months and were receiving standard antipsychotic medication treatment. Exclusion criteria included: serious physical illness such as malignancy or organic brain disease; recent history of substance abuse or dependence (including alcohol); confirmed intellectual disability; self-harm or suicidal tendencies; current use of other medications that may affect cognitive function; pregnant or lactating women; and those with impaired ability to understand the study content or express consent.
[0166] The inclusion criteria for the depression group were: age 18–60 years, diagnosed by a specialist with a moderate to severe depressive episode meeting the DSM-5 diagnostic criteria, without other comorbid mental disorders, and requiring hospitalization for standard antidepressant treatment. Exclusion criteria included: presence of other mental disorders (such as anxiety disorders, obsessive-compulsive disorder, etc.); depressive symptoms stemming from physical illness or substance abuse; history of suicide attempts or self-harm; concurrent serious physical illness; recent use of other medications that may affect cognitive function; pregnancy or lactation; and impaired ability to understand the study content or express consent.
[0167] The inclusion criteria for the healthy control group were: age 18–60 years, no history of mental disorders, and no family history of mental disorders among close relatives.
[0168] All participants signed written informed consent forms, and the relevant research was reviewed and approved by the relevant research ethics committee. Peripheral venous blood from all participants was collected using BD PAXgene blood collection tubes, and miRNA was extracted using the accompanying commercial kit. The extracted miRNA was stored at -80°C.
[0169] 1.2 Laboratory Animals
[0170] The C57BL / 6J male mice (7 weeks old, weighing approximately 25g) used in this study were purchased from Beijing Vital River Company. Experimental procedures were strictly performed in accordance with the Regulations on the Management of Laboratory Animals promulgated by the National Health and Family Planning Commission of the People's Republic of China and the experimental ethics review standards of Xi'an Jiaotong University. Mice were housed in an animal room with 4-5 mice per cage. The cage floor was covered with bedding, which was changed weekly to keep it dry and clean. Mice were provided with ample food and water. The temperature in the animal room was maintained at 25℃, the humidity at 60%, and the lighting time from 7:00 am to 7:00 pm. Before the experiment, the mice needed to acclimatize to the environment in the animal room for one week to reduce the stimulation caused by stress and anxiety. During this period, the experimenters also needed to pet and practice handling the mice daily for 5 minutes each time.
[0171] 1.3 Adeno-associated virus
[0172] The adeno-associated virus (AAV) used in the experiment (serotype AAV) 2 / 9 Provided by Shanghai Heyuan Biotechnology Co., Ltd.
[0173] 1.4 Behavioral Experiments
[0174] For behavioral experimental method steps, please refer to the literature "Ni T, Zhu L, Wang S, et al. Medial prefrontalcortex Notch1 signaling mediates methamphetamine-induced psychosis via Hes1-dependent suppression of GABA receptor expression [J]. Molecular Psychiatry, 2022, 27(10): 4009-4022.", "Yin FY, Guo H, Cui JJ, et al. The basolateral amygdalaregulation of complex cognitive behaviors in the five-choice serialreactiontime task[J].Psychopharmacology,2019,236(11):3135-3146." and "Wang J, LaiS M, Wang R, et al.Dopamine D3 receptor in the nucleus accumbens alleviatesneuroinflammation in a mouse model ofdepressive-like behavior[J].BrainBehavior and "Immunity, 2022, 101:165-179." When conducting behavioral tests, mice are placed in the behavioral chamber one hour in advance to allow for environmental adaptation, reducing the impact of environmental stress on mouse behavior.
[0175] 1.4.1 Elevated Cross Maze
[0176] The elevated plus maze (EPM) is an experimental method for evaluating anxiety-like responses in rodents. This experiment is simple to perform and can relatively directly reflect emotional changes in mice. It utilizes the fact that rodents, facing a novel object, open their arms in response to curiosity, leading to exploratory behavior. Simultaneously, the open arms, suspended at a height, induce fear and a natural tendency towards darkness (closing the arms). This conflict between exploration and avoidance results in anxiety.
[0177] The elevated cross maze consists of two open arms and two closed arms, perpendicular to each other in a cross shape. Each arm measures 30×5cm, and the closed arms are 15cm high. The central area, which intersects the maze, measures 6×6cm. The platform is 50cm above the ground. During the experiment, mice were placed in the central area facing the open arms. A Smart 3.0 instrument recorded the time the mice spent in the open arms, closed arms, and central area within 5 minutes. The percentage of time spent in the open arms was calculated as: (Open arm time / (Open arm time + Closed arm time)) × 100%. The longer the mouse spent in the open arms, the lower its anxiety-like level.
[0178] 1.4.2 Open Field Experiment
[0179] The open field test (OFT), also known as the open box test, is a method for evaluating the autonomous behavior, exploratory behavior, and stress levels of laboratory animals in a novel environment. The test uses a box measuring 43×43×43cm. Mice are placed in the open field, and their activity levels are recorded using a Smart 3.0 device over 10 minutes.
[0180] 1.4.3 New Object Recognition Experiment
[0181] The novel object recognition (NOR) experiment is a method that uses the innate instinct of rodents to approach and explore novel objects to test their learning and memory abilities. The experiment mainly consists of three phases: adaptation, training, and testing.
[0182] During the adaptation phase (Day 1-2), mice were placed in a box for 10 minutes each day. After each round of experiments, the box was sprayed with 75% (v / v) alcohol and wiped clean with tissue paper to avoid the influence of the odor produced by the previous mouse on the subsequent mice.
[0183] During the training phase (Day 3), two identical objects were placed at the bottom of a box, 10cm from the edge of the box. The mouse was placed in the box with its back to the objects and trained for 5 minutes. This was repeated 3 times, with a 15-minute interval between training sessions. The time the mouse spent exploring the objects was recorded using Smart 3.0 software.
[0184] The testing phase (Day 3) was mainly used to reflect the mouse's short-term memory. One of the objects was replaced with a new object. The two objects were roughly the same size. Three hours after the third training session, the mouse was placed in a box with its back to the object. The Smart 3.0 software was used to record the time the mouse spent exploring the two objects.
[0185] The testing phase (Day 4), conducted 24 hours after training, primarily assesses the mice's long-term memory. The new object from Day 3 is replaced with another new object of the same size. The mice are placed in a box with their backs to the object, and the Smart 3.0 software is used to record the time taken for the mice to explore both objects. The mice's cognitive ability is represented by the new object recognition index, calculated as: Discrimination Ratio = (Exploration Time of New Object / (Exploration Time of New Object + Exploration Time of Old Object)) × 100%. A higher recognition index indicates better memory.
[0186] 1.4.4 Pre-pulse suppression test
[0187] The shock reflex is a reflex in mammals that occurs when suddenly exposed to strong external stimuli such as sound, light, electricity, or air, causing the animal to flex and extend its muscles throughout its body. Behaviorally, it manifests as a startle reflex, hence it is also called the startle jump reflex. This is a self-protective and defense mechanism in animals. Later research found that if a weak stimulus (not capable of triggering a shock reflex) is given to the animal approximately tens to hundreds of milliseconds before the strong stimulus, followed by a strong stimulus, the animal will exhibit a reduced amplitude of shock. This phenomenon is called pre-pulse inhibition (PPI). PPI involves the coordinated function of multiple brain regions, and its specific mechanism remains unclear. Sensorimotor gating refers to the body's ability to inhibit irrelevant sensory information while also suppressing the behavioral responses caused by such information. Therefore, PPI is currently an important behavioral parameter for assessing the adequacy of sensorimotor gating function. Patients with sensory-motor dysphoric encephalopathy (SCZ) exhibit not only symptoms such as anxiety and depression but also abnormalities in information processing, i.e., sensory gating deficits. Therefore, PPI testing in rodents is crucial for the study of SCZ.
[0188] The PPI testing steps are as follows:
[0189] (1) Adaptation: Two days before the PPI test, the mice need to be placed in the PPI test box to adapt and reduce the stress response of the mice. Each adaptation lasts for 30 minutes. After one mouse has finished adapting, rinse the PPI test box with clean water and wipe the water off with tissue paper. Then, put the next round of mice into the PPI test box to continue the adaptation. Do not turn on the light switch during the adaptation process.
[0190] (2) PPI Testing: Based on the results of the shock reflex test, a suitable sound stimulus intensity was selected as the shock stimulus and pre-pulse stimulus. Background noise (white noise, 65dB) was kept on throughout the experimental phase, which was divided into three stages: adaptation, Block I, and Block II. The adaptation period lasted 5 minutes. Block I consisted of 10 tracks, each without a pre-pulse stimulus. The shock stimulus was set to 110dB, with a duration of 40ms. The intervals between tracks varied randomly between 15 and 20 seconds. Block II consisted of 50 tracks, with the intervals between tracks varying randomly between 15 and 20 seconds. Block II included five stimulus types: No stimulus, 70dB, 75dB, 80dB pre-pulse stimulus + 110dB shock stimulus, and 110dB shock stimulus. Each stimulus type appeared 10 times in the 50 tracks, with the order of appearance random and the intervals varying randomly between 15 and 20 seconds. PPI% = (1 - pre-pulse shock reflex / 110dB shock reflex) × 100%.
[0191] 1.4.5. Tail Suspension Test
[0192] The tail suspension test (TST) is a classic method used to assess the efficacy of antidepressants, stimulants, and sedatives, and it can be used to evaluate depressive-like behaviors in mice.
[0193] The specific procedure for the tail suspension test is as follows: A tail suspension test box with dimensions of 55cm high × 60cm wide × 11.5cm deep is used. A partition in the middle of the test box separates the experimental animals to reduce mutual interference. The mouse's tail is attached with medical tape, specifically 1cm from the tip of the tail. The mouse's tail is then hung on a tail suspension rod, with the distance between the mouse's head and the ground 15cm. The duration of the mouse's immobile state is recorded using SMART 3.0 for 10 minutes.
[0194] 1.4.6 Forced Swimming Experiment
[0195] The Forced Swimming Test (FST) is very similar to the TST test; both are used to assess depressive-like behaviors in mice.
[0196] The specific procedure for the forced swimming experiment is as follows: The bucket used in the experiment has a diameter of 10cm and a height of 25cm. Water is poured into the bucket during the experiment, the water temperature is controlled at 24℃, and the water depth is 15cm. The experimental animal is placed in the bucket, and the duration of the immobile state of the mouse in the last 4 minutes within 6 minutes is recorded using Smart 3.0.
[0197] 1.4.7. Modeling Chronic Restraint Stress
[0198] Chronic Restraint Stress (CRS) modeling involves placing the behavior restraints flat with the bottom open, allowing the animal to enter facing the opening. The opening is then sealed and secured with a matching plug. Once restrained, the animal's length within the restraints is less than its body length, ensuring only the head can move freely while the limbs are restricted. Restraint lasts for 21 days, 4 hours per day.
[0199] 1.4.8 Sugar Water Preference Experiment
[0200] The sucrose preference test consists of a training period and a testing period. During the training period, animals are given a bottle of sucrose solution (concentration of 2%, where % refers to g / 100mL) and a bottle of pure water, with free access to the water, allowing mice to adapt to the presence of sugar in their drinking water. After fasting for 8 hours (with no restriction on water), the animals undergo a sucrose / pure water consumption test (12 hours). The sucrose preference index is calculated based on the animals' sucrose and pure water intake (sucrose preference index = sucrose consumption / total fluid consumption × 100%) (a decrease in the sucrose preference index is a manifestation of anhedonia, a symptom of depression).
[0201] 1.5 Statistical Analysis
[0202] The data from the experiment were analyzed, processed, and plotted using GraphPad Prism 8.0 software. Experimental results are expressed as mean ± standard error (mean ± SEM), where P < 0.05 was considered statistically significant. One-way ANOVA was used for behavioral experiments, with Bonferroni performing post-hoc tests.
[0203] 2. Experimental Results
[0204] 2.1. miR-0701 expression was decreased in the peripheral blood of patients with schizophrenia and depression.
[0205] In this study, peripheral blood samples were collected from five batches of schizophrenia patients and healthy controls. High-throughput miRNA sequencing was performed, and the following analyses were conducted (high-throughput sequencing was performed using the Illuminanovaseq 6000 sequencing platform; independent sample differential analysis and paired sample differential analysis were performed using DEseq2 and edgeR software):
[0206] (1) Independent sample difference analysis (11 vs 12) was performed between chronic SCZ treatment and healthy control group to obtain common significant results of DEseq2 and edgeR (absolute value of log2FC ≥ 0.5, P < 0.05).
[0207] (2) Paired sample difference analysis (11 vs 11) was performed before and after treatment of chronic SCZ to obtain the common significance results of DEseq2 and edgeR (absolute value of log2FC ≥ 0.5, P < 0.05).
[0208] (3) The intersection of the above results yielded 41 DE miRNAs (log2FC with consistent direction and absolute value ≥0.5, P<0.05).
[0209] (4) Paired sample difference analysis was performed using peripheral blood miRNA sequencing data of the second batch of first-episode SCZ patients before and after treatment (20VS20) to obtain common significant results of DEseq2 and edgeR (absolute value of log2FC ≥0.5, P<0.05).
[0210] (5) Independent sample difference analysis was performed using peripheral blood miRNA sequencing data of the third batch of first-episode SCZ patients before treatment and healthy controls (7 vs 8) to obtain the common significant results of DEseq2 and edgeR (absolute value of log2FC ≥0.5, P<0.05).
[0211] (6) The intersection of the results of (4) and (5) yielded 39 DE miRNAs (log2FC direction was consistent and absolute value ≥0.5, P<0.05).
[0212] (7) The intersection of the DE miRNAs in (3) and (6) yielded 3 DE miRNAs, all of which were downregulated in the case group. Among them, only miR-0701 had a homologous sequence in animals and its expression was decreased in the case group.
[0213] (8) qPCR validation was performed using peripheral blood miRNAs from the fourth batch of first-episode SCZ patients before and after treatment, and from healthy controls (10 vs 10). The results showed that miR-0701 (UGAGGUAGUAGGUUGUGUGGUU, SEQ ID NO.1) expression decreased in the peripheral blood of SCZ patients, but significantly increased after treatment. The qPCR validation process first involved reverse transcription of miRNA using the tailing method (reverse transcription was performed using a miRNA cDNA first-strand synthesis kit, model AG11717, purchased from Hunan Aikerui Biotechnology Co., Ltd.), and then qPCR was used to detect miR-0701 expression in peripheral blood (qPCR was performed using U6snRNA as an internal control, using a SYBR Green Pro Taq HS premixed qPCR kit, model AG11704, purchased from Hunan Aikerui Biotechnology Co., Ltd., and the nucleotide sequence of the upstream primer used for miR-0701 was as shown in SEQ ID NO. As shown in NO.4, the downstream primer is the universal downstream primer provided with the kit. The nucleotide sequence of the upstream primer used for the internal control is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6.
[0214] (9) Using the peripheral blood miRNAs of the fifth batch of chronic SCZ patients and healthy controls (137 vs 77), qPCR verification was performed again. The results still showed that miR-0701 expression was decreased in the peripheral blood of SCZ patients.
[0215] (10) qPCR was used to detect miR-0701 in peripheral blood of patients with depression before and after treatment and healthy controls (15 vs 15). The results showed that miR-0701 expression decreased in peripheral blood of MDD patients, and then increased significantly after treatment. Figure 1 ).
[0216] The above results indicate that changes in miR-0701 expression in peripheral blood are closely related to schizophrenia and depression, as well as their prognosis.
[0217] 2.2 Using peripheral blood miR-0701 as a biomarker for predicting the diagnosis and classification of schizophrenia and depression
[0218] The qPCR results (relative expression level and CT value) of peripheral blood miR-0701 were substituted into a classification prediction model. The model automatically determined whether the patient had schizophrenia or depression based on the calculated probability values (>0.5 for disease, <0.5 for normal). The results showed that... Figure 2When the miRNAs described above were used as molecular markers in peripheral blood for the diagnosis of schizophrenia and depression, the areas under the curve (AUC) were 0.82 (SCZ) and 0.84 (MDD), respectively, and the 95% confidence intervals (CI) were 0.745–0.895 (SCZ) and 0.768–0.912 (MDD), respectively, indicating high accuracy. Therefore, the miRNAs described above can effectively diagnose schizophrenia and depression.
[0219] The classification prediction model used to predict the diagnosis of schizophrenia and depression using peripheral blood miR-0701 as a biomarker is a binary classification model based on the expression level of peripheral blood miR-0701, used to predict whether an individual has schizophrenia or depression. The main features of the model are as follows:
[0220] (1) Input variables: The model uses two main input variables:
[0221] a) Relative expression level of miR-0701;
[0222] b) CT value of miR-0701.
[0223] (2) Model Type: This model uses the logistic regression algorithm. Specifically, it is a binary logistic regression model, and its mathematical expression is as follows:
[0224] P(Y=1)=1 / (1+e^-(β0+β1X1+β2X2));
[0225] In the formula, P(Y=1) is the probability that the sample belongs to the disease group, X1 is the relative expression level of miR-0701, X2 is the CT value of miR-0701, β0 is the intercept term, and β1 and β2 are the corresponding regression coefficients.
[0226] (3) Model training: The model was trained using maximum likelihood estimation based on data from patients and healthy controls with known diagnoses. The training data included the relative expression level of miR-0701, CT value, and corresponding diagnoses (disease / health) for each sample.
[0227] (4) Model output: The model outputs a probability value between 0 and 1, which represents the probability that the sample belongs to the disease group.
[0228] (5) Decision threshold: Set 0.5 as the decision threshold. If the output probability > 0.5, the sample is classified into the disease group (schizophrenia or depression); if the probability < 0.5, it is classified into the healthy group.
[0229] (6) Application process:
[0230] a) Collect peripheral blood samples from patients and extract whole blood RNA;
[0231] b) Perform qPCR detection to obtain the relative expression level and CT value of miR-0701;
[0232] c) Input these two values into the pre-trained logistic regression model;
[0233] d) The model calculates and outputs probability values;
[0234] e) Automatically determine whether a patient belongs to a disease group based on probability values.
[0235] (7) Limitations: Since the model is based on only a single biomarker, it may be necessary to combine other clinical information to improve predictive accuracy. In addition, the model cannot distinguish between schizophrenia and depression, but can only determine whether a patient belongs to one of these two diseases.
[0236] (8) Continuous optimization: As more data accumulates, the model parameters (β0, β1, β2) can be updated regularly to improve their prediction accuracy.
[0237] 2.3 Ketamine-induced mice exhibited SCZ-like behavior.
[0238] Ketamine is an effective, selective, non-competitive NMDA receptor antagonist commonly used to construct animal models of spontaneous urinary tract infection (SCZ). These models effectively mimic the positive and negative symptoms of SCZ, as well as cognitive impairment. In this study, normal male C57BL / 6J mice were used as experimental animals. A SCZ animal model was established by intraperitoneal administration of 25.0 mg / kg four times daily for 7 consecutive days at a volume of 10 mL / kg (using physiological saline). An equal volume of physiological saline was provided as a control (saline group). After model establishment, positive-related symptoms of SCZ were assessed using OFT and PPI, negative-related symptoms were assessed using EPM, TST, and FST, and cognitive function was assessed using the NOR test.
[0239] Behavioral results show ( Figure 3Compared to the saline group, mice in the ketamine group exhibited a significant reduction in spontaneous activity during OFT (Out-of-Flight) experiments, suggesting that ketamine induces abnormal activity levels. Simultaneously, in the OFT experiment, mice in the ketamine group spent significantly less time in the central region. In the EPM (Extended Peripheral Movement) experiment, mice in the ketamine group showed a significant reduction in time spent with open arms and a significant increase in time spent with closed arms, suggesting anxiety-like behavior. In the TST (Traction on Stimulation) and FST (Frequency on Stimulation) experiments, mice in the ketamine group showed a significant increase in immobility time, suggesting depression-like behavior. These anxiety-like and depression-like behaviors correspond to negative symptoms in SCZ (Sensory-Induced Zygomatic Disease) patients. In the NOR (Natural Orientation) experiment, mice in the ketamine group showed reduced exploration time for novel objects in both short-term and long-term memory tests, indicating cognitive impairment. In the PPI (Progressive Peripheral Inhibition) experiment, mice in the ketamine group showed pre-pulse inhibition defects, suggesting that ketamine induces abnormal information processing (i.e., sensory gating defects). These results indicate that ketamine-induced mice exhibit SCZ-like behavioral abnormalities, and the ketamine-induced SCZ mouse model has been successfully established.
[0240] 2.4. MK-801-induced mice exhibited SCZ-like behavior.
[0241] MK-801, also known as dizocilpine, is an effective, selective, non-competitive NMDA receptor antagonist commonly used to construct animal models of sclerotic leukopenia (SCZ). These models effectively mimic the positive and negative symptoms and cognitive impairment associated with SCZ. In this study, normal male C57BL / 6J mice were used as experimental animals. A SCZ animal model was established using MK-801 group (administered intraperitoneally at 1.0 mg / kg once daily for 14 consecutive days, with a dosage of 10 mL / kg in physiological saline). An equal volume of physiological saline was provided as a control (saline group). After model establishment, positive-related symptoms of SCZ were assessed using OFT and PPI, negative-related symptoms were assessed using EPM, TST, and FST, and cognitive function was assessed using the NOR test.
[0242] Behavioral results show ( Figure 4Compared to the saline group, the MK-801 group mice exhibited significantly increased spontaneous activity during OFT (Out-of-Face) tests, suggesting a state of hyperexcitability, which corresponds to the manic-excitatory psychosis seen in SCZ patients. Simultaneously, in the OFT test, the MK-801 group mice spent significantly less time in the central region. In the EPM (Extended Peripheral Movement) test, the MK-801 group mice showed significantly reduced time spent with open arms and significantly increased time spent with closed arms, suggesting anxiety-like behavior. In the TST (Traumatic Stimulation) and FST (Follicular Stimulation) tests, the MK-801 group mice showed significantly increased immobility time, suggesting depressive-like behavior. These anxiety-like and depressive-like behaviors correspond to negative symptoms in SCZ patients. In the NOR (Natural Orientation) test, the MK-801 group mice showed reduced exploration time for new objects in both short-term and long-term memory tests, indicating cognitive impairment. In the PPI experiment, the MK-801 group mice exhibited prepulse inhibition defects, suggesting that MK-801 causes abnormal information processing in mice (i.e., sensory gating defects). These results indicate that MK-801-induced mice exhibit SCZ-like behavioral abnormalities, and the MK-801-induced SCZ mouse model has been successfully established.
[0243] 2.5 Chronic restraint stress induces depressive-like behavior in mice
[0244] In this study, a depression model of chronic restraint stress (CRS) was established using normal male C57BL / 6J mice as experimental animals. Behavioral results showed that ( Figure 5 The CRS group mice showed a decrease in sucrose preference index and a significant increase in immobility time in the TST and FST experiments, indicating that CRS exhibits depressive-like behavior, and that the MDD mouse model induced by chronic stress restraint was successfully constructed.
[0245] 2.6. The expression of miR-0701 was decreased in the mPFC and peripheral blood of SCZ mice and mice under chronic stress.
[0246] After the behavioral studies in steps 2.3, 2.4, and 2.5, mice were anesthetized with isoflurane, and blood was collected via the orbital vein. Following blood collection, the mice were sacrificed, and the medial prefrontal cortex (mPFC) was isolated. RNA was extracted from peripheral blood and mPFC using the trizol method (see reference "Chen F, Shi B, Liu WJ, et al. Circulating exosomal microRNAs as biomarkers of lupusnephritis[J]. Frontiers in Immunology, 2023, 14."). Then, miRNA was reverse transcribed using a tailing method (reverse transcription was performed using a miRNA cDNA first-strand synthesis kit, model AG11717, purchased from Hunan Aike Rui Biotechnology Co., Ltd.). Finally, miR-0701 expression in peripheral blood and mPFC was detected by qPCR (using U6snRNA as an internal control in SYBR GreenPro Taq). The HS premixed qPCR kit (model AG11704) was used, purchased from Hunan Aikerui Biotechnology Co., Ltd. The nucleotide sequence of the upstream primer used for miR-0701 is shown in SEQ ID NO.4. The downstream primer was the universal downstream primer provided with the kit. The nucleotide sequence of the upstream primer used for the internal control is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6. The qPCR results showed ( Figure 6 The expression of miR-0701 was decreased in the peripheral blood and mPFC of ketamine and MK-801-induced SCZ mice, and also decreased in the peripheral blood and mPFC of mice with depressive-like behavior induced by chronic stress restraint. These results suggest that miR-0701 plays an important role in SCZ-like behavior.
[0247] 2.7 Decreased miR-0701 expression in mPFC causes abnormal SCZ-like behavior.
[0248] Experiments 2.3–2.6 identified miR-0701 as a key molecule regulating SCZ. To further investigate the function of miR-0701 in SCZ, this study constructed an AAV that inhibits miR-0701 (the AAV that inhibits miR-0701 is a recombinant AAV carrying the gene that inhibits miR-0701, wherein the nucleotide sequence of the gene that inhibits miR-0701 is shown in SEQ ID NO.7, and the AAV that inhibits miR-0701 was synthesized by Shanghai Heyuan Biotechnology Co., Ltd., with a titer of 2.21E+13 v.g / mL). The AAV was injected into the mPFC of mice to observe what behavioral changes were caused by the decrease in miR-0701 expression in the mPFC.
[0249] This study used normal male C57BL / 6J mice as experimental animals. AAV inhibiting miR-0701 was injected into the mouse mPFC (stereolocalization: AP: +0.2cm, ML: ±0.04cm, DV: -0.22cm) via brain region injection. The injection volume per side was 200 nL, and the injection rate was 50 nL / min. After injection, the microsyringe was left in the target nucleus for 5 min to reduce AAV extravasation. Mice injected with miR-0701-inhibiting AAV into the mPFC were designated as the miR-0701-reduced animal model group (KDmiR-0701 group). The control group (Control group) received an equal volume (200 nL per side, injection rate 50 nL / min) of AAV carrying a random sequence as a control (the AAV carrying the random sequence was synthesized by Shanghai Heyuan Biotechnology Co., Ltd., with a titer of 1.58E+13v.g / mL; the nucleotide sequence of the random sequence is shown in SEQ ID NO.8). Four weeks after AAV injection, a series of SCZ-related behavioral assessments were conducted, including OFT, EPM, TST, and FST to evaluate anxiety-like and depression-like behaviors in mice, NOR to evaluate cognitive function, and PPI to evaluate the endophenotype of SCZ, in order to observe what behavioral changes would be caused by decreased miR-0701 expression in mPFC.
[0250] Behavioral results show ( Figure 7 Compared to the control group, mice in the KD miR-0701 group showed no significant difference in spontaneous activity during OFT, but their dwell time in the central region was significantly reduced. In the EPM test, mice in the KD miR-0701 group showed significantly reduced dwell time in the open-arm position and significantly increased dwell time in the closed-arm position, suggesting anxiety-like behavior. In the TST and FST tests, mice in the KD miR-0701 group showed significantly increased immobility time, suggesting depression-like behavior. In conclusion, reduced miR-0701 expression in the mPFC causes anxiety and depression-like behaviors. In the NOR test, compared to the control group, mice in the KD miR-0701 group showed significantly reduced recognition index in both short-term and long-term tests, indicating that reduced miR-0701 expression in the mPFC causes cognitive impairment. In the PPI experiment, it was observed that, compared with the Control group mice, the KD miR-0701 group mice showed reduced PPI scores when given prestimulation of 70dB, 75dB and 80dB respectively, and when given stimulation of 110dB, which means they showed prepulse inhibition defects.
[0251] 2.8 Overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improves MK-801-induced schizophrenia-related behavioral abnormalities.
[0252] This study designed two additional derivative sequences (which do not exist in humans or mice) containing the core sequence "GAGGUAG" of miR-0701. AAVs overexpressing miR-0701, miR-0701a, and miR-0701b were constructed and injected into the mPFC of mice to observe the behavioral changes induced by overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC.
[0253] The derived sequences obtained were miR-0701a (UGAGGUAGGAGUUUGUUAAGUU, SEQ ID NO.2) and miR-0701b (CGAGGUAGUAGGUUGUGUGGUU, SEQ ID NO.3). AAVs overexpressing miR-0701, miR-0701a, and miR-0701b were recombinant AAVs carrying miR-0701, miR-0701a, and miR-0701b, respectively. All three recombinant AAVs were synthesized by Shanghai Heyuan Biotechnology Co., Ltd., with viral titers of 6.87E+12v.g / mL, 3.97E+12v.g / mL, and 8.21E+12v.g / mL, respectively.
[0254] This study used normal male C57BL / 6J mice as experimental animals. AAV overexpressing miR-0701, miR-0701a, and miR-0701b was injected into the mouse mPFC (stereolocalization: AP: +0.2cm, ML: ±0.04cm, DV: -0.22cm) via brain region injection, with an injection volume of 200 nL per side and an injection rate of 50 nL / min. After injection, the microsyringe was left in the target nucleus for 5 min to reduce AAV extravasation. The control group received an equal volume (200 nL per side, injection rate 50 nL / min) of AAV without any exogenous sequence as a blank control (AAV synthesized by Shanghai Heyuan Biotechnology Co., Ltd., titer 7.46E+12v.g / mL). Four weeks after AAV injection, mice injected with AAV-overexpressing mice and mice injected with control AAV were given MK-801 (1.0 mg / kg intraperitoneally, once daily for 14 days, 10 mL / kg) to induce SCZ in mice, establishing animal models of miR-0701 overexpression (OE miR-0701+MK-801 group), miR-0701a overexpression (OE miR-0701a+MK-801 group), miR-0701b overexpression (OE miR-0701b+MK-801 group), and a model control group (Control+MK-801 group). The blank control group (Control+saline group) used mice injected with control AAV as experimental animals and provided an equal volume of physiological saline as a control. Following drug administration, a series of SCZ-related behavioral assessments were conducted, including OFT, EPM, TST, and FST, to evaluate anxiety-like and depression-like behaviors in mice; NOR to evaluate cognitive function; and PPI to evaluate the endophenotype of SCZ, in order to observe what behavioral changes would result from overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC.
[0255] In the OFT experiment ( Figure 8Compared with the Control+saline group, mice in the Control+MK-801 group showed a significant increase in spontaneous activity (from 3506.27 cm to 4464.75 cm, an increase of 27.34%). Mice in the Control+MK-801 group with elevated expression of miR-0701, miR-0701a, and miR-0701b in the mPFC showed a significant decrease in spontaneous activity (from 4464.75 cm to 3683.01 cm, 3388.11 cm, and 3643.87 cm, respectively, a decrease of 17.51%, 24.11%, and 18.39%). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC can improve positive symptoms in SCZ mice, namely, improve abnormal activity (here, abnormal activity is manifested as increased spontaneous activity).
[0256] In the OFT experiment ( Figure 9 Compared with the Control+saline group, mice in the Control+MK-801 group spent significantly less time in the central region (from 8.07% to 2.15%, a reduction of 73.36%), indicating that the mice exhibited anxiety-like behavior. Mice in the control+MK-801 group with increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC spent significantly more time in the central region compared with the Control+MK-801 group (from 2.15% to 7.84%, 6.75%, and 7.36%, respectively, an increase of 264.65%, 213.95%, and 242.33%), indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improved anxiety-like behavior in SCZ mice.
[0257] In the EPM experiment ( Figure 9 Compared with the Control+saline group, the Control+MK-801 group mice exhibited a significantly shorter time spent in the open arm position (from 15.62% to 5.12%, a reduction of 67.22%), indicating that the mice also exhibited anxiety-like behavior. Compared with the Control+MK-801 group mice, the mice with increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC showed a significantly longer time spent in the open arm position (from 5.12% to 12.94%, 13.07%, and 14.55%, respectively, an increase of 152.73%, 155.27%, and 184.18%), indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improved anxiety-like behavior in SCZ mice.
[0258] In the TST experiment ( Figure 9 Compared with the Control+saline group, mice in the Control+MK-801 group showed a significantly prolonged immobility time during TST (from 121.76 s to 175.80 s, a 44.38% increase), indicating that the mice exhibited depressive-like behavior. Mice with elevated miR-0701, miR-0701a, and miR-0701b expression in the mPFC showed a significantly reduced immobility time compared with the Control+MK-801 group (from 175.80 s to 107.90 s, 113.80 s, and 111.24 s, respectively, representing reductions of 38.62%, 35.27%, and 36.72%). In the FST experiment (… Figure 9 Compared with the Control+saline group, mice in the Control+MK-801 group showed a significantly prolonged immobility time in the FST (from 137.12s to 201.63s, an increase of 47.05%), indicating that the mice exhibited depressive-like behavior. Mice with elevated miR-0701, miR-0701a, and miR-0701b expression in the mPFC showed a significantly reduced immobility time compared with the Control+MK-801 group (from 201.63s to 134.63s, 134.64s, and 150.25s, respectively, representing reductions of 33.23%, 33.23%, and 25.48%). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC has an antidepressant effect.
[0259] In summary, overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC can effectively alleviate both positive and negative symptoms in SCZ mice, namely abnormal activity, anxiety, and depression-like behavior.
[0260] In the NOR experiment ( Figure 10In short-term memory tests, mice in the Control+MK-801 group showed a significant decrease in recognition index compared to mice in the Control+saline group (from 57.39% to 34.94%, a decrease of 39.12%), indicating memory impairment. (OE miR-0701+MK-801, OE...) Compared with the Control+MK-801 group, mice in the miR-0701a+MK-801 and OEmiR-0701b+MK-801 groups showed a significant increase in recognition index (from 34.94% to 59.94%, 58.72%, and 56.93%, respectively, representing increases of 71.55%, 68.06%, and 62.94%). In long-term memory tests, mice in the Control+MK-801 group showed a significant decrease in recognition index compared with the Control+saline group (from 57.18% to 33.21%, a decrease of 41.92%), indicating memory impairment. The OE miR-0701+MK-801, OE miR-0701a+MK-801, and OE... Compared with the Control+MK-801 group, mice in the miR-0701b+MK-801 group showed a significant increase in recognition index (from 33.21% to 56.19%, 59.12%, and 54.40%, representing increases of 69.20%, 78.02%, and 63.81%, respectively). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improves cognitive dysfunction in SCZ mice.
[0261] In PPI testing ( Figure 11Under 70 dB prestimulation, mice in the Control+MK-801 group showed a significantly lower PPI score compared to the Control+saline group (from 27.98% to 5.18%, a decrease of 81.49%), indicating that the MK-801 group exhibited prepulse inhibition deficiency. The OE miR-0701+MK-801, OE miR-0701a+MK-801, and OE... Compared with the Control+MK-801 group, mice in the miR-0701b+MK-801 group showed a significant increase in PPI scores (from 5.18% to 36.26%, 32.19%, and 31.45%, representing increases of 600%, 521.43%, and 507.14%, respectively). Under 75 dB prestimulation, mice in the Control+MK-801 group showed a significant decrease in PPI scores compared with the Control+saline group (from 52.98% to 27.77%, a decrease of 47.58%), indicating that the MK-801 group exhibited a prepulse inhibition defect. The OE miR-0701+MK-801, OE miR-0701a+MK-801, and OE... Compared with the Control+MK-801 group, mice in the miR-0701b+MK-801 group showed a significant increase in PPI scores (from 27.77% to 60.06%, 55.17%, and 48.53%, representing increases of 116.28%, 98.67%, and 74.76%, respectively). Under 80 dB prestimulation, mice in the Control+MK-801 group showed a significant decrease in PPI scores compared with the Control+saline group (from 65.62% to 46.37%, a decrease of 29.34%), indicating that the MK-801 group exhibited a prepulse inhibition deficiency. (OE miR-0701+MK-801, OE) Compared with the Control+MK-801 group, mice in the miR-0701a+MK-801 and OEmiR-0701b+MK-801 groups showed significantly increased PPI scores (from 46.37% to 59.36%, 62.62%, and 61.03%, respectively, representing increases of 28.01%, 35.04%, and 31.62%). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improves prepulse inhibition deficiency in SCZ mice.
[0262] 2.9 Overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC improves ketamine-induced behavioral abnormalities associated with schizophrenia.
[0263] Based on 2.8, the SCZ-induced behavior in mice was replaced by ketamine (25.0 mg / kg intraperitoneally, once daily for 14 days, 10 mL / kg) instead of MK-801 (1.0 mg / kg intraperitoneally, once daily for 7 days, 10 mL / kg). Following administration, a series of SCZ-related behavioral assessments were conducted, including OFT, EPM, TST, and FST to evaluate anxiety-like and depression-like behaviors, NOR to assess cognitive function, and PPI to assess SCZ endophenotype, to observe the behavioral changes induced by overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC.
[0264] In the OFT experiment ( Figure 12 Compared with the Control+saline group, mice in the Control+ketamine group showed a significant decrease in spontaneous activity (from 5312.34 cm to 4156.7 cm, a decrease of 21.75%). Mice in the control+ketamine group with increased expression of miR-0701, miR-0701a, and miR-0701b in the mPFC showed increased spontaneous activity (from 4156.7 cm to 5355.88 cm, 5290.55 cm, and 5572.4 cm, respectively, an increase of 28.85%, 27.28%, and 34.06%). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC can improve the ketamine-induced activity abnormality in SCZ mice (here, the activity abnormality is manifested as a decrease in spontaneous activity).
[0265] In the OFT experiment ( Figure 13 Compared with the Control+saline group, mice in the Control+ketamine group spent significantly less time in the central region (from 14.05% to 5.95%, a reduction of 57.65%), indicating that the mice exhibited anxiety-like behavior. Compared with the Control+ketamine group, mice in the OE miR-0701+ketamine, OE miR-0701a+ketamine, and OE miR-0701b+ketamine groups spent significantly more time in the central region (from 5.95% to 12.74%, 15.18%, and 14.67%, respectively, an increase of 114.12%, 155.13%, and 146.55%), indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improved anxiety-like behavior in SCZ mice.
[0266] In the EPM experiment ( Figure 13 Compared with the Control+saline group, the Control+ketamine group mice showed a significantly shorter dwell time in the open arm (from 22.59% to 11.44%, a reduction of 49.36%), indicating that the mice also exhibited anxiety-like behavior. Compared with the Control+ketamine group mice, the OE miR-0701+ketamine, OE miR-0701a+ketamine, and OE miR-0701b+ketamine groups showed a significantly increased dwell time in the open arm (from 11.44% to 22.77%, 22.50%, and 22.46%, respectively, representing increases of 99.04%, 96.68%, and 96.33%), indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improved anxiety-like behavior in SCZ mice.
[0267] In the TST experiment ( Figure 13 Mice in the Control+ketamine group showed a significantly prolonged immobility time compared to the Control+saline group (from 101.21s to 165.41s, a 63.43% increase), indicating depressive-like behavior. Mice with elevated miR-0701, miR-0701a, and miR-0701b expression in the mPFC showed a significantly reduced immobility time compared to the Control+ketamine group (from 165.41s to 93.13s, 99.2s, and 97.56s, respectively, representing reductions of 43.70%, 40.03%, and 41.02%). In the FST experiment (… Figure 13 Compared with the Control+saline group, mice in the Control+ketamine group showed a significantly prolonged immobility time (from 134.48 s to 183.91 s, an increase of 36.76%), indicating that the mice exhibited depressive-like behavior. Mice in the mPFC with elevated expression of miR-0701, miR-0701a, and miR-0701b showed a significantly reduced immobility time compared with the Control+ketamine group (from 183.91 s to 132.92 s, 126.92 s, and 124.82 s, respectively, representing reductions of 27.73%, 30.99%, and 32.13%). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC has an antidepressant effect.
[0268] In summary, overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC can effectively alleviate both positive and negative symptoms in SCZ mice, namely abnormal activity, anxiety, and depression-like behavior.
[0269] In the NOR experiment ( Figure 14 In short-term memory tests, mice in the Control+ketamine group showed a significant decrease in recognition index compared to the Control+saline group (from 62.31% to 44.27%, a decrease of 28.95%), indicating memory impairment. Mice in the OE miR-0701+ketamine, OE miR-0701a+ketamine, and OE miR-0701b+ketamine groups showed a significant increase in recognition index compared to the Control+ketamine group (from 44.27% to 67.99%, 61.14%, and 60.98%, respectively, increases of 53.58%, 38.11%, and 37.75%). In long-term memory tests, mice in the Control+ketamine group showed a significant decrease in recognition index compared to the Control+saline group (from 62.74% to 43.92%, a decrease of 30%), indicating memory impairment. Compared with the Control+ketamine group, mice in the miR-0701a+ketamine and OE miR-0701b+ketamine groups showed a significant increase in recognition index (from 43.92% to 64.32%, 61.42%, and 60.78%, respectively, representing increases of 46.45%, 39.85%, and 38.39%). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improves cognitive dysfunction in SCZ mice.
[0270] In PPI testing ( Figure 15Under 70 dB prestimulation, mice in the Control+ketamine group showed a significantly lower PPI score compared to the Control+saline group (from 32.65% to 13.77%, a decrease of 57.83%), indicating that the Control+ketamine group exhibited prepulse inhibition deficiency. (OE miR-0701+ketamine, OE miR-0701a+ketamine, OE...) Compared with the Control+ketamine group, mice in the miR-0701b+ketamine group showed a significant increase in PPI scores (from 13.77% to 33.35%, 39.61%, and 31.98%, representing increases of 142.19%, 187.65%, and 132.24%, respectively). Under 75 dB prestimulation, mice in the Control+ketamine group showed a significant decrease in PPI scores compared with the Control+saline group (from 49.87% to 23.31%, a decrease of 53.26%), indicating that the Control+ketamine group exhibited a prepulse inhibition deficiency. (OE miR-0701+ketamine, OE miR-0701a+ketamine, OE...) Compared with the Control+ketamine group, mice in the miR-0701b+ketamine group showed a significant increase in PPI scores (from 23.31% to 50.38%, 44.92%, and 53.41%, representing increases of 116.13%, 92.71%, and 129.13%, respectively). Under 80 dB prestimulation, mice in the Control+ketamine group showed a significant decrease in PPI scores compared with the Control+saline group (from 65.86% to 41.92%, a decrease of 36.35%), indicating that the Control+ketamine group exhibited prepulse inhibition deficiency. (OE miR-0701+ketamine, OE miR-0701a+ketamine, OE...) Compared with the Control+ketamine group, mice in the miR-0701b+ketamine group showed a significant increase in PPI scores (from 41.92% to 59.69%, 65.29%, and 60.79%, representing increases of 42.39%, 55.75%, and 45.01%, respectively). This indicates that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC improves prepulse inhibition deficiency in SCZ mice.
[0271] 2.10. Overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC improves depressive-like behavior in mice under chronic stress restraint.
[0272] An animal model of depression was established using chronic restraint stress. Building upon the previous method (2.8), the SCZ of mice induced by MK-801 (1.0 mg / kg intraperitoneally, once daily for 14 days, 10 mL / kg) was replaced with MDD induced by chronic restraint stress. Following induction, a series of MDD-related behavioral assessments, including the sucrose preference index, TST, and FST, were used to evaluate the depressive-like behaviors of the mice, to observe the behavioral changes induced by overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC.
[0273] Overexpression of miR-0701: Gluten preference experiment ( Figure 16 Compared with the Control+Control group, the sucrose preference index of the Control+CRS group mice was significantly reduced (from 75% to 64.95%, a decrease of 13.4%). In the TST and FST experiments, the immobility time of the Control+CRS group mice was significantly increased compared with the Control+Control group mice (from 182.31 to 216.24, an increase of 18.61%). In the FST experiment, the immobility time of the Control+CRS group mice was significantly increased compared with the Control+Control group mice (from 126.59 to 162.79, an increase of 28.6%). This indicates that CRS successfully established a mouse model of depression. Compared with the Control+CRS group, the OE miR-0701+CRS mice showed a certain degree of increase in sucrose preference index (from 64.95% to 74.51%, an increase of 14.72%), a significant decrease in immobility time in TST (from 216.24 to 177.64, a decrease of 17.85%), and a significant decrease in immobility time in FST (from 162.79 to 122.16, a decrease of 24.96%). This indicates that increased miR-0701 expression in mPFC can improve CRS-induced depressive-like behavior, suggesting that miR-0701 has an antidepressant function.
[0274] Overexpression of miR-0701a: sucrose preference experiment ( Figure 16 ), Control+CRS group mice and
[0275] Compared with the Control+Control group, the sucrose preference index of mice was significantly reduced (from 82.74% to 61.34%, a decrease of 25.86%). In the TST experiment, the immobility time of mice in the Control+CRS group was significantly increased compared with the Control+Control group (from 231.08 to 328.59, an increase of 42.2%). In the FST experiment, the immobility time of mice in the Control+CRS group was significantly increased compared with the Control+Control group (from 51.88 to 92.10, an increase of 77.53%), indicating that CRS successfully established a mouse model of depression. Compared with the Control+CRS group, the OE miR-0701a+CRS mice showed a certain degree of increase in sucrose preference index (from 61.34% to 72.91%, an increase of 18.86%), a significant decrease in immobility time in TST (from 328.59 to 200.06, a decrease of 39.12%), and a significant decrease in immobility time in FST (from 92.10 to 34.43, a decrease of 62.62%). This indicates that increased miR-0701a expression in mPFC can improve CRS-induced depressive-like behavior, suggesting that miR-0701a has an antidepressant function.
[0276] Overexpression of miR-0701b: sucrose preference experiment ( Figure 16Compared with the Control+Control group, the sucrose preference index of the Control+CRS group mice was significantly reduced (from 89.73% to 82.63%, a decrease of 7.91%). In the TST experiment, the immobility time of the Control+CRS group mice was significantly increased compared with the Control+Control group mice (from 130.28 to 181.96, an increase of 39.67%). In the FST experiment, the immobility time of the Control+CRS group mice was significantly increased compared with the Control+Control group mice (from 132.18 to 192.61, an increase of 45.72%). This indicates that CRS successfully established a mouse model of depression. Compared with the Control+CRS group, the OE miR-0701b+CRS mice showed a certain degree of increase in sucrose preference index (from 82.63% to 89.49%, an increase of 8.3%), a significant decrease in immobility time during TST (from 181.96 to 115.52, a decrease of 36.51%), and a significant decrease in immobility time during FST (from 192.61 to 131.39, a decrease of 31.78%). This indicates that increased miR-0701b expression in the mPFC can improve CRS-induced depressive-like behavior, suggesting that miR-0701b has an antidepressant function.
[0277] 2.11 Overexpression of miR-0701, miR-0701a, and miR-0701b in mPFC did not induce schizophrenia-related behavioral abnormalities in normal mice.
[0278] Based on 2.8, MK-801 was not administered to induce SCZ in mice.
[0279] In OFT experiments ( Figure 17 Mice overexpressing miR-0701, miR-0701a, and miR-0701b in the mPFC showed no significant change in spontaneous activity compared to mice in the Control group, indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC does not affect the activity level of normal mice.
[0280] In the OFT experiment ( Figure 18 Mice overexpressing miR-0701, miR-0701a, and miR-0701b in the mPFC showed no significant difference in the time spent in the central region compared to mice in the control group, indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC does not induce anxiety-like behavior in normal mice.
[0281] EPM Experiment ( Figure 18Mice overexpressing miR-0701, miR-0701a, and miR-0701b in the mPFC showed no significant change in the duration of their open arm position compared to mice in the control group, indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC does not induce anxiety-like behavior in normal mice.
[0282] In the TST and FST experiments ( Figure 18 Mice overexpressing miR-0701, miR-0701a, and miR-0701b in the mPFC showed no significant change in immobility time during TST and FST compared to mice in the Control group, indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC does not induce depressive-like behavior in normal mice.
[0283] In the NOR experiment ( Figure 19 In both short-term and long-term memory tests, mice overexpressing miR-0701, miR-0701a, and miR-0701b in the mPFC showed no significant difference in recognition index compared to mice in the control group, indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC does not cause cognitive abnormalities in normal mice.
[0284] In PPI testing ( Figure 20 Regardless of whether the prestimulation was 70dB, 75dB, or 80dB, the PPI scores of mice overexpressing miR-0701, miR-0701a, and miR-0701b in the mPFC were not significantly different from those of the control group mice, indicating that overexpression of miR-0701, miR-0701a, and miR-0701b in the mPFC does not cause abnormal prepulse inhibition in normal mice.
[0285] 2.12. IL-6 is one of the target genes for nucleic acid molecules to function.
[0286] miRNAs bind to target gene mRNA molecules through partially complementary sequences, leading to mRNA degradation or inhibited translation. To investigate the target genes affected by the miR-0701, miR-0701a, and miR-0701b molecules with the "GAGGUAG" core fragment constructed in this study, the following screening was conducted, with the specific approach as follows:
[0287] (1) For the human brain transcriptome data of SCZ patients and healthy controls collected in the CMC database (including the brain bank and tissue bank of Mount Sinai Medical School, the brain bank of the University of Pennsylvania's Center for Mental Illness and Alzheimer's Disease, and the brain and tissue bank of the University of Pittsburgh Neurobiobank) and the HBCC database (including human brain samples provided by the National Institute of Mental Health), the intersection of two significant results (log2FC absolute value > 0 and P < 0.05) was obtained for each dataset using Deseq2 and edgeR analysis software, and then the common differentially expressed mRNAs of the two datasets were obtained.
[0288] (2) Online tools based on classic prediction algorithms (represented by miRabel) (see the literature "Quillet A, Saad C, Ferry G, et al. Improving Bioinformatics Prediction of microRNA Targets by Ranks Aggregation[J]. Frontiers in Genetics,2020,10.") predict the set of target genes of miR-0701.
[0289] (3) Online tools based on ML algorithms (represented by miRDB) (see the literature "Chen YH, Wang X W. miRDB: an online database for prediction of functional microRNA targets[J]. NucleicAcids Research,2020,48(D1):D127-D131.") predict the set of miR-0701 target genes.
[0290] (4) All StrongExperimental Evidence target genes of miR-0701 were obtained from the website http: / / www.rnainter.org, and then the results were combined with the Ago2-CLIP-seq experimental results to form an experimental verification target gene set 3.
[0291] (5) Take the intersection of the above 4 datasets, and there are a total of 63 mRNAs.
[0292] (6) For the transcriptome data of SCZ patients and healthy controls included in the LIBD database (including human brain samples provided by the Lieberman Institute for Brain Science at Johns Hopkins University), the Deseq2 and edgeR analysis software were used to obtain the common mRNAs of two significant results (log2FC absolute value > 0 and P < 0.05).
[0293] (7) Taking the intersection of the results of (5) and (6) again, only 4 mRNAs ("COL3A1", "HMGA2", "IGF2BP2" and "IL-6") were found, and only IL-6 was elevated in the PFC of the human brain of SCZ patients. miR-0701 was shown to be decreased in SCZ patients and schizophrenia-like mouse models. Based on the negative regulatory mechanism of miRNA and target genes, IL-6 can be considered as one of the target genes that miR-0701 participates in regulating SCZ. Figures 21-24 ).
[0294] Based on section 2.1, the expression of IL-6 in the peripheral blood of SCZ patients was further detected by qPCR. Figure 25 The results showed that IL-6 expression was elevated in the peripheral blood of SCZ patients and decreased after drug treatment. These results suggest that IL-6 may be one of the target genes of miR-0701. The qPCR detection process first used the trizol method to extract total RNA from the peripheral blood of SCZ patients before and after treatment, as well as healthy controls. Then, reverse transcription of the total RNA was performed (using EvoM-MLV reverse transcription reagent premix, kit model AG11706, purchased from Hunan Aikerui Biotechnology Co., Ltd.). Next, qPCR was used to detect IL-6 expression in the peripheral blood of SCZ patients before and after treatment (using GAPDH as an internal control, and the SYBR Green Pro Taq HS premixed qPCR kit, kit model AG11704, purchased from Hunan Aikerui Biotechnology Co., Ltd.). The nucleotide sequence of the upstream primer used for IL-6 is shown in SEQ ID NO.9, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10, and the nucleotide sequence of the upstream primer used for the internal control is shown in SEQ ID NO.10. As shown in NO.11, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12.
[0295] Based on 2.7 and 2.8, qPCR was used to further detect the expression of IL-6 in the mPFC of mice with suppressed miR-0701 and mice with overexpression of miR-0701. Figure 26The results showed that IL-6 expression significantly decreased in mouse mPFC when miR-0701 expression increased, and IL-6 expression increased when miR-0701 expression decreased, suggesting that IL-6 is one of the target molecules of miR-0701. The qPCR detection process involved first extracting total RNA from mouse mPFCs using the Trizol method, then performing reverse transcription of the total RNA (using Evo M-MLV reverse transcription reagent premix, kit model AG11706, purchased from Hunan Aikerui Biotechnology Co., Ltd.). IL-6 expression in mouse mPFCs was then detected by qPCR (using GAPDH as an internal control, using the SYBR GreenPro Taq HS premixed qPCR kit, kit model AG11704, purchased from Hunan Aikerui Biotechnology Co., Ltd.). The nucleotide sequence of the upstream primer used for IL-6 is shown in SEQ ID NO.13, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.14, and the nucleotide sequence of the upstream primer used for the internal control is shown in SEQ ID NO.14. As shown in NO15, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.16.
[0296] miR-0701a and miR-0701b were designed based on the core sequence "GAGGUAG". These two nucleic acid molecules share the same core sequence as the known miR-0701, such as... Figure 27 As shown in the figure, the study found that all three miRNAs can form complementary pairs with the 3' untranslated region (3'UTR) of IL-6. It is precisely because of this characteristic that these miRNAs can specifically regulate the expression of IL-6. Therefore, it is reasonable to infer that IL-6 is one of the target genes of these miRNAs with a common core sequence "GAGGUAG". This discovery not only reveals the similarity of the molecular-level mechanisms of action of non-coding RNAs containing core sequences, but also provides a molecular basis for explaining their potential roles in regulating inflammatory responses and immune function, and offers new insights for further research on their mechanisms of action in neuropsychiatric diseases. It should be noted that although IL-6 has been identified as a common target gene of these miRNAs containing core sequences, this does not preclude the possibility that they may have other specific target genes. Further research may reveal more roles and mechanisms of these non-coding RNAs in regulatory networks, thus providing more support for developing treatment strategies for neuropsychiatric diseases based on the core sequence "GAGGUAG".
[0297] 3. Experimental Conclusions
[0298] Analysis of a series of behavioral experiments revealed that overexpression of miR-0701, miR-0701a, and miR-0701b molecules containing the "GAGGUAG" core fragment in mouse mPFC significantly improved positive, negative, and cognitive impairment symptoms associated with schizophrenia. Specifically, this manifested as: improved prepulse inhibition disorder, a key indicator of schizophrenia; improved autonomic activity abnormalities, typically associated with positive symptoms of schizophrenia; reduced anxiety-like and depressive-like behaviors, usually associated with negative symptoms of schizophrenia; and significantly enhanced cognitive function. More importantly, in a mouse model of depression, these three miRNA molecules also exhibited significant antidepressant effects, substantially improving depressive-like behaviors. This finding further expands the potential therapeutic applications of these miRNA molecules. The comprehensive experimental results demonstrate that miRNA molecules containing the "GAGGUAG" core sequence not only show comprehensive improvement in the treatment of schizophrenia but also demonstrate ideal therapeutic potential in alleviating symptoms of other mental illnesses such as depression. This multi-target, multi-symptom improvement characteristic provides new ideas and potential targets for the development of drugs for mental illnesses, and may bring breakthrough progress to the field of clinical psychiatry.
[0299] In summary, miR-0701, miR-0701a, and miR-0701b molecules with the core fragment "GAGGUAG" have shown significant application prospects in the treatment and diagnosis of neuropsychiatric diseases. Their unique therapeutic effects, potential safety advantages, and high diagnostic accuracy make them ideal candidate molecules for developing novel therapeutic drugs and diagnostic products for neuropsychiatric diseases.
[0300] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A nucleic acid molecule for treating neuropsychiatric disorders, characterized in that, The nucleic acid molecule contains a core sequence of nucleotides, such as "GAGGUAG"; Alternatively, the nucleic acid molecule may contain a complementary sequence transcribed using the core sequence as a template; Alternatively, the nucleic acid molecule may be a derived sequence derived from the core sequence or complementary sequence, in which one or more nucleotides have been substituted, deleted, or added, while retaining the biological function of the source sequence.
2. The nucleic acid molecule as described in claim 1, characterized in that, The nucleic acid molecules treat neuropsychiatric disorders by regulating IL-6 transduction-related signaling pathways; the IL-6 transduction-related signaling pathways include classical signaling pathways and / or the sIL-6R / gp130-mediated JAK / STAT3 signaling pathway.
3. A recombinant expression system, characterized in that, The recombinant expression system expresses the nucleic acid molecule as described in claim 1 or 2.
4. The use of the nucleic acid molecule of claim 1 or 2 or the recombinant expression system of claim 3 in the preparation or screening of medicaments for the prevention and / or treatment of neuropsychiatric diseases.
5. A medicine for the prevention and / or treatment of neuropsychiatric disorders, characterized in that, The drug comprises the nucleic acid molecule of claim 1 or 2 or the recombinant expression system of claim 3.
6. A method for screening drugs for the prevention and / or treatment of neuropsychiatric disorders, characterized in that, The method includes the following steps: Step 1: Apply the compound to be screened together with the nucleic acid molecule described in claim 1 or 2 to a cell model or animal model; or, apply the compound to be screened together with the recombinant expression system described in claim 3 to a cell model or animal model. Step 2: Detect changes in indicators related to neuropsychiatric diseases in cell models or animal models; Step 3: Screen for drugs for the prevention and / or treatment of neuropsychiatric disorders based on changes in indicators.
7. A molecular marker for diagnosing neuropsychiatric disorders, characterized in that, The molecular markers include the nucleic acid molecules described in claim 1 or 2.
8. The use of a reagent for detecting the molecular markers of claim 7 in a test sample in the preparation of products for diagnosing neuropsychiatric diseases, or in the preparation of products for evaluating the treatment effects of neuropsychiatric diseases and / or monitoring the progression of neuropsychiatric diseases.
9. A product for diagnosing neuropsychiatric disorders, characterized in that, The product includes a reagent for detecting the molecular markers of claim 7 in a sample to be tested.
10. An evaluation model for diagnosing neuropsychiatric disorders, characterized in that, The evaluation model includes a detection module, a data analysis module, and an evaluation module; The detection module is used to detect the level of the molecular marker of claim 7 in the sample to be tested; The data analysis module is used to analyze the detection results output by the detection module and calculate the probability value of the disease. The assessment module is used to classify the test sample into a disease group or a healthy group based on the disease probability value output by the data analysis module.
11. An application system for the prevention, personalized treatment, and gene therapy of neuropsychiatric diseases, characterized in that, The application system includes a risk assessment module, a personalized treatment module, and a gene therapy module; The risk assessment module is used to identify high-risk individuals and formulate prevention strategies based on the levels of the molecular markers described in claim 7 in the patient's body. The personalized treatment module is used to determine drug sensitivity and develop personalized treatment plans based on the levels of the molecular markers described in claim 7 in the patient's body; The gene therapy module is used to design and implement gene therapy strategies based on the nucleic acid molecules described in claim 1 or 2.
12. A comprehensive platform for research and development related to neuropsychiatric diseases, characterized in that, The integrated platform includes an animal model module, a mechanism research module, a drug screening module, and an application development module. The animal model module is used to construct transgenic animals expressing the nucleic acid molecules of claim 1 or 2; The mechanism study module is used to evaluate the effects of the nucleic acid molecule described in claim 1 or 2 on nervous system function; The drug screening module is used to establish a screening system based on the nucleic acid molecules described in claim 1 or 2; The application development module is used to explore the applications of the nucleic acid molecules described in claim 1 or 2 in the fields of epigenetic regulation, functional food preparation, and artificial intelligence prediction.