A method for creating osnramp5 gene edited rice and a genotyping method
By making specific mutations in exons 6 and 8 of the rice OsNramp5 gene, combined with high-resolution melting curve analysis technology, the problems of cadmium and manganese absorption caused by OsNramp5 gene knockout were solved, and the creation of low-cadmium-accumulating rice and efficient genotyping were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
- Filing Date
- 2026-03-31
- Publication Date
- 2026-06-16
AI Technical Summary
How can we create a method to reduce cadmium absorption in rice while minimizing its impact on plant growth, address the problem of decreased manganese absorption capacity caused by OsNramp5 gene knockout, and provide a safe, simple, and rapid genotyping method?
We designed and constructed a dual-target gene editing vector for the OsNramp5 gene. By performing specific mutations in exons 6 and 8 of the rice OsNramp5 gene, combined with high-resolution melting curve analysis technology, we used specific primers to identify the genotype.
It significantly reduces the rice's ability to absorb cadmium, minimizes the impact on plant growth, provides new germplasm resources for low-cadmium-accumulating rice, and prevents contamination of germplasm materials through a simple genotyping identification method, thereby improving the resolution and efficiency of detection.
Smart Images
Figure CN122214366A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology breeding, specifically relating to a method of creation. OsNramp5 Gene edit Methods for rice cultivation and genotyping identification. Background Technology
[0002] Rice is a major food crop. In recent years, excessive cadmium levels in rice have been detected, drawing significant attention from researchers. Cadmium pollution not only hinders rice growth and development, leading to reduced yields, but more seriously, it causes cadmium to accumulate in large quantities in rice grains. Long-term consumption of rice with excessive cadmium levels poses a health hazard. While soil remediation to reduce cadmium pollution in arable land has been slow, developing new rice varieties with low cadmium accumulation is an effective technical means to reduce cadmium pollution in rice.
[0003] OsNramp5 The gene for Natural Resistance-Associated Macrophage Protein encodes a major transporter protein responsible for the uptake of manganese and cadmium by rice roots. It functions to absorb manganese and cadmium ions from the external environment into root cells and is a key gene involved in cadmium uptake by rice roots. OsNramp5 After gene knockout, the ability of rice roots to absorb cadmium from the soil decreased significantly, thereby reducing the cadmium content in rice grains. However, OsNramp5 Genes simultaneously regulate manganese uptake; blindly knocking them out... OsNramp5 Genes may lead to a significant reduction in the plant's manganese absorption capacity, affecting plant growth. Therefore, how to create new varieties that reduce cadmium absorption while minimizing the impact on rice production has become an urgent technical problem to be solved. Summary of the Invention
[0004] To solve the above-mentioned technical problems, this invention targets the regulation of cadmium absorption in rice. OsNramp5 A dual-target gene editing vector was designed and constructed using two gene editing targets on exons 6 and 8 of the gene. Genetic transformation was performed using the high-quality silky rice variety "19xiang" as the transformation material, yielding results... OsNramp5 Homozygous for a single-base insertion in the target region of exon 6 and a 20bp deletion in the target region of exon 8. OsNramp5 Gene-edited rice, OsNramp5 Specific mutations in gene-edited rice significantly reduce the plant's ability to absorb cadmium. Based on this, two pairs of primers were designed for genotyping based on this mutation result. This genotyping method is safer, simpler, and faster than traditional electrophoresis. This method can clearly distinguish the "single base insertion" mutation type, offering higher resolution than traditional electrophoresis and greater convenience than amplification sequencing. This method can be applied to... OsNramp5Genotyping of gene-edited rice-GM15 progeny materials helps prevent contamination of germplasm. Furthermore, if hybridization is needed to reduce cadmium uptake by utilizing GM15 mutations, this method can be used to identify the genotypes of subsequent segregating populations, aiding in selection.
[0005] On the one hand, the present invention provides a creative OsNramp5 A method for gene-editing rice, the method comprising the following steps:
[0006] Rice OsNramp5 Exons 6 and 8 of the gene were used as gene editing targets. A first sgRNA expression cassette targeting exon 6 and a second sgRNA expression cassette targeting exon 8 were designed and constructed, respectively. The target nucleotide sequence of exon 6 is shown in SEQ ID NO:1 and the target nucleotide sequence of exon 8 is shown in SEQ ID NO:2. The first and second sgRNA expression cassettes were introduced together into rice cells to... OsNramp5 Genes are edited using two targets; Filtering OsNramp5 Gene-edited rice with homozygous mutations, the aforementioned OsNramp5 The homozygous mutation is characterized by a single base insertion in the target region of exon 6 and a 20bp deletion in the target region of exon 8.
[0007] Furthermore, in the method, the first sgRNA expression cassette is driven by the OsU6a promoter, and its nucleotide sequence is shown in SEQ ID NO:15; the second sgRNA expression cassette is driven by the OsU6b promoter, and its nucleotide sequence is shown in SEQ ID NO:16.
[0008] Furthermore, in the method, the adapter primer sequences of the first sgRNA expression cassette are shown in SEQ ID NO:3 and SEQ ID NO:4; the adapter primer sequences of the second sgRNA expression cassette are shown in SEQ ID NO:5 and SEQ ID NO:6.
[0009] Furthermore, in the method described, the method of jointly introducing the first sgRNA expression cassette and the second sgRNA expression cassette into rice cells is as follows: the U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector carrying the first sgRNA expression cassette and the second sgRNA expression cassette is introduced into rice cells.
[0010] Also provides OsNramp5 The method for identifying the genotype of gene-edited rice includes the following steps: against OsNramp5 PCR amplification was performed using the first primer pair designed to target the 6th exon of the gene and / or the second primer pair designed to target the 8th exon. High-resolution melting curve analysis was performed on the PCR amplification products, and the genotype of the rice plant at the corresponding target site was determined based on the differences in melting peaks and / or melting curves.
[0011] Furthermore, in the identification method, the nucleotide sequences of the first primer pair are shown in SEQ ID NO:17 and SEQ ID NO:18; and the nucleotide sequences of the second primer pair are shown in SEQ ID NO:19 and SEQ ID NO:20.
[0012] Furthermore, in the identification method, the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:24.
[0013] Also provided is a method for identification OsNramp5 Primer compositions for gene-edited rice, including a first primer pair and / or a second primer pair; The first primer pair is used to amplify containing OsNramp5 The fragment of the target region of exon 6 of the gene, and the nucleotide sequences of the first primer pair are shown in SEQ ID NO:17 and SEQ ID NO:18; The second primer pair is used to amplify the fragment containing the target region of exon 8 of the OsNramp5 gene, and the nucleotide sequence of the second primer pair is shown in SEQ ID NO:19 and SEQ ID NO:20; The OsNramp5 Gene-edited rice OsNramp5 There is a single base insertion in the target region of exon 6 of the gene, and a 20bp fragment deletion in the target region of exon 8.
[0014] Furthermore, the primer composition described in this invention is also provided for the identification of... OsNramp5 Application of gene editing in rice genotyping, the application being based on high-resolution melting curve analysis technology, the... OsNramp5 Gene-edited rice for OsNramp5 There is a single base insertion in the target region of exon 6 of the gene, and a 20bp fragment deletion in the target region of exon 8.
[0015] It also provides a method for identification OsNramp5 A kit for gene editing rice genotypes, as described OsNramp5 Gene-edited rice is for... OsNramp5The gene has a single base insertion in the target region of exon 6 and a 20bp deletion in the target region of exon 8. The kit contains the primer composition described in this invention.
[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) This invention is aimed at OsNramp5 A dual-target editing system was designed for exons 6 and 8 of the gene to obtain a homozygous mutant GM15 with a single-base insertion in the exon 6 target region and a 20bp deletion in the exon 8 target region. Under cadmium treatment conditions, the cadmium content in both the aboveground and underground parts of this mutant was significantly lower than that of the wild-type control, indicating that this specific mutant combination can effectively reduce the cadmium uptake capacity of rice and provides a new germplasm resource for low-cadmium-accumulating rice.
[0017] (2) The present invention selects OsNramp5 Using exons 6 and 8 of the gene as targets differs from traditional complete knockout strategies. The GM15 mutant retains part of the gene sequence, avoiding the problems that may occur due to complete loss of gene function affecting normal plant growth. While reducing cadmium absorption, it also reduces the impact on normal plant growth, laying the foundation for breeding low-cadmium rice varieties with excellent comprehensive traits.
[0018] (3) This invention designs two pairs of specific primers (SEQ ID NO: 17-20) targeting two mutation types in the GM15 mutant, and establishes a rapid detection method for identifying this genotype by combining high-resolution melting curve analysis technology. This method can clearly distinguish single-base insertion mutation types and differentiate between homozygous, heterozygous, and wild-type mutations; it is simple to operate, requires closed-tube operation, does not require electrophoresis, and avoids cross-contamination; it is suitable for genotype screening of offspring materials in large-scale breeding; and it significantly reduces detection costs and time compared to traditional sequencing methods.
[0019] (4) The primer composition, kit and identification method provided by the present invention can be applied to the genotype tracking and detection of GM15 mutant and its derived offspring materials to prevent the mixing of germplasm materials. At the same time, if the GM15 mutant type is introduced into other superior rice varieties through hybridization, the identification method can be used to assist selection and accelerate the breeding process of low cadmium rice varieties. Attached Figure Description
[0020] Figure 1 For rice OsNramp5 A schematic diagram of gene structure and gene editing target design.
[0021] Figure 2 for OsNramp5 Analysis of target sequencing results of gene-edited rice GM15 single plant.
[0022] Figure 3 The image shows the cadmium content test results of the underground and aboveground parts of T2 generation GM15 hydroponic seedlings after cadmium treatment.
[0023] Figure 4 This is a screenshot of the user interface of the High Resolution Melting (HRM) analysis module of the Roche LightCycler® 96 Real-Time PCR instrument.
[0024] Figure 5 for OsNramp5 High-resolution melting (HRM) normalized melting peak diagram of gene target 1.
[0025] Figure 6 for OsNramp5 HRM-normalized melting curve of gene target 1.
[0026] Figure 7 for OsNramp5 High-resolution melting (HRM) normalized melting peak diagram of gene target 2.
[0027] Figure 8 for OsNramp5 HRM-normalized melting curve of gene target 2. Detailed Implementation
[0028] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.
[0029] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings. However, the embodiments described are not intended to limit the present invention.
[0030] Unless otherwise specified, the experimental and detection methods described in the following embodiments are conventional methods; unless otherwise specified, the reagents and materials are commercially available.
[0031] Example 1 This embodiment describes the construction of a dual-target gene editing vector.
[0032] 1.1 Identifying the target Obtain " from the EnsemblePlants website (https: / / plants.ensemble.org)" OsNramp5 "Gene sequence, the" OsNramp5 The gene sequence is shown in SEQ ID NO:25. Target screening was performed on the CRISPR-P v2.0 website (http: / / cbi.hzau.edu.cn / crispr). Rice OsNramp5The gene simultaneously regulates the uptake of manganese and cadmium. Complete loss of gene function affects the plant's absorption of manganese, thus impacting plant growth. To ensure that subsequent transgenic plants possess both low cadmium adsorption capacity and good agronomic traits, two target sites located in the middle of the gene coding region, on exons 6 and 8, were ultimately selected as gene editing targets. Target site 1 was named T1, and target site 2 was named T2. The nucleotide sequence of T1 is shown in SEQ ID NO:1, specifically: TCTTGGCCTCCAAAAATACGGGG; the nucleotide sequence of T2 is shown in SEQ ID NO:2, specifically: GGTGCTATCGAGGAAGACACCGG. Rice OsNramp5 A schematic diagram of gene editing targets is shown below. Figure 1 As shown.
[0033] Whole-genome BLAST results showed that both T1 and T2 targets had high specificity. Furthermore, sequencing of the T1 and T2 targets in the genetically transformed material "19xiang" revealed that the target location sequences were consistent with those in the database.
[0034] 1.2 Target Connector Design There are two target sites, and the sgRNAs are driven by the OsU6a and OsU6b promoters, respectively. According to the target adapter design rules, the primer information for the two target adapters is shown in Table 1.
[0035] Table 1. Target-Link Primer Information
[0036] 1.3 Construction of sgRNA expression cassette Overlapping PCR was used to amplify expression cassette fragments corresponding to different target sites using pYLgRNA-OsU6a and pYLgRNA-OsU6b plasmids as templates and universal primers and corresponding target adapter primers. The universal primers were UF and gR-R, and their sequence information is as follows: UF (SEQ ID NO:7): CTCCGTTTTACCTGTGGAATCG; gR-R (SEQ ID NO:8): CGGAGGAAAATTCCATCCAC.
[0037] Using the fragment product as a template, the corresponding Golden Gate primers were added to perform a second round of PCR to obtain the sgRNA expression cassettes U6a-T1-sgRNA and U6b-T2-sgRNA. The nucleotide sequence of the U6a-T1-sgRNA expression cassette is shown in SEQ ID NO:15, and the nucleotide sequence of the U6b-T2-sgRNA is shown in SEQ ID NO:16.
[0038] The specific nucleotide sequence of the U6a-T1-sgRNA expression cassette is as follows: TTCAAGGTCTTCCTCGACTAGTATGGAATCGGCAGCAAAGGATTTTTTCCTGTAGTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCA ATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATTCGTCAGGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGA ATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAAC TGGACTGCCTTATATGCGCGGGTGCTGGCTTGGCTGCCGTCTTGGCCTCCAAAAATACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTT GGAGTGGATGGACCCTGACGAGACCCACGCT.
[0039] The specific nucleotide sequence of the U6b-T2-sgRNA expression cassette is as follows: TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGGATGCAAGAACGAACTAAGCCGGACAAAAAAAAAAGGAGCACATATACAAACCGGTTTTATTCATGAATGGTCACGATGGATGATGGGGCTCAGACTTGAGCTACGAGGCCGCAGGCGAGAGAAGCCTAGTGTGCTCTCTGCTTGTTTGGGCCGTAACGGAGGATACGGCCGACGAGCGTGTACTACCGCGCGGGATGCCGCTGGGCGCTGCGGGGGCCGTTGGATGGGGATCGGTGGGTCGCGGGAGCGTTGAGGGGAGACAGGTTTAGTACCACCTCGCCTACCGAACAATGAAGAACCCACCTTATAACCCCGCGCGCTGCCGCTTGTGTTGGTGCTATCGAGGAAGACACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGATACGCGTCGGTCGAGACCCACGCT。
[0040] The specific Golden Gate primer information is as follows: U6a-T1-sgRNA expression cassette: Pps-GGL (SEQ ID NO:9): TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGCAGCAAAGG; Pgs-GG2 (SEQ ID NO:10): AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC.
[0041] U6b-T2-sgRNA expression cassette: Pps-GG2 (SEQ ID NO:11): TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG; Pgs-GGR (SEQ ID NO:12): AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC.
[0042] 1.4 Assemble the expression cassette into the pYLCRISPR / Cas9 vector The Golden Gate cloning method was used, with variable-temperature cycling for enzyme digestion and ligation (diet-ligation-as-you-go) to ligate the constructed sgRNA expression cassette into the pYLCRISPR / Cas9 vector. The reaction system is shown in Table 2 below.
[0043] Table 2 Reaction System
[0044] After gently mixing the prepared reaction system, briefly centrifuge to concentrate the liquid at the bottom of the tube, and then place it in a PCR instrument for enzyme digestion and ligation reaction to obtain the U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector.
[0045] 1.5 Conversion of Linkage Products The U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector was transformed into competent E. coli cells using a chemical heat shock method. The transformation product was then plated onto LB plates containing 25 μg / ml Kan and cultured at 37°C to obtain single clones.
[0046] 1.6 Sequencing Detection Single clones grown on the plate were picked, cultured, and the bacterial culture was collected and sent to a sequencing company for sequencing. Sequencing was performed using the sequencing flanking primers (PB-L and PB-R) on the pYLCRISPR / Cas9 vector. Sequencing results were compared and analyzed to select clones with correct insertion of the target fragment and no base mutations, thus obtaining U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 positive clones. Expressing U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 positive clones yielded sufficient quantities of the U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector for creation. OsNramp5 Gene-edited rice. The primer information for PB-L and PB-R is as follows: PB-L (SEQ ID NO:13): GCGCGCGGTCTCGCCTCGACTAGTATGG; PB-R (SEQ ID NO: 14): GCGCGCGGTCTCTACCGACGCGTATCC.
[0047] Example 2 This embodiment is a creation. OsNramp5 Gene-edited rice.
[0048] Using the high-quality high-quality rice variety "19xiang" as the genetic transformation material, Wuhan Boyuan Biotechnology Co., Ltd. was commissioned to carry out the genetic transformation work. The vector used for genetic transformation was the U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector. This vector carries sgRNA expression elements designed for the rice OsNramp5 gene. Among them, the T1-sgRNA in the U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector targets the T1 target site of the OsNramp5 gene, and the T2-sgRNA in the vector targets the T2 target site of the OsNramp5 gene. The dual-site editing of the OsNramp5 gene was achieved through the CRISPR / Cas9 system. The U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector was introduced into callus tissue of '19xiang' rice. After Agrobacterium-mediated genetic transformation, selection culture, and induction of regenerated plants, the T0 generation was obtained. OsNramp5 Gene-edited rice. T0 generation. OsNramp5 Gene-edited rice varieties up to generation T1 OsNramp5 When gene-editing rice, the T1 generation is targeted at different individual plants. OsNramp5 Sequencing analysis was performed on the target sites (T1 and T2) of the gene-edited rice genome. Sequencing of the two target site sequences in different individual plants yielded a homozygous two-site mutant plant, designated GM15. Figure 2 As shown, in target site 1, the sequencing sequence of the GM15 single plant is highly consistent with the wild-type original sequence, with only a single base insertion at the location marked in red, indicating a single base insertion at target site 1. At target site 2, marked in blue, there is a 20bp deletion. These sequencing results indicate that... OsNramp5 Successful dual-target gene editing OsNramp5 Gene-edited rice - GM15 (GM15 for short).
[0049] Example 3 This embodiment is OsNramp5 Experiment on cadmium absorption in hydroponic culture of gene-edited rice seedlings-GM15.
[0050] The results obtained in Example 2 OsNramp5T2 generation plants (T2-GM15) from the seeds of gene-edited rice-GM15 and the control variety "19xiang" were sown separately in the same hydroponic container and cultured in a light incubator (light intensity 20000 lx, light duration 12 hours, temperature 30℃ during light and 28℃ during darkness). After the seedlings reached the three-leaf stage, they were cultured in a rice-specific complete nutrient solution for one week. Then, CdCl2 solution was added to the nutrient solution to a final concentration of 2 ppm, and the pH was adjusted to 5.6. After one week of treatment, the plants were rinsed with deionized water, and the aboveground and underground parts were collected separately, dried, and the cadmium content in the samples was tested. The test results are as follows: Figure 3 As shown, the cadmium content in both the aboveground and underground parts of the T2 generation of GM15 plants was significantly lower than that of the control '19xiang'. This indicates that the cadmium content in the GM15 plants was significantly lower than that in the aboveground and underground parts. OsNramp5 The specific type of gene mutation can significantly reduce its ability to absorb cadmium. Furthermore, OsNramp5 Gene-edited rice GM15 showed the same growth pattern as the control rice '19xiang'.
[0051] Example 4 This embodiment is for establishing OsNramp5 Methods for identifying the genotype of gene-edited rice GM15.
[0052] 4.1 Primer Design Given OsNramp5 Gene-edited rice GM15 (GM15) reduces cadmium uptake. Two primer pairs were designed for this haplotype and based on HRM (High Resolution Melting Analysis) genotyping analysis for genotype identification. Primer GMT-1 targets the T1 target, and primer GMT-2 targets the T2 target. Primer sequences are as follows: GMT-1-F (SEQ ID NO:17): TGCTTCTTGGCCTCCAAAA; GMT-1-R (SEQ ID NO:18): CTTACAAAAAATAATTTATACCCCG; GMT-2-F (SEQ ID NO:19): GCAGCCACAATCTGTTCTTGC; GMT-2-R (SEQ ID NO:20): CAGGCTGAATATAGCTACCTTGAT.
[0053] 4.2 DNA Extraction The experiment used the TPS method to extract total DNA from rice plants. The specific steps are as follows: S1. Cut an appropriate amount of rice leaves into a 2ml centrifuge tube, add a 4mm diameter steel ball and 500mL of TPS extraction buffer. S2. Use a high-throughput tissue homogenizer, 60Hz, for 40s; Incubate at 65℃ for about 1 hour, shaking the centrifuge tube every 20 minutes during this period. S4, centrifuge at 12000 rpm for 10 min, and transfer 200 μL of supernatant to a new 1.5 mL centrifuge tube; S5. Add 400 μL of frozen anhydrous ethanol to the centrifuge tube containing the supernatant. Centrifuge at 12000 rpm for 5 minutes, discard the supernatant, and air dry in an open container; S7. After drying, add 200μLddH2O to dissolve, and the total DNA of the rice plant is obtained.
[0054] 4.3 PCR Amplification PCR was performed on a real-time PCR plate. Each PCR reaction system had a total volume of 10 μL, specifically including: 3 μL DNA template; 5.175 μL ddH2O; 1 μL 10× Buffer; 0.2 μL F primer (10 μM); 0.2 μL R primer (10 μM); 0.2 μL dNTPs; 0.125 μL 20× Evagreen; and 0.1 μL Taq enzyme. The PCR reaction employed a two-step amplification method: pre-denaturation at 94℃ for 2 min; and cyclic amplification: denaturation at 94℃ for 10 s, followed by annealing and extension at 55℃ for 30 s. This denaturation-annealing extension cycle was repeated for a total of 40 cycles.
[0055] PCR amplification was performed using different primers for both non-mutant and GM15 mutant samples, and the resulting product sequences are as follows: GMT-1 primer amplification product sequence: GMT-1 (non-mutant) (SEQ ID NO:21): TGCTTCTTGGCCTCCAAAAATACGGGGTATAAATTATTTTTTGTAAG.
[0056] GMT-1 (T2-GM15 mutant) (SEQ ID NO:22): TGCTTCTTGGCCTCCAAAAAATACGGGGTATAAATTATTTTTTGTAAG.
[0057] GMT-2 primer amplification product sequence: GMT-2 (non-mutant) (SEQ ID NO:23): TGCCTTGGTGCTATCGAGGAAGACACCGGCATCAGTCAGAGGAATCAAGGTAGCTATATTCAGCCTG.
[0058] GMT-2 (T2-GM15 mutant) (SEQ ID NO:24): TGCCTTGGTGCTATCGAGGAAGAATCAAGGTAGCTATATTCAGCCTG.
[0059] 4.4 HRM Testing Differences in product size or base composition can cause variations in their Tm values, which can be reflected by high-resolution melting curves for genotyping. The obtained PCR products were placed in a Roche LightCycler 96 real-time PCR instrument. The program was set as follows: Step 1, 94℃, 10s, no acquisition mode; Step 2, 65℃, 10s, no acquisition mode; Step 3, 92℃, 1s, continuous acquisition mode, acquiring fluorescence data 15 times every 1℃ increase in temperature. The results were opened using LightCycler96 SW 1.1, as shown below. Figure 4 As shown, create a new analysis and select the High Resolution Melting option.
[0060] 4.5 Analysis of Test Results The templates of three types—non-mutant, GM15 mutant, and heterozygous—were analyzed, and the results are as follows: For target point 1, such as Figure 5 As shown in the standardized melting peak diagram, the peak positions of the products amplified from the non-mutated template are not significantly different from those of the products amplified from the T2-GM15 mutant template, while the peaks of the products amplified from the heterozygous template show double peaks.
[0061] Depend on Figure 6 As can be seen, in the standardized melting curve diagram, the inflection points of the melting curves corresponding to the three are slightly different, which can be distinguished well.
[0062] For target 2, there is a 20bp size difference between the unmutated template product and the T2-GM15 mutant template product, such as Figure 7 As shown in the standardized melting peak diagram, the corresponding peaks of the two are far apart. Meanwhile, the peak diagram of the heterozygous genotype product shows a double peak.
[0063] Depend on Figure 8 It can be seen that the non-mutated, mutant, and heterozygous types can be well distinguished in the standard melting curve diagram.
[0064] Based on the above detection results, the two primer pairs designed according to the target site location can effectively distinguish between three genotypes at the two target sites: non-mutated, T2-GM15 mutant, and heterozygous. This is a co-dominant molecular marker. This marker, combined with the HRM detection method, is safer, simpler, and faster than traditional electrophoresis. It can also clearly distinguish the "single base insertion" mutation type, offering higher resolution than traditional electrophoresis and being more convenient than amplification sequencing. These two primer pairs can be used for genotype detection of GM15 progeny materials to prevent material contamination. Furthermore, if it is necessary to reduce the cadmium uptake capacity of plants using the GM15 mutation type through hybridization, these two primer pairs can be used to identify the genotype of the subsequent segregating population to assist in selection.
[0065] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.
Claims
1. A creation OsNramp5 The method for gene-editing rice is characterized by, The method includes the following steps: Rice OsNramp5 Exons 6 and 8 of the gene were used as gene editing targets. A first sgRNA expression cassette targeting exon 6 and a second sgRNA expression cassette targeting exon 8 were designed and constructed, respectively. The target nucleotide sequence of exon 6 is shown in SEQ ID NO:1, and the target nucleotide sequence of exon 8 is shown in SEQ ID NO:
2. The first and second sgRNA expression cassettes were introduced together into rice cells to... OsNramp5 Genes are edited using two targets; Filtering OsNramp5 Gene-edited rice with homozygous mutations, the aforementioned OsNramp5 The homozygous mutation is characterized by a single base insertion in the target region of exon 6 and a 20bp deletion in the target region of exon 8.
2. The method according to claim 1, characterized in that, The first sgRNA expression cassette is driven by the OsU6a promoter, and its nucleotide sequence is shown in SEQ ID NO:15; the second sgRNA expression cassette is driven by the OsU6b promoter, and its nucleotide sequence is shown in SEQ ID NO:
16.
3. The method according to claim 2, characterized in that, The adapter primer sequences of the first sgRNA expression cassette are shown in SEQ ID NO:3 and SEQ ID NO:4; the adapter primer sequences of the second sgRNA expression cassette are shown in SEQ ID NO:5 and SEQ ID NO:
6.
4. The method according to claim 1, characterized in that, The method for introducing the first sgRNA expression cassette and the second sgRNA expression cassette into rice cells is as follows: the U6a-T1-sgRNA-U6b-T2-sgRNA-pYLCRISPR / Cas9 vector carrying the first sgRNA expression cassette and the second sgRNA expression cassette is introduced into rice cells.
5. A kind OsNramp5 A method for identifying the genotype of gene-edited rice, characterized in that, Includes the following steps: against OsNramp5 PCR amplification was performed using the first primer pair designed to target the 6th exon of the gene and / or the second primer pair designed to target the 8th exon. High-resolution melting curve analysis was performed on the PCR amplification products, and the genotype of the rice plant at the corresponding target site was determined based on the differences in melting peaks and / or melting curves.
6. The identification method according to claim 5, characterized in that, The nucleotide sequences of the first primer pair are shown in SEQ ID NO:17 and SEQ ID NO:18; the nucleotide sequences of the second primer pair are shown in SEQ ID NO:19 and SEQ ID NO:
20.
7. The identification method according to claim 5, characterized in that, The nucleotide sequences of the PCR amplification products are shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:
24.
8. A method for identification OsNramp5 The primer composition for gene-edited rice is characterized by, Including the first primer pair and / or the second primer pair; The first primer pair is used to amplify containing OsNramp5 The fragment of the target region of exon 6 of the gene, and the nucleotide sequences of the first primer pair are shown in SEQ ID NO:17 and SEQ ID NO:18; The second primer pair is used to amplify the fragment containing the target region of exon 8 of the OsNramp5 gene, and the nucleotide sequence of the second primer pair is shown in SEQ ID NO:19 and SEQ ID NO:20; The OsNramp5 Gene-edited rice OsNramp5 There is a single base insertion in the target region of exon 6 of the gene, and a 20bp fragment deletion in the target region of exon 8.
9. The primer composition of claim 8 in the identification OsNramp5 The application of gene editing in rice genotypes is characterized by, The application is based on high-resolution melting curve analysis technology. OsNramp5 Gene-edited rice for OsNramp5 There is a single base insertion in the target region of exon 6 of the gene, and a 20bp fragment deletion in the target region of exon 8.
10. A method for identification OsNramp5 A kit for gene editing rice genotypes, characterized in that, The OsNramp5 Gene-edited rice is for... OsNramp5 The gene has a single base insertion in the target region of exon 6 and a 20bp deletion in the target region of exon 8. The kit contains the primer composition of claim 8.