A set of molecular markers, kit and application for screening high temperature tolerant largemouth bass
By using gradient heating lethal accumulated temperature method and genome resequencing analysis, SNP markers significantly associated with heat tolerance of largemouth bass were identified. Specific primers were designed and a detection kit was constructed, which solved the problem of inaccurate screening of heat-tolerant largemouth bass individuals in the existing technology and realized efficient and low-cost molecular marker-assisted breeding.
Patent Information
- Application Number
- CN202610654769.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-13
- Publication Date
- 2026-06-16
AI Technical Summary
Existing technologies cannot accurately screen out largemouth bass individuals that are heat-resistant under actual high-temperature conditions, and molecular marker identification methods are not applicable to different populations, resulting in low breeding efficiency.
A largemouth bass population was treated using a gradient temperature increase lethal accumulated temperature method. Through genome resequencing and genome-wide association analysis, SNP markers significantly associated with heat tolerance were identified. Specific primers were designed and a detection kit was constructed. Next-generation sequencing was used for detection.
With high accuracy, high throughput, and low cost, it can effectively screen for heat-resistant largemouth bass individuals, shorten the breeding cycle, and improve selection reliability.
Smart Images

Figure CN122214508A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomolecular marker detection technology, and in particular relates to a set of molecular markers, reagent kits and applications for screening heat-resistant largemouth bass. Background Technology
[0002] Largemouth bass ( Micropterus salmoides Largemouth bass, commonly known as California bass, belongs to the order Perciformes, family Solariidae, and genus Perciformes. Native to the Mississippi River system in California, USA, it is highly prized for its rapid growth, tender flesh, and lack of intramuscular bones. Since its introduction to my country in the 1980s, years of research have overcome technical challenges in artificial breeding, large-scale seedling cultivation, and formulated feed, leading to a year-on-year increase in its aquaculture area and yield. Currently, largemouth bass is farmed throughout China and has become one of the major freshwater aquaculture species, holding significant economic importance. According to data from the "2025 China Fisheries Statistical Yearbook," the national aquaculture yield of largemouth bass in 2024 was 938,500 tons.
[0003] While largemouth bass possesses many excellent traits, it also suffers from heat intolerance. Its optimal growth temperature is 26-29℃; temperatures above 33℃ cause heat stress, leading to stunted growth and reduced immune function and disease resistance. With the increasing frequency of extreme heat events due to global warming, summer temperatures in southern my country have consistently exceeded 35℃, resulting in mass deaths of largemouth bass due to heat stress and the suppression of immune function, leading to disease outbreaks and significant losses. To promote the healthy development of aquaculture and improve farming efficiency, there is an urgent need to cultivate new heat-resistant varieties of largemouth bass.
[0004] Conventional fish breeding methods require multiple generations of continuous screening to fix the target trait in the population, which is time-consuming and labor-intensive. For example, a method for breeding heat-resistant largemouth bass described in Chinese invention patent (publication date 2023.01.03, publication number CN115553233A) involves large-scale population selection, gene sequencing, F1 generation breeding and selection grouping and gene homozygosity determination, establishing F1 populations, breeding F2 generation and conducting population selection, breeding F3 generation and verifying heat resistance; using a combination of population selection and gene selection, three generations were bred to produce largemouth bass with fast growth and heat resistance. Molecular marker-assisted breeding, on the other hand, indirectly selects by screening molecular markers associated with the target trait, overcoming the limitations of traditional phenotypic screening, helping to shorten the breeding cycle and improve selection reliability, especially for complex traits. However, to conduct molecular marker-assisted heat-resistant selection breeding of largemouth bass and improve breeding efficiency, reliable molecular markers must first be obtained.
[0005] To identify heat tolerance molecular markers in largemouth bass, it is essential to accurately assess the individual's heat tolerance and perform correlation analysis between quantitative indicators of heat tolerance and molecular markers such as SNPs. Heat tolerance in fish is a quantitative trait controlled by multiple genes with minor effects, involving complex genetic regulation mechanisms. It is also influenced by factors such as individual heat experience, developmental stage, nutritional status, and heat treatment methods. Applying the same method to different experimental fish populations, or applying different methods to the same experimental fish population, will yield different results. Furthermore, molecular markers are affected by the population's genetic background; markers identified in a specific experimental fish population may not be applicable to other populations. Therefore, treatment under heat conditions closely resembling those used in aquaculture and repeated validation are necessary to obtain reliable molecular markers suitable for breeding new heat-tolerant largemouth bass varieties.
[0006] However, existing technologies cannot meet the above requirements. For example, the technology disclosed in Chinese invention patent (publication date 2024.11.08, publication number CN118910289A) involves "placing largemouth bass individuals in water at a temperature of 25 ℃. Gradually increasing the water temperature by 1 ℃ per hour until the temperature reaches 37.8 ℃, recording the time (CTMax) during which each fish loses its balance. Based on the time to withstand high temperatures, the individuals are divided into two groups: heat-resistant (t ≥ 360 min) and heat-intolerant (t ≤ 200 min)." This technology screens for heat-resistant and heat-intolerant largemouth bass individuals through acute high-temperature exposure. The treatment conditions are very different from the slow temperature rise and fluctuations in aquaculture production, and cannot guarantee that the screened heat-resistant individuals will also be more heat-resistant in actual aquaculture. Furthermore, the description of the marker identification method for this technology states that "the applicant performed genome resequencing analysis on the heat-resistant group (t ≥ 360 min) and the heat-intolerant group (t ≤ 200 min), and developed a specific primer P1," without disclosing the analytical method for identifying heat-resistant molecular markers from genome resequencing data. Crucially, testing revealed that this technology cannot distinguish between heat-resistant and heat-intolerant largemouth bass individuals screened through gradient high-temperature exposure and lethal accumulated temperature methods. Summary of the Invention
[0007] To address the aforementioned problems in existing technologies, this invention provides a novel molecular marker and reagent kit for screening heat-resistant largemouth bass. This molecular marker and reagent kit offers high accuracy, high throughput, and low cost, and has significant application value in the field of molecular marker-assisted breeding of heat-resistant new varieties of largemouth bass.
[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One objective of this invention is to provide a molecular marker related to the heat tolerance of largemouth bass, wherein the sequence of the molecular marker is shown as any one or more of SEQ ID NO.59-SEQ ID NO.62.
[0009] A second objective of this invention is to provide a primer combination for detecting the molecular marker, the sequence of which is shown in SEQ ID NO.23-SEQ ID NO.58.
[0010] A third objective of this invention is to provide a product for screening, detecting, or identifying heat-resistant largemouth bass, wherein the product contains the primer combination.
[0011] Furthermore, the product includes a reagent kit.
[0012] The fourth objective of this invention is to provide the application of the aforementioned molecular markers in constructing a genetic map of heat tolerance in largemouth bass.
[0013] The fifth objective of this invention is to provide a method for screening the aforementioned molecular markers, comprising the following steps: treating a largemouth bass population with a gradient heating lethal accumulated temperature method, and identifying SNP markers that are significantly associated with heat tolerance through genome resequencing and genome-wide association analysis, wherein the molecular marker with the highest significance level in each cluster is the aforementioned molecular marker.
[0014] The sixth objective of this invention is to provide a method for screening, detecting, or identifying heat-resistant largemouth bass, comprising the following steps: using the primer combination or the kit to detect the molecular markers in largemouth bass, and screening heat-resistant largemouth bass individuals based on the detection results.
[0015] Furthermore, the detection is a genotyping test.
[0016] The seventh objective of this invention is to provide the application of the molecular marker, the primer combination, or the product in the screening, detection, or identification of heat-resistant largemouth bass.
[0017] Furthermore, the application includes its use in the breeding of new heat-resistant largemouth bass varieties.
[0018] Compared with the prior art, the present invention has the following beneficial effects: This invention exposes four batches of largemouth bass to gradient high temperatures as reported in the literature (Animals, 2025, 15(2): 128), and calculates the lethal accumulated temperature (LCT) for each individual. For each population, individuals with the highest LCT values (high-temperature tolerant) and the lowest LCT values (high-temperature intolerant) are selected, with 96 individuals being high-temperature intolerant and 105 individuals being high-temperature tolerant. Genome resequencing analysis is performed, yielding 1,808,294 SNPs. After in-population Z-score normalization of the LCT data, all data are merged and genome-wide association analysis (GWAS) is performed, identifying 14 SNPs significantly associated with the high-temperature tolerance trait in largemouth bass. p <10 -5 These heat-resistant SNP markers are clustered and located on four chromosomes, with markers on the same chromosome being tightly linked. Using the most significant marker in each cluster as a representative, specific primers were designed and screened. Barcodes and next-generation sequencing adapter sequences were added to the 5' end of the primers to distinguish samples, thus developing a detection kit for heat-resistant molecular markers. Next-generation sequencing was used to detect unknown samples; each sequencing library contained 20 samples, and four markers were detected simultaneously. The constructed libraries were sequenced, with read lengths of 150 bp at both ends. After quality control analysis and preprocessing, the sequencing data were compared with the reference genome sequence of largemouth bass. The alignment results were used for genotyping and SNP identification using GATK software. Compared with genome resequencing data, the technology of this invention showed good accuracy, high throughput, and low cost, and can be applied to the breeding of new heat-resistant varieties of largemouth bass with molecular marker assistance. Attached Figure Description
[0019] Figure 1 These are the heat tolerance phenotypic data for largemouth bass in this invention. (A) LCT values from four experiments. (B) LCT values of heat-sensitive and heat-tolerant individuals in different experiments. (C) Z-score values after normalization of LCT values. (D) Z-score values of heat-sensitive and heat-tolerant individuals in different experiments. "express p <0.05.
[0020] Figure 2 The distribution of SNPs in the chromosome (A) and different genomic functional regions of the largemouth bass in this invention is shown in Figure (B).
[0021] Figure 3The following are the population structure and genetic correlations of the samples in this invention. (A) Phylogenetic tree. Samples are color-coded by experimental group. (B) Heatmap of kinship among samples. (C) Principal component analysis (PCA) results. The legend includes experimental number (1-4) and sample phenotype (S, sensitive group; R, tolerant group). (D) Relationship between cross-validation error and ancestral population size (K value). (E) Population structure with K values of 1-5.
[0022] Figure 4 This is a QQ plot showing the different combinations of phenotypic types and analytical models in this invention. (A) Sensitive / Tolerant (Qualitative Trait) phenotype + GLM. (B) Z-score (Quantitative Trait) + GLM. (C) Sensitive / Tolerant (Qualitative Trait) phenotype + LMM. (D) Z-score (Quantitative Trait) + LMM. Blue dots represent SNPs, and red dashed lines represent observed and expected values minus log. 10 (p) are equal, and the blue shaded area represents the 95% confidence interval.
[0023] Figure 5 These are the SNPs that are significantly associated with the heat tolerance trait of largemouth bass in this invention. The horizontal axis represents the chromosome number, and the red solid line represents the significance threshold (…). p <10 -5 ).
[0024] Figure 6 This is the result of the chain imbalance decay analysis in this invention. The blue dashed line represents the decay distance and the corresponding r. 2 value.
[0025] Figure 7 This figure shows the expression of heat-resistance-related genes in the brain and liver of normal and moribund largemouth bass after high-temperature treatment. Error bars represent standard deviation (n = 4). "express p <0.05, "express p <0.01.
[0026] Figure 8 This is an electrophoresis image of the amplified fragment of the heat-resistant molecular marker for largemouth bass in this invention. HRAS#1, HRAS#2, HRAS#3 and HRAS#13: heat-resistant molecular markers for largemouth bass; M: molecular weight standard.
[0027] Figure 9 For verification of existing technology. M: Molecular weight standard; red asterisk indicates homozygote of a single short segment, i.e., a heat-resistant individual identified by existing technology. Detailed Implementation
[0028] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.
[0029] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0030] Example 1 1. Analysis of the high-temperature tolerance of largemouth bass (1) Experimental fish The juvenile largemouth bass used in this invention were obtained from a fish farm in Xiaogan, Hubei Province. After being transported back to the laboratory, the experimental fish were raised in a cylindrical aquarium with a diameter of 1 m and a height of 1.25 m for one month before undergoing high-temperature tolerance phenotypic analysis. During the rearing period, the fish were fed twice a day, at 9:00 AM and 5:00 PM, with largemouth bass-specific extruded pellet feed produced by Fujian Tianma Technology Group Co., Ltd., until they were satiated. The feed's stated nutritional composition was: crude protein 53%, crude fat 5%, crude fiber 3%, and crude ash 15%. The experimental fish rearing room was under natural light, and the aquarium was equipped with a circulating water system. The water temperature was maintained at 25-28 ℃, and the main water quality parameters were: dissolved oxygen >5 mg / L, ammonia nitrogen <0.1 mg / L, and nitrite nitrogen <0.05 mg / L.
[0031] (2) Determination of lethal accumulated temperature in experimental fish The previously established gradient high-temperature exposure method (Chen et al., 2025) was used to treat the largemouth bass experimental fish population with high temperature, and the lethal cumulative temperature (LCT) at which each individual died under high-temperature exposure conditions was used as the evaluation index of high-temperature tolerance.
[0032] The experimental procedure is briefly described as follows: The experimental fish, which had been fasted for 24 hours, were randomly divided into four cylindrical exposed aquariums (1 m in diameter, 1.25 m in height, and 600 L of water each). The water temperature was controlled by an HXL-M030 thermostat manufactured by Guangdong Haojia Refrigeration Equipment Co., Ltd. (Guangzhou, China).
[0033] The initial water temperature was set at 28 ℃. After the experimental fish acclimatized to 28 ℃ for 24 hours, the water temperature was increased from 28 ℃ to 34 ℃ (non-lethal temperature) at a rate of 2 ℃ per step. After reaching 34 ℃, the temperature was increased at a rate of 0.5 ℃ per step until all fish died. Whether the temperature increase was 2 ℃ or 0.5 ℃, the target temperature could be reached within 2 hours after adjusting the thermostat settings. Including the temperature rise period (~2 hours), each temperature increase treatment lasted for 24 hours.
[0034] During the high-temperature treatment, the fish were not fed and were checked every 6 hours. Susceptibility to body stiffness and lack of response to disturbance was used as the criterion for determining mortality. The water temperature at the time of death for different individuals and their survival time under the corresponding water temperature conditions were recorded. A total of four high-temperature treatment experiments were conducted. The duration of each experiment, the number of fish, and the average weight are shown in Table 1.
[0035] Table 1. Experimental time and sample information for high-temperature resistance phenotypic analysis
[0036] (3) Calculation of lethal accumulated temperature Calculate the lethal accumulated temperature value for different individuals using the following formula. T0: Reference temperature (34℃) Ti: Water temperature on day i (°C) Tn: Temperature at the time of death (°C) n: Survival time (days) M: Survival time at the death temperature (hours) (4) Selection of individuals sensitive to and resistant to high temperatures In each experiment, based on the distribution characteristics of LCT values among different individuals, samples with the lowest and highest LCT values, accounting for approximately 20% of the total population, were selected as heat-sensitive and heat-tolerant individuals, respectively, while the rest were considered intermediate phenotype individuals. The number of individuals in the heat-sensitive, heat-tolerant, and intermediate phenotype groups in different experiments, as well as the range of LCT values for different phenotypes, are shown in Table 1 above.
[0037] (5) Homogenization of LCT values Because the weight, physiological state, and culture temperature of the experimental fish populations used in different experiments vary slightly, their LCT values differ to some extent. Figure 1 A). Although there were significant differences in LCT values between individuals selected from the heat-sensitive and heat-resistant groups in each experiment ( p <0.05), but in different experiments, especially in the first experiment, the LCT values of the high-temperature resistant group were not significantly different from the LCT values of the high-temperature sensitive group in other batches of experiments. Figure 1B). To eliminate the influence of batch effects on subsequent genome-wide association studies (GWAS), LCT values from different experiments were Z-score normalized. Figure 1 C). After homogenization, the Z-score values of the high-temperature sensitive group in different experiments were all negative, while the Z-score values of the high-temperature resistant group were all positive, showing significant differences. p <0.05, Figure 1 D).
[0038] 2. Genome resequencing (1) Sample collection and genomic DNA extraction A piece of muscle was cut from the left back of each fish using scissors and placed in anhydrous ethanol at -20 °C for genomic DNA extraction. Genomic DNA was extracted using the phenol-chloroform method, and the integrity of the genomic DNA was checked by agarose gel electrophoresis. The DNA concentration was determined using a Quawell Q5000 spectrophotometer.
[0039] (2) Genome resequencing VAHTS manufactured by Vazyme DNA sequencing libraries were constructed using the Universal Plus DNA Library Prep Kit for MGIV2, and paired-end 150bp (PE150) sequencing was performed using the DNBSEQ-T7 high-throughput sequencing platform of MGI Tech Co., Ltd. The raw sequencing data has been stored in the GSA (Genome Sequence Archive) database of the National Center for Biotechnology, with accession number CRA039973. The data download link is https: / / download.cncb.ac.cn / gsa6 / CRA039973.
[0040] 3. Data Analysis (1) Identification of SNPs The raw sequencing data were preprocessed using fastp-v0.23.2, yielding 8,986,323,497 high-quality sequences with an average sequencing depth of 13.92×. bowtie2-v2.5.4 was used to align the high-quality sequences with the largemouth bass reference genome sequence (NCBI RefSeq assembly: GCF_014851395.1), achieving an average alignment rate of 93.31%, with 64.66% of alignments being unique and consistent in both forward and reverse directions. The generated SAM files were filtered using samtools-v1.16.1 to remove PCR duplicates, converted to BAM files, and then sorted and indexed. GATK-v4.2.6.1 was used for variant detection, GVCF file merging, genotyping, SNP extraction, and filtering. The output GVCF file was further filtered using VCFtools-v0.1.17, yielding 1,825,445 high-quality SNPs with a deletion rate <0.5, minor allele frequency >3, quality score >30, and average depth >3. More than 99% of these SNPs (1,808,294) were evenly distributed across the 23 chromosomes of the largemouth bass. Figure 2 A). SNPs are mainly located in introns, intergenic regions, and downstream and upstream regions of annotated genes, with only a small number of SNPs distributed in exons. Figure 2 B).
[0041] (2) Population structure and genetic relationship analysis Population structure and genetic correlation analyses were performed on the identified high-quality SNPs. VCF files containing high-quality SNP information were converted to PHYLIP format using vcf2phylip-v2.0, and a phylogenetic tree was constructed using the neighbor-joining method in phylip-v3.697 with 1000 self-repeating replicates. The genetic relationship matrix (GRM) was calculated using GCTA-v1.94.1, and a kinship heatmap was generated using the R package pheatmap-v1.0.12. Principal component analysis (PCA) was performed using PLINK-v1.90, and the population structure of the samples was assessed using ADMIXTURE-v1.3.0, with K values (inferred ancestral population size) ranging from 1 to 5. The optimal K value was determined using minimum cross-validation (CV) error.
[0042] The phylogenetic analysis results showed no obvious clustering among different samples. Figure 3 A), the kinship heatmap showed weak genetic correlations among different samples ( Figure 3 B), and the PCA plot did not show obvious group separation (B), Figure 3 C), the above results indicate that there is no significant genetic differentiation between individuals sensitive to and resistant to high temperatures. Population structure analysis results show that the cross-validation error is lowest when K=1. Figure 3 (D and E) indicate that all samples may have originated from the same ancestral group. These analytical results suggest that the samples in this invention are suitable for genome-wide association studies.
[0043] (3) Genome-wide association analysis False positives in genome-wide association studies (GWAS) were compared for different combinations of phenotypes and analytical models to determine the optimal phenotype and analytical model combination. The two phenotypes were sensitivity / tolerance (qualitative trait) and Z-score (quantitative trait), and the two analytical models were generalized linear model (GLM) and linear mixed model (LMM). For the combination of GLM and the two phenotypes, GWAS analysis was performed using PLINK-v1.90; while for the combination of LMM and the two phenotypes, GWAS analysis was performed using GEMMA-v0.98.5, with the first three principal components and GRM obtained from PCA and kinship analysis as covariates.
[0044] When using GLM, the phenotype of sensitivity / tolerance (quality traits) ( Figure 4 QQ plots of A) and Z-score (quantitative trait) phenotypes ( Figure 4 B) shows the observed -log 10 ( p The values were all higher than expected, indicating the presence of false positives. For the linear mixed model (LMM), the QQ plots for the sensitive / tolerant (quality trait) phenotype still showed false positives. Figure 4 C), while the Z-score (quantitative trait) phenotype effectively controlled for false positives (C). Figure 4 D). Therefore, we chose Z-score (quantitative trait) phenotype + LMM for GWAS and subsequent analysis.
[0045] (4) SNPs that are significantly related to high temperature resistance According to the minor allele frequency (MAF) >5% and p <10 -5 Based on the established standards, 14 SNPs significantly associated with heat resistance in largemouth bass were identified. The heat resistance-associated molecular markers were named HRAS (Heat resistance-associated SNPs) and further classified according to... p The values are numbered in ascending order from HRAS#1 to HRAS#14. These HRASs are concentrated on three chromosomes. Figure 5 Chr17 was the most numerous (8), followed by Chr13 (4) and Chr15 (2). Their specific locations on chromosomes, the genomic functional regions they are distributed in, the significance level associated with the heat resistance trait, and the phenotypic explanation rate (PVE) are shown in Table 2.
[0046] Table 2. SNPs associated with the heat tolerance of largemouth bass
[0047] (5) Genotype frequencies of heat-resistant molecular markers in sensitive and tolerant groups Based on the genotyping results, the genotype frequencies of heat-resistant molecular markers in heat-sensitive and heat-tolerant largemouth bass populations were obtained (Table 3). For example, HRAS#1, HRAS#4, HRAS#5, and HRAS#7-10 are all located on chromosome 17, and their (S_MAF) minor allele frequencies (MAF, 0.33-0.37) in the sensitive group are highly consistent, indicating close linkage. Similarly, heat-resistant molecular markers located on chromosomes 13 and 15 are also closely linked to each other. However, although also located on chromosome 17, the minor allele frequency of HRAS#13 in the sensitive group is 0.28, which differs significantly from the MAF (0.33-0.37) of other heat-resistant molecular markers on this chromosome, indicating that it is not closely linked. Therefore, based on the linkage between markers, the 14 thermostable molecular markers located on the three chromosomes can be divided into four clusters: Chr17-1 (HRAS#1, HRAS#4, HRAS#5 and HRAS#7-10), Chr13 (HRAS#2, HRAS#6, HRAS#11 and HRAS#12), Chr15 (HRAS#3 and HRAS#4) and Chr17-2 (HRAS#13).
[0048] Table 3. Genotype frequencies of heat-resistant molecular markers in the sensitive and tolerant largemouth bass populations.
[0049] Based on the genotype frequencies of heat-resistant molecular markers in the sensitive and tolerant groups, the relationship between genotype and heat tolerance in largemouth bass can be determined. For example, the MAF (S_MAF, 0.41-0.46) of the Chr17-1 heat-resistant molecular marker was higher in the sensitive group than in the tolerant group (R_MAF, 0.23-0.27), and this trend remained consistent across four experiments, indicating an inverse correlation between the frequency of minor alleles at these loci and heat tolerance. Taking HRAS#1 as an example, the genotypes at this locus are G / G, G / A, and A / A. The proportion of the G / G type was higher in the tolerant group than in the sensitive group, while the proportions of the G / A and A / A types were lower, indicating that the minor allele (A) at this locus is unfavorable for heat tolerance. Similarly, the minor allele of the Chr13 heat-resistant molecular marker is also unfavorable for heat tolerance. However, the minor alleles of the Chr15 and Chr17-2 molecular markers are favorable for heat tolerance. The relationship between the genotypes of the above molecular marker loci and the heat tolerance trait of largemouth bass lays the foundation for developing specialized kits to screen for heat-tolerant largemouth bass.
[0050] (6) Chain disequilibrium analysis Genome-wide linkage disequilibrium (LD) decay analysis was performed using PopLDdecay-v3.43, with r 2 Quantization of LD. 2 The closer to 1, the stronger the LD; the closer to 0, the weaker the LD. Chain disequilibrium (LD) decay analysis shows that the LD weakens rapidly with increasing distance. Figure 6 The attenuation distance is 100kb (r 2 ≈0.28).
[0051] (7) Identification of heat-resistant genes Candidate heat-resistance-related genes were identified by scanning a 100kb window upstream and downstream of the heat-resistance molecular marker. As shown in Table 4, a total of 22 genes linked to the heat-resistance molecular marker of largemouth bass were identified. Most of the heat-resistance-related genes have not yet been named; representative genes include... fancb Participating in DNA damage repair, klhl6 It participates in the ubiquitination of proteins.
[0052] Table 4. Genes linked to heat-resistant molecular markers in largemouth bass.
[0053] (8) Expression analysis of heat-resistant genes To investigate the correlation between the expression levels of candidate genes and the heat tolerance of largemouth bass, real-time quantitative PCR (qPCR) was used to detect the expression levels of these genes. fancbThe expression of eight genes in the brain and liver tissues of untreated control, normal treated individuals, and moribund treated individuals was investigated.
[0054] The experimental fish were subjected to a gradient temperature treatment as described above. Samples were taken after the temperature reached 35.5 °C and was maintained for 24 hours. Dying individuals floated on the surface, exhibited increased respiratory rate, and showed no response to human disturbance such as capture, while healthy individuals swam normally without these abnormalities. The experimental fish were anesthetized with 200 mg / L MS-222 and dissected. Brain and liver tissues were collected, and total RNA was extracted using Trizol reagent (Thermo Fisher Scientific). The concentration was measured, and RNA degradation was confirmed by agarose gel electrophoresis. First-strand cDNA was synthesized using EasyScript One-step gDNA Removal and cDNA Synthesis SuperMix (TransGen).
[0055] qPCR analysis was performed using a Bio-Rad CFX Duet Real-Time PCR system. The reaction mixture consisted of 5 μL of mix, 0.5 μL each of 10 μM forward and reverse primers, 2.5 μL of first-strand cDNA diluted 10-fold, and ultrapure water to a final volume of 10 μL. Information on the target gene, primer sequences, amplicon length, and primer amplification efficiency is shown in Table 5. actb2 and eef1g Genes are used as internal controls, and the geometric mean of their expression levels is used as a normalization parameter for calculating the relative expression level of the target gene.
[0056] Table 5. qPCR primer sequences, amplification efficiency, and amplicon length
[0057] qPCR analysis results showed that although the expression of some genes was tissue-specific, the expression of all candidate genes detected was affected by high temperature stress, and the expression levels of most genes differed significantly between normal and dying individuals. Figure 7 ).For example, gpm6bb Gene expression levels were significantly downregulated in the brain and liver tissues of both normal and near-death individuals after high-temperature treatment, with a greater degree of downregulation in near-death individuals. Compared with control samples, LOC119907939 Gene expression levels were significantly upregulated in the brain and liver tissues of both normal and dying individuals, but the upregulation was more pronounced in normal individuals. Furthermore, fancb , LOC119904170 , LOC119904172 , LOC119907685 and mospd2Significant differences were also found in the expression levels of these genes in the brains or livers of normal and dying individuals. These findings indicate that the expression levels of these heat-resistance-related genes are closely related to the heat tolerance of largemouth bass. The heat-resistance molecular markers identified in this invention may influence the heat tolerance of largemouth bass by affecting the expression of their associated heat-resistance-related genes.
[0058] 4. Detection kit for heat-resistant molecular markers in largemouth bass Because the identified heat-resistant molecular markers for largemouth bass are clustered and closely linked within the same cluster, the markers with the highest significance levels in each cluster were selected to construct a detection kit. Targeted high-throughput sequencing (targeted sequencing) was then used to achieve batch screening of heat-resistant largemouth bass. Individuals screened using these heat-resistant molecular markers can be used as parents to breed new largemouth bass varieties with enhanced heat resistance.
[0059] (1) Detection primers Specific amplification primers were designed and screened for HRAS#1, HRAS#2, HRAS#3, and HRAS#13. As shown in Table 6, each marker has 4 forward primers and 5 reverse primers, with a barcode marker (underlined portion) at the 5' end of each primer. The site-specific sequences of different forward and reverse primers are identical, but the barcode sequences are different to distinguish different samples. Each forward primer of each marker can be paired with 5 reverse primers, allowing for the detection of 20 samples at a time. Since the sequences of different markers are different, mixed sequencing can be performed. After sequencing, sequences belonging to different markers from different samples are sorted based on the marker sequence and barcode sequence. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and diluted to 10 µM with 10 mM Tris-Cl before being used in PCR reactions. The designed amplification fragments of different markers ranged in length from 287 to 381 bp.
[0060] Table 6 Primer sequences and amplicon lengths for high-temperature resistant molecular marker detection in largemouth bass.
[0061] HRAS#1 sequence (SEQ ID NO.59) gaaaacatttttttagcaggcaaatagatgttaaatacaacacacacaaattctgagaatcatgtgatgagttcttttcgagttctggccgaagataagtctcaaaagtgagtgagcaccgaattaagaattaaatcttcagtatcttattactgttatcctgacgggtgagaaatgacagaaa gtgctgagaggacgatggtaattttctcaggaccagcgagggcacagtgaagatggataatgcaactgaagaggagagtataatatatggggatttcaacatgcagcagatact(g / a)agaggaggtagtaaggctgaacgtagagaggatgattggctttttaatggtgacaactaccatagaaggtgaagaggcaagacgaggcagaagaggcggtgatctgtaggtttcagctcataaaaccttgagaagaatgaatactcagagagggatgatggagaatgattgggggaggggggtttcagccttttgtatgggcaacacaaaacagccagcagattcactcagggatttggacccggggaaagaaaagtctcacgtttcacatttaacaaagggatcttcagaggatttga HRAS #2 sequence (SEQ ID NO.60) gatatagaaatggagataaatacgaagatagaagaatagagggaattcatg ttaaaggggagagtgga cctgatgggagaaacataattgccaaataatcctagcaaacactttgatgttgtacatatgttatgttagatgtcctacatcaacaccaaaaatgtttgaagaaactgacagttgagacaaggttggcaatcatccatacctgttggataatgtgttttcttaagtaagtgcttccattttacacaaattcacaaatcaataacttgccactatgaaacgtcttgctccagt(a / c)taggttgcatagctggttcgggttgttctgcctgtgttttgggataatatatggctgaaccgaagccatgtggttacccaagcagcttagtttttgatcacaggaccttgcttgtcaggattcgccgtactcttcttctgattgtctagtagtccatttatttatttatttttattttacctttattttaccaggaaagaaatccaatgagatttttaatctcttttacaaggatgtcctggccatacctaggtactgcacatatgcaactcccaacaaagatcttatagaagtgagat HRAS #3 Sequence (SEQ ID NO.61) gaaacctggtccagagtgctcaggtttacacatgtaccctgtgaacaatacacagtaaatatacattcacaattcactgagtctcttttgagacctaatcactttaaaatgtaataacatatgattttcagcaaaactgttccaaattgcatgttataatgatctcttcatgcactgtaacaaatcccagaaaatcccattaaactttacctgagcaatgagtctctgca gagcgaggacacgtccattaaaggcagcatcatgaattggagaccagtccgattcaacatctaggtgcag(a / g)catgaaaagcaacagtcactcacatctccccaagtattagttataatgacatggtgaaactttctgtgtaaagtagtaaatatactccagctgcagtgcgagcacacactggcagcaactactcaccactcatcaaagggtttgagaaaaaaacaacagctccactttgacatgtagtgtctctcggagtctctttgtgtccagcagacatccttcacagtggcgttccaaaatgttgttttatgggccgattgtttttgcctcaaaggtttttgcaatagaggctgaattgtgtccaa HRAS #13 sequence (SEQ ID NO.62) gctttactgcagttctgagattagatgatgtttacagatttgtttcaagtgtgtgtcactttttaagcactggggagggatgacaaaatactgaatactgctcttataaatacatgtggagaaaaacacatatatacaatgttttacgttttgtaaaaaaaaaaaaaaagtgttttgctgctgttatgaatgaatgatatcacttaaag tcggagagaga ctgctttgtttggggggttggtggtgaaagtaaaatattaacgtaacgagtaacgttacgtattattgctttttttaagg(t / a)gtaataaataactagtaacttattacaatttctaacttgcccaacgctgcttgctaatagtggatcttctttagaccattaattttataaaacaaaggcctttaacatcactc aggtgagtcaatccctgttccagtcacgttaagtcttgacctggaagttttgagattacctaaagtgcgaggcttccttgaggattagctggaaggatggaagagttttgtgactcacccgaacaacaagacccacacccccacaaacacacacacaaacacacactccctagctgcttcacagtt Note: The underlined part is the forward primer, the bold part is the reverse primer, and the part inside the parentheses is the polymorphic site.
[0062] (2) PCR amplification Using genomic DNA from 10 heat-sensitive and 10 heat-resistant individuals selected in Experiment 1 as templates, the specificity of each marker PCR amplification was verified. The PCR reaction system was: 12.5 μL 2× T8 High-Fidelity Master Mix (Qingke Biotechnology), 10 μL enzyme-free water, 0.5 μL forward primer, 0.5 μL reverse primer, and 1 μL DNA template. The reaction program was: 98℃ for 2 min; 98℃ for 15 s, 60℃ for 15 s, 72℃ for 15 s, 30 cycles; 72℃ for 5 min. After PCR amplification, 1% agarose gel electrophoresis was used for detection. After 20 min of constant voltage electrophoresis at 120V, images were taken using a UV gel imaging system. Figure 8 As shown, specific amplification products were obtained for different markers, and the amplified fragment size was consistent with the design. The electrophoretic bands were bright and the homogeneity among different samples was good, indicating that the PCR reaction had high specificity and amplification efficiency, and the amplification products could be used for high-throughput sequencing.
[0063] (3) High-throughput sequencing Two µL of each of the 80 PCR products obtained from 20 samples amplified using four pairs of labeled primers was mixed to form a single pooled sample. The mixed PCR sample was purified using VAHTS DNA clean beads (Novozymes), and a sequencing library was constructed using the VAHTS® UniversalPlus DNA Library Prep Kit for MGI (Novozymes). High-throughput sequencing was performed using the DNBSEQ-T7 sequencing system (BGI Genomics). Sequencing was performed at paired-end 150 bp (PE150), yielding 18,098,868 reads, for a total sequencing depth of 2.7 Gb.
[0064] Due to the high cost of genome resequencing, GWAS analyses typically use a sequencing depth of around 10×. However, targeted sequencing, with its smaller number of sites, does not lead to a dramatic increase in sequencing cost when increasing sequencing depth. In this protocol, the average targeting depth for thermostable molecular markers in largemouth bass was 6.5 × 10⁻⁶. 4 ~ 16.0×10 4 This is several times higher than the 9.2 to 14.0 times higher than that of genome resequencing.
[0065] (4) SNP and genotype identification The same analysis software as the genome resequencing data was used for preprocessing, SNP identification, and genotyping of the targeted sequencing data. The difference was that the parameter "--contamination-fraction-to-filter 0.3" was used in the gatk HaplotypeCaller command to exclude the influence of PCR contamination on the genotyping results. The high depth of the targeted sequencing data ensured the accuracy of the genotyping results. The allele read lengths in heterozygotes at different marker loci accounted for 49%-51% of the total read lengths, fully conforming to Mendel's laws of inheritance, indicating that the genotyping results were reliable with an accuracy of 100% (Table 7). Inconsistencies existed between the genotyping results of the genome resequencing data and those of the targeted high-throughput sequencing data; the accuracy of genotyping results at different loci ranged from 80% to 100% (Table 7).
[0066] Table 7 Comparison of depth and genotype identification accuracy in genome resequencing targeted sequencing
[0067] (5) Testing cost analysis This kit contains 36 primers, costing 303.6 yuan. The primers are sufficient for at least 4000 PCR reactions per target site. Library construction costs 50 yuan. High-throughput sequencing data is 2.7G, with a sequencing cost of 10 yuan / G, totaling approximately 30 yuan. Testing 20 fish will cost a total of 303.6 + 50 + 30 = 383.6 yuan. The testing cost per fish per marker is approximately 383.6 / (20...). 4) ≈ 4.8 yuan. Since the cost of primers remains constant, the detection cost per marker decreases rapidly as the number of samples increases. For example, the total cost of detecting 200 fish is 303.6 + 50 yuan. 10 + 30 10 = 1103.6 yuan, the testing cost per fish per tag is 1103.6 / (200) 4) ≈ 1.4 yuan. If 2000 fish are tested, the total cost will be 303.6 + 50 yuan. 100 + 30 100 = 8303.6 yuan, the testing cost per fish per tag is 8303.6 / (2000) 4) ≈ 1.0 yuan, which is much less than the sequencing cost of 10 yuan per fish per marker for Sanger sequencing.
[0068] Comparative Example 1 Ten largemouth bass, the most sensitive and heat-resistant fish in the first three experiments of Example 1 of this invention, were selected and subjected to PCR amplification and agarose gel electrophoresis using the forward primer P1-F and reverse primer P1-R disclosed in the prior art (Chinese Invention Patent CN118910289A).
[0069] like Figure 9 As shown, amplifying the genome of largemouth bass using this primer yielded three banding patterns: a single long fragment, a single short fragment, and a mixture of long and short fragments (heterozygotes). According to molecular weight standards, the amplified fragment size matched the 244 bp short fragment and 288 bp long fragment in the comparative file, indicating successful amplification of the target fragment and an effective reaction. However, this technique could not identify heat-sensitive and heat-tolerant largemouth bass individuals distinguished by the gradient temperature lethal accumulated temperature method. According to the comparative file, a single short fragment indicates a heat-tolerant type, a single long fragment indicates a heat-intolerant type, and heterozygotes represent an intermediate type. Verification showed that different banding patterns (genotypes) were randomly distributed in the sensitive and tolerant largemouth bass populations, indicating no correlation with the individual's heat tolerance.
[0070] In summary, heat tolerance in fish is a quantitative trait determined by multiple genes, not a qualitative trait determined by a single gene. Although numerous studies have investigated the effects of heat stress on the growth, immunity, and disease resistance of largemouth bass, the genetic mechanism determining its heat tolerance remains unclear. The technique disclosed in Comparative Example 1 cannot accurately determine which largemouth bass individuals are heat-sensitive and which are heat-tolerant. This invention employs a gradient heating lethal accumulated temperature method to screen for heat-sensitive and heat-tolerant largemouth bass. Through genome resequencing and genome-wide association analysis, 14 SNP markers significantly associated with heat tolerance in largemouth bass were identified. A detection kit was developed for the four SNPs with the highest significance level in each cluster to screen for heat-tolerant largemouth bass individuals from the baseline population. This invention's technique has the advantages of high throughput and low cost, with 100% accuracy in genotyping, and can be used for breeding new heat-tolerant largemouth bass varieties.
[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A molecular marker associated with the heat tolerance of largemouth bass, characterized in that, The sequences of the molecular markers are shown as any one or more of SEQ ID NO.59-SEQ ID NO.
62.
2. A primer combination for detecting the molecular marker of claim 1, characterized in that, The sequences of the primer combination are shown in SEQ ID NO.23-SEQ ID NO.
58.
3. A product for screening, detecting, or identifying heat-resistant largemouth bass, characterized in that, The product contains the primer combination as described in claim 2.
4. The product according to claim 3, characterized in that, The product includes a reagent kit.
5. The application of the molecular marker described in claim 1 in constructing a genetic map of heat tolerance for largemouth bass.
6. A method for screening molecular markers as described in claim 1, characterized in that, Includes the following steps: Largemouth bass were treated with gradient temperature rise lethal accumulated temperature method. Through genome resequencing and genome-wide association analysis, SNP markers that were significantly associated with heat tolerance were identified. The molecular marker with the highest significance level in each cluster was identified.
7. A method for screening, detecting, or identifying heat-resistant largemouth bass, characterized in that, The process includes the following steps: using the primer combination described in claim 2 or the kit described in claim 4 to detect the molecular marker described in claim 1 in largemouth bass, and screening heat-resistant largemouth bass individuals based on the detection results.
8. The method according to claim 7, characterized in that, The test is for genotype identification.
9. The application of the molecular marker of claim 1, the primer combination of claim 2, or the product of any one of claims 3-4 in the screening, detection, or identification of heat-resistant largemouth bass.
10. The application according to claim 9, characterized in that, The applications include the breeding of new heat-resistant largemouth bass varieties.
Citation Information
Patent Citations
Breeding method of high-temperature-resistant largemouth bass
CN115553233A
Molecular marker primer and kit for rapidly identifying high-temperature-resistant individuals of micropterus salmoides and application of molecular marker primer and kit
CN118910289A