A method for detecting genes encoding electron transport proteins involved in sulfate-reducing bacteria
By designing specific primer pairs for quantitative real-time PCR, the problem of rapid detection of electron transport protein encoding genes in Archaeococcus was solved, enabling in-depth analysis of the corrosion mechanism of sulfate-reducing bacteria and supporting the adoption of effective inhibition measures.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- EAST CHINA UNIV OF SCI & TECH
- Filing Date
- 2026-04-28
- Publication Date
- 2026-06-16
AI Technical Summary
Existing technologies are insufficient for the rapid and specific detection of electron transport protein-encoding genes in Archaeococcus, which affects the effectiveness of analysis of the corrosion mechanism of sulfate-reducing bacteria under high-temperature conditions and the development of inhibition measures.
Design and use specific primer pairs (such as first primer pair, second primer pair, and third primer pair) to perform real-time PCR to identify and quantify the abundance and expression levels of genes encoding electron transport proteins in Archaeococcus.
This method enables rapid and specific detection of electron transport protein encoding genes in Archaeococcus, allowing for further research on electron transport function and activity, and supporting corrosion analysis of sulfate-reducing bacteria under high-temperature conditions.
Smart Images

Figure CN122214518A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial corrosion and microbial detection technology, and relates to a method for detecting genes encoding electron transport proteins in sulfate-reducing bacteria. Background Technology
[0002] Archaeococcus ( Archaeoglobus *Hypericum sulfate-reducing* is a strictly anaerobic, hyperthermophilic group of sulfate-reducing archaea, widely distributed in environments such as submarine hydrothermal vents, deep oil reservoirs, and high-temperature sediments. This bacterium utilizes sulfate, sulfite, or thiosulfate as terminal electron acceptors to reduce them to hydrogen sulfide (H₂S), participating in the environmental sulfur cycle. It is an important functional group in microbial corrosion (MIC) in high-temperature oil reservoirs, potentially significantly impacting the corrosion of pipelines (such as well tubing and casing) and metal facilities (pumps) under high-temperature conditions, leading to oilfield acidification and exacerbating corrosion damage to metal materials. Specific detection of thermophilic sulfate-reducing bacteria can facilitate understanding their growth in high-temperature environments, analyzing corrosion patterns and mechanisms, and implementing appropriate measures for effective inhibition. Studies have shown that... Archaeoglobus fulgidus (Archaeopteryx scintillans) can form biofilms under high temperatures and cause indirect corrosion of metal surfaces through its metabolic products (such as sulfides). Archaeoglobus fulgidus(At 70°C, International Biodeterioration & Biodegradation, 2020, 154: 105056). Under carbon-deficient conditions, it may even utilize the metal itself as an electron donor to directly promote the corrosion process, indicating its potential ability to transfer electrons between metal surfaces and the metal (Carbon steel biocorrosion at 80 ºC by a thermophilic sulfate reducing archaeon biofilm provides evidence for its utilization of elemental iron a selectron donor through extracellular electron transfer, Corrosion Science, 2018, 145: 47-54). Some proteins, such as cytochrome c, have been reported to be related to electron transfer. Therefore, developing a specific, rapid, and sensitive method to detect genes encoding proteins involved in electron transfer, and further applying it to the study of electron transfer function and activity in Archaeococci, is of great significance. Summary of the Invention
[0003] The purpose of this invention is to provide a method for the specific, rapid, and sensitive detection of electron transport protein encoding genes in Archaeococcus, thereby providing primer pairs for detecting electron transport protein encoding genes in sulfate-reducing bacteria and their applications.
[0004] The objective of this invention can be achieved through the following technical solutions: One of the technical solutions of this invention is to provide a primer pair for detecting the abundance and / or expression level of electron transport protein-coding genes in sulfate-reducing bacteria. The primer pair is designed based on the specific sequences of electron transport protein-coding genes in sulfate-reducing bacteria, wherein the GenBank accession number of the electron transport protein-coding genes is AAB90709.1. The primer pair is selected from any one of the first primer pair, the second primer pair, and the third primer pair. The first primer pair consists of a first forward primer and a first reverse primer, the nucleotide sequences of which are shown in SEQ ID NO.1~2, respectively; The second primer pair consists of a second forward primer and a second reverse primer, the nucleotide sequences of which are shown in SEQ ID NO.3~4, respectively; The third primer pair consists of a third forward primer and a third reverse primer, the nucleotide sequences of which are shown in SEQ ID NO.5~6, respectively.
[0005] First primer pair: First forward primer (SEQ ID NO.1): ACCTGATGAAATGCGGCTCA First reverse primer (SEQ ID NO.2): AGCGAGAACTCAGCCTTGTC Second primer pair: Second forward primer (SEQ ID NO.3): GACAAGGCTGAGTTCTCGCT Second reverse primer (SEQ ID NO.4): GAGGCATTAAAAACCGGCCC Third primer pair: Third forward primer (SEQ ID NO.5): GAGGCATTAAAAACCGGCCC Third reverse primer (SEQ ID NO.6): TGAGCCGCATTTCATCAGGT The second technical solution of the present invention is to provide the application of primer pairs for detecting the abundance and / or abundance of electron transport protein-coding genes in sulfate-reducing bacteria as described in one of the above technical solutions in the study of electron transport in Archaeococcus, wherein the abundance of electron transport protein-coding genes in sulfate-reducing bacteria is positively correlated with the electron transport function of Archaeococcus, and the expression level of the electron transport protein-coding genes is positively correlated with the electron transport activity of Archaeococcus.
[0006] In some specific embodiments, the Archaeococcus genus is... Archaeoglobus fulgidus .
[0007] In some specific embodiments, the Archaeococcus genus is... Archaeoglobus fulgidus DSM 4304.
[0008] The third technical solution of the present invention provides a method for detecting genes encoding electron transport proteins in sulfate-reducing bacteria, comprising the following steps: S1. Extract DNA or RNA from all microorganisms in the sample to be tested. If RNA is extracted, reverse transcribe the RNA into cDNA. S2. Select the primer pair as described in one of the above technical solutions and perform real-time PCR on the sample DNA or cDNA obtained in step S1. S3. Read the initial cycle number C of the real-time PCR amplification reaction in step S2. T The value is used to calculate the copy number of genes encoding electron transport proteins in the sample being tested.
[0009] In some specific embodiments, step S1 involves the sample to be tested comprising any one or more combinations of oilfield produced fluid containing Archaeococcus, sulfate-reducing bacterial system containing Archaeococcus, and corrosion exposure test system.
[0010] In some specific embodiments, the Archaeococcus genus is... Archaeoglobus fulgidus .
[0011] In some specific embodiments, the Archaeococcus genus is... Archaeoglobus fulgidus DSM 4304.
[0012] In some specific embodiments, in step S1, RNA extraction is performed using the TRIzol reagent method; DNA was extracted using a commercially available bacterial DNA extraction kit.
[0013] In some specific embodiments, the reaction system for step S2, the real-time PCR amplification, consists of the following: 9.5 μL sterile water, 12.5 μL Universal SYBR Green Master Mix, 0.5 μL each of 12.5 μM forward and reverse primers, and 2 μL of sample DNA or cDNA to be tested.
[0014] In some specific implementations, step S2, the procedure for quantitative PCR amplification, is set as follows: a) incubate at 95 ºC for 30 min; b) incubate at 94 ºC for 20 s; c) incubate at 60 ºC for 30 s; d) repeat steps b) to c) 39 times; e) increase the temperature by 0.5 ºC every 5 s from 65 ºC until reaching 95 ºC; f) read the initial cycle number C of the quantitative PCR amplification reaction. T value.
[0015] In some specific embodiments, step S3 involves calculating the copy number of genes encoding electron transport proteins in sulfate-reducing bacteria when the specific primer pair is the first primer pair. N The formula is: .
[0016] In some specific embodiments, in step S3, when the specific primer pair is the second primer pair, the copy number of the gene encoding the electron transport protein in sulfate-reducing bacteria is calculated. N The formula is: .
[0017] In some specific embodiments, step S3 involves calculating the copy number of genes encoding electron transport proteins in sulfate-reducing bacteria when the specific primer pair is the third primer pair. N The formula is: .
[0018] Compared with the prior art, the present invention has the following advantages: (1) The quantitative PCR method based on specific primers of this invention can identify Archaeococcus at the gene level. Archaeoglobus Genes encoding electron transport proteins in the sample were obtained from Archaeococcus species ( ). Archaeoglobus It participates in the abundance and expression level of electron transport protein-encoding genes, and can be further applied to the study of electron transport function and activity.
[0019] (2) The method of the present invention has high specificity, high sensitivity, and is fast, convenient and accurate. Attached Figure Description
[0020] Figure 1 The initial cycle number measured using the first primer pair and Archaeoglobus A standard curve showing the relationship between the absolute abundance of genes involved in electron transport protein encoding.
[0021] Figure 2 The initial cycle number measured using the second primer pair and Archaeoglobus A standard curve showing the relationship between the absolute abundance of genes involved in electron transport protein encoding.
[0022] Figure 3 The initial cycle number measured using the third primer pair and Archaeoglobus A standard curve showing the relationship between the absolute abundance of genes involved in electron transport protein encoding. Detailed Implementation
[0023] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.
[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.
[0025] Unless otherwise specified, the materials and processes described in the following embodiments or examples are conventional materials and processes used in the art to achieve the corresponding functions.
[0026] Example 1: This embodiment plots a standard curve for genes encoding electron transport proteins, including the following steps: (1) DNA extraction and preparation of standard samples Pick Archaeoglobus fulgidus10 mL of pure culture of DSM 4304 (Archaeococcus scintillans) was centrifuged, the supernatant was discarded, and the bacterial precipitate was collected. DNA was extracted according to the instructions of a commercially available bacterial DNA extraction kit to obtain a certain volume of DNA solution. The concentration of the DNA solution was determined using a Qubit 4 Fluorometer (initial concentration of DNA solution corresponding to the first primer pair was 10.3 ng / μL, the initial concentration of DNA solution corresponding to the second primer pair was 51 ng / μL, and the initial concentration of DNA solution corresponding to the third primer pair was 9.43 ng / μL). Based on the measurement results, the DNA solution was serially diluted 10-fold with sterile deionized water to obtain standard sample DNA at different concentration gradients.
[0027] (2) Real-time PCR amplification a. Select the following three pairs of specific primers for different concentrations of standard sample DNA obtained in step (1) and perform real-time PCR. Their sequences are as follows: First primer pair: First forward primer (SEQ ID NO.1): ACCTGATGAAATGCGGCTCA First reverse primer (SEQ ID NO.2): AGCGAGAACTCAGCCTTGTC Second primer pair: Second forward primer (SEQ ID NO.3): GACAAGGCTGAGTTCTCGCT Second reverse primer (SEQ ID NO.4): GAGGCATTAAAAACCGGCCC Third primer pair: Third forward primer (SEQ ID NO.5): GAGGCATTAAAAACCGGCCC Third reverse primer (SEQ ID NO.6): TGAGCCGCATTTCATCAGGT b. The reaction system for real-time PCR amplification consists of the following components: 9.5 μL sterile water, 12.5 μL UniversalSYBR Green Master Mix, 0.5 μL each of 12.5 μM forward and reverse primers, and 2 μL standard sample DNA of different concentrations.
[0028] c. The quantitative PCR amplification program was set as follows: a) Incubate at 95 ºC for 30 min; b) Incubate at 94 ºC for 20 s; c) Incubate at 60 ºC for 30 s; d) Repeat steps b) to c) 39 times; e) Increase the temperature by 0.5 ºC every 5 s from 65 ºC until reaching 95 ºC; f) Read the initial cycle number of the quantitative PCR amplification reaction. The quantitative PCR instrument used was a Bio-Rad C1000 Thermal Cycler.
[0029] (3) Standard curve plotting and gene copy number calculation Read the C values corresponding to DNA from standard samples at different concentration gradients T The copy number of the target gene in the standard sample is calculated using the following formula, based on the DNA concentration and the length of the target gene: N
[0030] in: N This refers to the gene copy number. C DNA quality (g); L 660 represents the target gene length (bp); 660 represents the average molecular weight of the base pairs (g / mol).
[0031] lg of the logarithm of gene copy number N Let C be the x-axis and the initial cycle number be C. T Using the ordinate as the ordinate, plot the standard curve to obtain the equation of the standard curve using the first primer pair. , that is The standard curve equation for the second primer pair is: , that is The standard curve equation using the third primer pair is: , that is ,See Figure 1 , Figure 2 and Figure 3 .
[0032] The results of fluorescence quantitative PCR amplification of standard samples are shown in Tables 1, 2 and 3.
[0033] Table 1. Results of real-time PCR amplification of standard samples using the first primer pair.
[0034] Table 2. Results of real-time PCR amplification of standard samples using the second primer pair.
[0035] Table 3. Results of real-time PCR amplification of standard samples using the third primer pair
[0036] In the table: A.fulgidus "for" Archaeoglobus fulgidus The abbreviation for "DSM 4304" N The number of gene copies (copies / mL) of genes encoding electron transport proteins at the DNA level is expressed in logarithmic form as lg. N Present the results.
[0037] Example 2 This embodiment detects and analyzes electron transport protein encoding genes in pure culture samples of different sulfate-reducing single bacteria.
[0038] (1) DNA extraction Take sulfate-reducing single bacteria Archaeoglobus fulgidus DSM 4304 (Scintillans scintillans) 、 Desulfovibrio desulfuricans DSM 642 (Desulfovibrio spp.) 、Thermodesulfovibrio Yellowstone 4 mL of pure culture of DSM11347 (Heat Desulfurized Vibrio) was centrifuged, the supernatant was discarded, and the bacterial precipitate was collected. DNA was extracted according to the instructions of a commercially available bacterial DNA extraction kit to obtain a certain volume of DNA solution.
[0039] (2) Real-time PCR amplification a. Select the following three pairs of specific primers to perform real-time PCR on the DNA samples obtained in step (1), and their sequences are as follows: First primer pair: First forward primer (SEQ ID NO.1): ACCTGATGAAATGCGGCTCA First reverse primer (SEQ ID NO.2): AGCGAGAACTCAGCCTTGTC Second primer pair: Second forward primer (SEQ ID NO.3): GACAAGGCTGAGTTCTCGCT Second reverse primer (SEQ ID NO.4): GAGGCATTAAAAACCGGCCC Third primer pair: Third forward primer (SEQ ID NO.5): GAGGCATTAAAAACCGGCCC Third reverse primer (SEQ ID NO.6): TGAGCCGCATTTCATCAGGT b. The reaction system for real-time PCR amplification consists of the following components: 9.5 μL sterile water, 12.5 μL UniversalSYBR Green Master Mix, 0.5 μL each of 12.5 μM forward and reverse primers, and 2 μL DNA from the sample to be tested.
[0040] c. The quantitative PCR amplification program was set as follows: a) Incubate at 95 ºC for 30 min; b) Incubate at 94 ºC for 20 s; c) Incubate at 60 ºC for 30 s; d) Repeat steps b) to c) 39 times; e) Increase the temperature by 0.5 ºC every 5 s from 65 ºC until reaching 95 ºC; f) Read the initial cycle number of the quantitative PCR amplification reaction. The quantitative PCR instrument used was a Bio-Rad C1000 Thermal Cycler.
[0041] (3) Calculation of gene copy number Reading C values of different test samples T Value, based on the standard curve equation of the first primer pair The standard curve equation of the second primer pair The standard curve equation of the third primer pair The copy number of genes encoding electron transport proteins in each sample was calculated. The results of real-time PCR amplification in pure culture samples of different sulfate-reducing bacteria are shown in Table 4.
[0042] Table 4. Results of Real-Time PCR Amplification in Pure Cultures of Sulfate-Reducing Single Bacteria
[0043] “ND” indicates that it was not detected.
[0044] As can be seen from the table, the three primer pairs of this invention can be specifically used for detection. A.fulgidus The electron transport protein encoding genes in *Archaeopteryx scintillans* were analyzed to further investigate their electron transport function.
[0045] Example 3 This embodiment detects and analyzes electron transport protein encoding genes in corrosion-coated sample plates. (1) Extraction of DNA and RNA Test samples were obtained by suspending N80 steel sheets in a bacterial solution for corrosion testing. The bacterial solutions were as follows: Archaeoglobus fulgidus DSM 4303 (Scintillans scintillans) 、 The bacterial community enriched by sulfate-reducing bacteria in the produced fluid of an oil field.
[0046] sample" A.fulgidus"Solution (0% carbon source reduction)" refers to suspending N80 steel sheets under conditions of sufficient carbon source. Archaeoglobus fulgidus A pure bacterial corrosion system was prepared by corroding tablets with DSM 4303 (Archaeococcus scintillans) bacterial solution for 30 days; sample " A.fulgidus "Solution (100% carbon source reduction)" refers to suspending N80 steel sheets in the absence of a carbon source. Archaeoglobus fulgidus A pure bacterial corrosion system was developed using DSM 4303 (Scintillans scintillans) bacterial solution to corrode the tablets for 30 days.
[0047] The sample "SRM solution" is a microbial corrosion system in which N80 steel sheets are suspended in a microbial community (including Archaeococcus) enriched with sulfate-reducing bacteria from a certain oilfield's produced fluid and corroded for 40 days.
[0048] Pick" A.fulgidus 7 mL of the corrosion solutions “SRM solution” and “SRM solution” were centrifuged, the supernatant was discarded, and the bacterial precipitate was collected. DNA was extracted according to the instructions of the commercially available bacterial DNA extraction kit to obtain a certain volume of DNA solution.
[0049] Take 100 mL of the same sample as above, add ethanol-TRIzol for fixation, discard the supernatant by centrifugation, collect the bacterial precipitate, extract total RNA using the TRIzol reagent method, and obtain RNA template after purification. After processing the RNA to remove any possible residual DNA, pre-bind it with random primers, and reverse transcribe the extracted RNA into cDNA through a programmed temperature rise process to obtain a cDNA solution.
[0050] (2) Real-time PCR amplification a. Select the following three pairs of specific primers to perform real-time PCR on the sample DNA / cDNA obtained in step (1), and their sequences are as follows: First primer pair: First forward primer (SEQ ID NO.1): ACCTGATGAAATGCGGCTCA First reverse primer (SEQ ID NO.2): AGCGAGAACTCAGCCTTGTC Second primer pair: Second forward primer (SEQ ID NO.3): GACAAGGCTGAGTTCTCGCT Second reverse primer (SEQ ID NO.4): GAGGCATTAAAAACCGGCCC Third primer pair: Third forward primer (SEQ ID NO.5): GAGGCATTAAAAACCGGCCC Third reverse primer (SEQ ID NO.6): TGAGCCGCATTTCATCAGGT b. The reaction system for real-time PCR amplification consists of the following components: 9.5 μL sterile water, 12.5 μL UniversalSYBR Green Master Mix, 0.5 μL each of 12.5 μM forward and reverse primers, and 2 μL of the sample DNA / cDNA to be tested.
[0051] c. The quantitative PCR amplification program was set as follows: a) Incubate at 95 ºC for 30 min; b) Incubate at 94 ºC for 20 s; c) Incubate at 60 ºC for 30 s; d) Repeat steps b) to c) 39 times; e) Increase the temperature by 0.5 ºC every 5 s from 65 ºC until reaching 95 ºC; f) Read the initial cycle number of the quantitative PCR amplification reaction. The quantitative PCR instrument used was a Bio-Rad C1000 Thermal Cycler.
[0052] (3) Calculation of gene copy number Reading C values of different test samples T Value, based on the standard curve equation of the first primer pair The standard curve equation of the second primer pair The standard curve equation of the third primer pair The copy number of genes encoding electron transport proteins in each sample was calculated, and the results of quantitative real-time PCR amplification in the corrosion-coated samples are shown in Table 5.
[0053] Table 5. Results of quantitative real-time PCR amplification of the corrosive bacterial solution.
[0054] As can be seen from the table, the three primer pairs of this invention can be specifically used to detect [the following]. A.fulgidus The electron transport protein encoding genes in different samples of *Archaeopteryx scintillans* were analyzed to further investigate their electron transport function. This was done under conditions of 100% carbon source reduction. A.fulgidus The communities containing DSM 4303 or Archaeococcus have higher electron transport potential. As shown in the table, the gene copy number of the protein encoding this protein is higher, which is positively correlated with the improved electron transport capacity.
[0055] By performing quantitative real-time PCR on the synthesized cDNA, the following parameters were measured: A.fulgidus The expression level of genes encoding electron transport proteins in the solution (100% carbon source reduction) sample was 3.28 × 10⁻⁶. 5 copies / mL; A.fulgidus The expression level of genes encoding electron transport proteins in the solution (0% carbon source reduction) sample was 8.21 × 10⁻⁶. 4 The expression level of the electron transport protein encoding gene in the SRM solution sample was 164 copies / mL.
[0056] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.
Claims
1. A primer pair for detecting the abundance and / or expression level of genes encoding electron transport proteins in sulfate-reducing bacteria, characterized in that, Primer pairs were designed based on the specific sequences of electron transport protein-coding genes in sulfate-reducing bacteria. The GenBank accession number for these electron transport protein-coding genes is AAB90709.
1. The primer pair is selected from any one of the first primer pair, the second primer pair, and the third primer pair. The first primer pair consists of a first forward primer and a first reverse primer, the nucleotide sequences of which are shown in SEQ ID NO. 1~2, respectively; The second primer pair consists of a second forward primer and a second reverse primer, the nucleotide sequences of which are shown in SEQ ID NO. 3~4, respectively; The third primer pair consists of a third forward primer and a third reverse primer, the nucleotide sequences of which are shown in SEQ ID NO. 5~6, respectively.
2. The application of the primer pair described in claim 1 for detecting the abundance and / or expression level of electron transport protein encoding genes in sulfate-reducing bacteria in electron transport research of Archaeococcus, characterized in that, The abundance of electron transport protein-coding genes in the sulfate-reducing bacteria is positively correlated with the electron transport function of Archaeococcus, and the expression level of the electron transport protein-coding genes is positively correlated with the electron transport activity of Archaeococcus.
3. The application according to claim 2, characterized in that, The Archaeococcus genus is Archaeoglobus fulgidus .
4. The application according to claim 2, characterized in that, The Archaeococcus genus is Archaeoglobus fulgidus DSM 4304.
5. A method for detecting genes encoding electron transport proteins in sulfate-reducing bacteria, characterized in that, Includes the following steps: S1. Extract DNA or RNA from all microorganisms in the sample to be tested. If RNA is extracted, reverse transcribe the RNA into cDNA. S2. Select the primer pair as described in claim 1 and perform real-time PCR on the sample DNA or cDNA obtained in step S1. S3. Read the initial cycle number C of the real-time PCR amplification reaction in step S2. T The value is used to calculate the copy number of genes encoding electron transport proteins in the sample being tested.
6. The method for detecting electron transport protein-coding genes in sulfate-reducing bacteria according to claim 5, characterized in that, In step S1, the sample to be tested is selected from any one or more combinations of oilfield produced fluid containing Archaeococcus, sulfate-reducing bacterial system containing Archaeococcus, and corrosion exposure test system.
7. The method for detecting electron transport protein-coding genes in sulfate-reducing bacteria according to claim 6, characterized in that, The Archaeococcus genus is Archaeoglobus fulgidus .
8. The method for detecting electron transport protein-coding genes in sulfate-reducing bacteria according to claim 5, characterized in that, Step S2, the reaction system for real-time PCR amplification consists of the following components: 9.5 μL sterile water, 12.5 μL Universal SYBR Green Master Mix, 0.5 μL each of 12.5 μM forward and reverse primers, and 2 μL of sample DNA or cDNA to be tested.
9. The method for detecting electron transport protein-coding genes in sulfate-reducing bacteria according to claim 8, characterized in that, Step S2, the program for quantitative PCR amplification is set as follows: a) Incubate at 95 ºC for 30 min; b) Incubate at 94 ºC for 20 s; c) Incubate at 60 ºC for 30 s; d) Repeat steps b) to c) 39 times; e) Increase the temperature by 0.5 ºC every 5 s from 65 ºC until reaching 95 ºC. f) Read the initial cycle number C of the real-time PCR amplification reaction. T value.
10. The method for detecting electron transport protein-coding genes in sulfate-reducing bacteria according to claim 5, characterized in that, In step S3, when the specific primer pair is the first primer pair, calculate the copy number of the gene encoding the electron transport protein in sulfate-reducing bacteria. N The formula is: ; When the specific primer pair is the second primer pair, calculate the copy number of the gene encoding the electron transport protein in sulfate-reducing bacteria. N The formula is: ; When the specific primer pair is the third primer pair, calculate the copy number of the gene encoding the electron transport protein in sulfate-reducing bacteria. N The formula is: .