A molecular marker for detecting wheat stripe rust adult plant resistance gene locus Qyr.hbaas.3AS and breeding application

Abstract

The application discloses a molecular marker for detecting a wheat stripe rust adult plant resistance gene site Qyr.hbaas.3AS and breeding application. The application provides application of single nucleotide polymorphism of a specific SNP site on a wheat genome as a marker in identification or auxiliary identification of stripe rust resistance of wheat, wherein the specific SNP site is located at the 36th position of SEQ ID No. 4 on the short arm of the 3A chromosome of the wheat, and the nucleotide at the SNP site is C or G. The application has important significance for identification of stripe rust resistance of the wheat and cultivation of a wheat variety with persistent stripe rust resistance.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a molecular marker for detecting the resistance gene locus Qyr.hbaas.3AS in mature wheat stripe rust and its application in breeding. Background Technology

[0002] Wheat stripe rust is one of the most devastating diseases of wheat caused by *Puccinia striiformis* f.sp. *Tritici* (Pst). Due to the frequent pathogenic variations of *Puccinia striiformis* and the continuous emergence of new pathogenic races, resistance genes often lose their effectiveness after a certain number of years of breeding. This necessitates reliance on chemical pesticides for control, leading to increasingly serious pesticide residues and environmental pollution. Therefore, discovering new stripe rust-resistant genes and breeding new wheat varieties with durable resistance through gene aggregation is a crucial approach to controlling wheat stripe rust.

[0003] Wheat stripe rust resistance is classified into two types: seedling resistance and mature plant resistance. Seedling resistance manifests as resistance to infection in the early seedling stage and often exhibits race-specificity. Mature plant resistance, on the other hand, is resistance developed later in the plant's growth and development, lacks race-specificity, is less susceptible to physiological races, and exhibits durable resistance. To date, 84 stripe rust resistance gene loci have been formally named, and hundreds of quantitative trait loci associated with stripe rust resistance have been located on different chromosomes. However, with variations in the virulence of physiological races, some resistance genes have gradually lost their efficacy. In particular, the newly discovered pathogenic race CRY34 in Gansu in 2009 led to the loss of resistance in Yr24, Yr10, and the Guinong and Nannong 92R lineage varieties. Currently, only a few major resistance genes, such as Yr5 and Yr15, are effective against the prevalent physiological race CRY34. Therefore, identifying new Fusarium head blight resistant materials and their related gene loci is an important aspect of wheat stripe rust resistance breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for detecting the wheat stripe rust resistance gene locus Qyr.hbaas.3AS at the adult stage and its application in breeding.

[0005] In a first aspect, the present invention claims protection for the use of single nucleotide polymorphisms at specific SNP sites on the wheat genome as markers in any of the following:

[0006] (A1) To identify or assist in the identification of wheat stripe rust resistance;

[0007] (A2) Prepare products for identifying or assisting in the identification of wheat stripe rust resistance;

[0008] (A3) Compare the resistance of the tested wheat to stripe rust;

[0009] (A4) Prepare products for comparing the stripe rust resistance of wheat to be tested;

[0010] (A5) Select and breed wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust;

[0011] (A6) Prepare products for breeding wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust;

[0012] (A7) Screening and removing wheat plants with relatively weak resistance to stripe rust;

[0013] (A8) Prepare products for screening and eliminating wheat plants with relatively weak resistance to stripe rust;

[0014] The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is either C or G. The specific SNP site corresponds to physical location 13572756 bp in the wheat reference genome Chinese Spring IWGSC RefSeq v1.0 (https: / / wheat-urgi.versailles.inra.fr / Seq-Repository / Assemblies) (hereinafter the same).

[0015] Secondly, the present invention claims protection for the use of a substance for detecting single nucleotide polymorphisms at specific SNP sites on the wheat genome in any of the following:

[0016] (A1) To identify or assist in the identification of wheat stripe rust resistance;

[0017] (A2) Prepare products for identifying or assisting in the identification of wheat stripe rust resistance;

[0018] (A3) Compare the resistance of the tested wheat to stripe rust;

[0019] (A4) Prepare products for comparing the stripe rust resistance of wheat to be tested;

[0020] (A5) Select and breed wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust;

[0021] (A6) Prepare products for breeding wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust;

[0022] (A7) Screening and removing wheat plants with relatively weak resistance to stripe rust;

[0023] (A8) Prepare products for screening and eliminating wheat plants with relatively weak resistance to stripe rust;

[0024] The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G.

[0025] The substance used to detect single nucleotide polymorphisms at specific SNP sites on the wheat genome may be the KASP primers described in the third aspect below or the reagents or kits described in the fourth aspect below.

[0026] Thirdly, the present invention claims protection for KASP primers used to identify or assist in the identification of wheat stripe rust resistance.

[0027] This invention claims a KASP primer for identifying or assisting in the identification of wheat stripe rust resistance, comprising primer 1, primer 2, and primer 3; primer 1 is a single-stranded DNA with fluorescent tag sequence A and positions 22-43 of SEQ ID No. 1 sequentially from the 5' end to the 3' end; primer 2 is a single-stranded DNA with fluorescent tag sequence B and positions 22-43 of SEQ ID No. 2 sequentially from the 5' end to the 3' end; primer 3 is a single-stranded DNA with the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing.

[0028] Furthermore, the fluorescent tag sequence A is the fluorescent tag sequence FAM, and its nucleotide sequence is positions 1-21 of SEQ ID No. 1; the fluorescent tag sequence B is the fluorescent tag sequence HEX, and its nucleotide sequence is positions 1-21 of SEQ ID No. 2;

[0029] Furthermore, primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1; primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 2.

[0030] Fourthly, the present invention claims protection for reagents or kits used to identify or assist in the identification of wheat stripe rust resistance.

[0031] The reagent kit claimed in this invention contains the reagent described above; the reagent contains the KASP primers described in the third aspect above.

[0032] Fifthly, this invention claims protection for a DNA molecule.

[0033] The DNA molecule claimed in this invention is such as SEQ ID No. 4.

[0034] In SEQ ID No. 4, the 36th position of S is either C or G.

[0035] Sixthly, the present invention claims protection for the use of the KASP primers described in the third aspect above, or the reagents or kits described in the fourth aspect above, or the specific DNA molecules described in the fifth aspect above, in any of the following:

[0036] (A1) To identify or assist in the identification of wheat stripe rust resistance;

[0037] (A2) Prepare products for identifying or assisting in the identification of wheat stripe rust resistance;

[0038] (A3) Compare the resistance of the tested wheat to stripe rust;

[0039] (A4) Prepare products for comparing the stripe rust resistance of wheat to be tested;

[0040] (A5) Select and breed wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust;

[0041] (A6) Prepare products for breeding wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust;

[0042] (A7) Screening and removing wheat plants with relatively weak resistance to stripe rust;

[0043] (A8) Prepare products for screening and eliminating wheat plants with relatively weak resistance to stripe rust;

[0044] (A9) Wheat breeding.

[0045] In (A9), the purpose of the breeding is to obtain wheat varieties with stronger resistance to stripe rust.

[0046] Seventhly, the present invention claims protection for any of the following methods:

[0047] Method I: A method for comparing stripe rust resistance of wheat to be tested, which may include the following steps: detecting nucleotides at specific SNP sites on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and determining the stripe rust resistance of the wheat to be tested according to the genotype of the wheat to be tested as follows: the stripe rust resistance of the wheat to be tested with the G:G genotype is stronger or candidate stronger than the stripe rust resistance of the wheat to be tested with the C:C genotype;

[0048] The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G;

[0049] The G:G genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is G;

[0050] The C:C genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is C.

[0051] Method II: A method for breeding wheat plants, lines, strains, or varieties with relatively strong resistance to stripe rust may include the following steps: detecting nucleotides at specific SNP sites on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, selecting the wheat to be tested with the G:G genotype as the parent for breeding, and selecting wheat with the G:G genotype in each generation of breeding, and finally obtaining wheat plants, lines, strains, or varieties with relatively strong resistance to stripe rust;

[0052] The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G;

[0053] The G:G genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is G.

[0054] Method III: A method for screening and removing wheat plants with relatively weak resistance to stripe rust may include the following steps: detecting nucleotides at specific SNP sites on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and screening out and removing the wheat plants with the C:C genotype.

[0055] The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G;

[0056] The C:C genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is C.

[0057] In the above method, the detection of nucleotides at the specific SNP sites on the genome of the wheat to be tested can be accomplished by direct sequencing, or by a method including the following steps: PCR amplification of the genomic DNA of the wheat to be tested using the reagents or kits described in the fourth aspect above, scanning the fluorescence signal of the amplified product, and then determining the genotype of the specific SNP site in the genome of the wheat to be tested as follows: if the fluorescence signal of the amplification product of the wheat to be tested is the signal corresponding to the fluorescent tag sequence A, then the wheat to be tested is of genotype C:C; if the fluorescence signal of the amplification product of the wheat to be tested is the signal corresponding to the fluorescent tag sequence B, then the wheat to be tested is of genotype G:G.

[0058] In one embodiment of the present invention, the stripe rust resistance is resistance to stripe rust races CYR32, CYR33 and / or CYR34.

[0059] Among the aforementioned relevant aspects, the stripe rust resistance refers to the resistance of wheat to stripe rust at the mature stage.

[0060] In this invention, the wheat may be selected from Jingzhou 66 and Aikang 58 or their hybrid offspring (such as the DH family).

[0061] This invention uses the wheat variety Jingzhou 66, which exhibits stable resistance to wheat stripe rust, as material to construct a double haploid population of Jingzhou 66 / Aikang 58, comprising 209 families. Genotypic analysis of the population was performed using the wheat 55K SNP chip. Combined with stripe rust resistance phenotypic data from five environments, a novel stripe rust resistance gene locus, Qyr.hbaas.3AS, was identified. This locus contributes up to 12.5% ​​to stripe rust resistance. Families containing this locus showed a 20.1% reduction in maximum disease severity compared to those without, with an average reduction of 14.57% across different environments. Based on the SNP differences at this locus, the KASP marker KASP-3812 was developed for breeding purposes, laying the foundation for molecular marker-based breeding of wheat stripe rust resistance using this locus. Attached Figure Description

[0062] Figure 1 This is for the validation of KASP-3812 on 209 DH population lines. Blue dots (corresponding to FAM) represent the CC genotype, which is the susceptible genotype; green dots (corresponding to HEX) represent the GG genotype, which is the resistant genotype. Detailed Implementation

[0063] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0064] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0065] The wheat variety Jingzhou 66 is described in the book "Hubei Wheat" (chief editor: Ao Liwan). It is available to the public from the applicant and can only be used for repeating experiments of this invention; it may not be used for other purposes. Jingzhou 66 has been identified as a wheat variety resistant to stripe rust.

[0066] The wheat variety Aikang 58 was bred by the Wheat Breeding Center of Henan University of Science and Technology using Zhoumai 11 × Wenmai 6 × Zhengzhou 8960, and has been approved as a national wheat variety (approval number: Guoshenmai 2005008). Aikang 58 is a wheat variety resistant to stripe rust (based on results from national wheat regional trials).

[0067] The wheat variety Emai 580 was bred by the Institute of Food Crops, Hubei Academy of Agricultural Sciences, and approved by the Hubei Provincial Crop Approval Committee in 2012, with approval number: E Shen Mai 2012001. Emai 580 is a wheat variety susceptible to striperust (Reference: Molecular characterization and validation of adult-plant striperust resistance gene Yr86 in Chinese wheat cultivar Zhongmai 895, Theoretical and Applied Genetics (2023) 136:142).

[0068] Wheat stripe rust races CYR32, CYR33 and CYR34: a gift from Researcher Yang Lijun of the Institute of Plant Protection and Soil Fertilizer, Hubei Academy of Agricultural Sciences.

[0069] Example 1: Molecular markers for detecting the wheat stripe rust resistance gene locus Qyr.hbaas.3AS at the adult stage and its application in breeding.

[0070] I. Materials and Methods

[0071] 1. Test materials

[0072] A population of 209 double haploid (DH) lines was constructed using wheat varieties Jingzhou 66 and Aikang 58 as parents.

[0073] 2. Test methods

[0074] (1) Field phenotypic identification of stripe rust

[0075] In the 2018-2019 and 2019-2020 seasons, parental lines and population strains were planted in Wuhan, Ezhou (Hubei Province), Yangling (Shaanxi Province), and Chongzhou (Sichuan Province), respectively. In the experimental area, the susceptible variety Emai 580 was planted in every 20 rows as induction lines. The physiological races of wheat stripe rust fungus CYR32, CYR33, and CYR34 were mixed (CYR34 accounted for 1 / 2, and CYR32 and CYR33 each accounted for 1 / 4, depending on the prevalence). Inoculation was performed at the jointing stage using a spray method, i.e., a 0.02% Tween-20 solution was used to suspend the fungal powder, which was then sprayed onto the leaves to be inoculated. The leaves were covered with a film to retain moisture, and the film was removed at 9:00 AM the next day. The experiment used a completely randomized block design with two replicates, single-row plots, row length 1m, row spacing 0.25m, 50 seeds sown per row, and two rows of parental lines were added every 18 rows as controls. When the stripe rust severity of the susceptible wheat variety Emai 580 reached its maximum, the disease severity (DS) of the flag leaf was investigated for each family. The specific recording standard was based on Peterson et al. 1948 (Peterson RF, Campbell AB, Hannah AE (1948) A diagrammatic scale for estimating rust intensity of leaves and stems of cereals. Can J Res 26:496–500). The investigation was repeated every other week for a total of two investigations. A higher DS value indicates a more severe stripe rust disease, meaning the wheat is more susceptible to stripe rust; a lower DS value indicates a less severe stripe rust disease, meaning the wheat is more resistant to stripe rust.

[0076] (2) Genotype analysis and genetic map construction

[0077] DNA was extracted from wheat DH population lines and parents using the CTAB method. Genotyping analysis was performed using a wheat 55K SNP microarray, retaining only poly-high markers. Differential and homozygous markers among parents were then selected. After removing duplicates using Icimapping 4.1 software, a genome map was constructed using Joinmap 4.0.

[0078] (3) QTL positioning and tagging development

[0079] Phenotypic data from five environments were used to perform QTL mapping with an LOD value set to 2.5 using Icimapping 4.1 software. Based on the flanking marker sequences and SNP differences of the located QTL sites, specific KASP markers were developed using the website (https: / / www.polymarker.tgac.ac.uk), and the accuracy of the KASP markers was validated in a DH population. The KASP marker PCR reaction conditions were as follows: a 10.0 μL system containing 50.0 ng DNA, 5.0 μL Master mix (2×) (Beijing Jiacheng Biotechnology Co., Ltd.), 1.4 μL primer mixture, and 2.6 μL ddH2O. The PCR program was 95℃ for 15 min, 10 cycles (95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 57℃), followed by 35 cycles (95℃ for 20 s, 57℃ for 1 min). Signal readings were then performed on a TECAN Infinite M1000. Scatter plots can be generated using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ).

[0080] II. Results and Analysis

[0081] 1. Analysis of stripe rust resistance phenotypes

[0082] Analysis of the resistance phenotype data of parents and population lines in five environments showed that the population resistance was continuously distributed across different environments, which is a typical quantitative trait inheritance.

[0083] 2. Location of stripe rust resistance gene loci

[0084] Six QTL loci associated with stripe rust were located on different chromosomes. Among them, the locus Qyr.hbaas.3AS, located on the short arm of 3A, could be detected in four different environments, contributing 6.8-12.5% ​​to the phenotype. Its resistance was derived from the wheat variety Jingzhou 66. The flanking markers of this locus were AX-108813812 and AX-110587728. Referring to the Chinese spring reference genome sequence IWGSC RefSeq v1.0, the physical location of this marker on the chromosome is between 13.5-15.5 Mb.

[0085] 3. Development and Validation of KASP Tags

[0086] Based on the sequence information of the Qyr.hbaas.3AS site linkage marker AX-108813812: 5'-CATGCAGAAGGAATCGGTACCTCCTCTTCATCCTCSGAATTTTTAGAATCCAGACTCTCCGCCAATCCATC-3' (SEQ ID No. 4, where "S" represents an SNP site, specifically C or G), a KASP molecular marker was developed and named KASP-3812. The primer sequence for this marker is as follows:

[0087] KASP-3812A: 5'- GAAGGTGACCAAGTTCATGCT CGGTACCTCCTCTTCATCCTCC-3' (SEQ ID No. 1, the underlined part is the specific fluorescent tag sequence FAM);

[0088] KASP-3812B: 5'- GAAGGTCGGAGTCAACGGATT CGGTACCTCCTCTTCATCCTCG-3' (SEQ ID No. 2, the underlined part is the specific fluorescent tag sequence HEX);

[0089] KASP-3812C: 5'-GATGATGGATTGGCGGAGAG-3' (SEQ ID No. 3).

[0090] KASP-3812A and KASP-3812B are forward primers, recognizing the differential bases C and G, respectively, while KASP-3812C is a universal reverse primer. The detection signal for samples carrying C bases at SNP sites is FAM, and the detection signal for samples carrying G bases is HEX.

[0091] If the wheat being tested shows a FAM signal at the SNP site marked by KASP-3812, then the genotype of the wheat being tested is CC homozygous, consistent with Aikang 58; if the wheat being tested shows a HEX signal at the SNP site marked by KASP-3812, then the genotype of the wheat being tested is GG homozygous, consistent with Jingzhou 66.

[0092] The validation results of KASP-3812 on 209 DH population lines are as follows: Figure 1 As shown. Blue dots (corresponding to FAM) represent the CC genotype, which is the susceptible genotype; green dots (corresponding to HEX) represent the GG genotype, which is the resistant genotype.

[0093] 4. Validation of the KASP-3812 marker in 209 DH family pedigrees

[0094] Based on the stripe rust resistance identification results of 209 family groups in different environments, it can be seen that there are significant differences between the resistant genotype (GG genotype) and the susceptible genotype (CC genotype) lines. The stripe rust severity of the resistant genotype (GG genotype) lines is significantly lower than that of the susceptible genotype (CC genotype) lines (Tables 1 and 2).

[0095] Meanwhile, the developed KASP-3812 marker was used to analyze the genotypes at this locus in 209 strains. The results showed that the genotypes of two families could not be determined (strains w63 and w73), and only one family (w107) had a genotype inconsistent with the chip results. The newly developed marker KASP-3812 achieved a consistency rate of 99.5% with the chip detection results, and can be used for SNP difference detection at this gene locus, and effectively distinguish whether the target material carries the resistance gene locus.

[0096] Table 1. Severity of stripe rust in the 209DH family in five different environments, and results of microarray genotyping and KASP-3812 genotyping.

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] Note: AE represents the severity of stripe rust in Wuhan in 2020; the severity of stripe rust in Ezhou in 2020; the severity of stripe rust in Yangling in 2020; the severity of stripe rust in Sichuan in 2020; and the severity of stripe rust in Ezhou in 2019, respectively. NA indicates not detected.

[0104] Table 2. Statistical analysis of the differences in stripe rust severity (DS) among different genotypes in the 209DH population.

[0105]

[0106] Note: ** indicates a highly significant difference.

[0107] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of single nucleotide polymorphisms at specific SNP sites on the wheat genome as markers in any of the following: (A1) To identify or assist in the identification of wheat stripe rust resistance; (A2) Prepare products for identifying or assisting in the identification of wheat stripe rust resistance; (A3) Compare the resistance of the tested wheat to stripe rust; (A4) Prepare products for comparing the stripe rust resistance of wheat to be tested; (A5) Select and breed wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust; (A6) Prepare products for breeding wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust; (A7) Screening and removing wheat plants with relatively weak resistance to stripe rust; (A8) Prepare products for screening and eliminating wheat plants with relatively weak resistance to stripe rust; The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G.

2. The application of a substance for detecting single nucleotide polymorphisms at specific SNP sites on the wheat genome in any of the following: (A1) To identify or assist in the identification of wheat stripe rust resistance; (A2) Prepare products for identifying or assisting in the identification of wheat stripe rust resistance; (A3) Compare the resistance of the tested wheat to stripe rust; (A4) Prepare products for comparing the stripe rust resistance of wheat to be tested; (A5) Select wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust; (A6) Prepare products for breeding wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust; (A7) Screening and removing wheat plants with relatively weak resistance to stripe rust; (A8) Prepare products for screening and eliminating wheat plants with relatively weak resistance to stripe rust; The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G.

3. The application according to claim 1 or 2, characterized in that: The substance used to detect single nucleotide polymorphisms at specific SNP sites on the wheat genome is the KASP primer as described in claim 4 or the reagent or kit as described in claim 5.

4. KASP primers for identifying or assisting in the identification of wheat stripe rust resistance, comprising primer 1, primer 2, and primer 3; primer 1 is a single-stranded DNA consisting of fluorescent tag sequence A and positions 22-43 of SEQ ID No. 1, sequentially from the 5' end to the 3' end; primer 2 is a single-stranded DNA consisting of fluorescent tag sequence B and positions 22-43 of SEQ ID No. 2, sequentially from the 5' end to the 3' end; primer 3 is a single-stranded DNA with the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing. Furthermore, the fluorescent tag sequence A is the fluorescent tag sequence FAM, and its nucleotide sequence is positions 1-21 of SEQ ID No. 1; the fluorescent tag sequence B is the fluorescent tag sequence HEX, and its nucleotide sequence is positions 1-21 of SEQ ID No. 2; Furthermore, primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1; primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No.

2.

5. A reagent or kit for identifying or assisting in the identification of wheat stripe rust resistance, characterized in that: The kit contains the reagent described herein; the reagent contains the KASP primers as described in claim 4.

6. DNA molecules, as shown in SEQ ID No.

4.

7. The use of the KASP primer of claim 4, the reagent or kit of claim 5, or the DNA molecule of claim 6 in any of the following: (A1) To identify or assist in the identification of wheat stripe rust resistance; (A2) Prepare products for identifying or assisting in the identification of wheat stripe rust resistance; (A3) Compare the resistance of the tested wheat to stripe rust; (A4) Prepare products for comparing the stripe rust resistance of wheat to be tested; (A5) Select wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust; (A6) Prepare products for breeding wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust; (A7) Screening and removing wheat plants with relatively weak resistance to stripe rust; (A8) Prepare products for screening and eliminating wheat plants with relatively weak resistance to stripe rust; (A9) Wheat breeding.

8. Any of the following methods: Method I: A method for comparing the resistance of wheat to stripe rust, comprising the following steps: Nucleotides at specific SNP sites on the genome of the wheat to be tested are detected to determine the genotype of the wheat to be tested. Based on the genotype of the wheat to be tested, the stripe rust resistance of the wheat to be tested is determined as follows: the stripe rust resistance of the wheat to be tested with the G:G genotype is stronger or candidate stronger than that of the wheat to be tested with the C:C genotype. The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G; The G:G genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is G; The C:C genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is C; Method II: A method for breeding wheat individual plants, lines, strains, or varieties with relatively strong resistance to stripe rust, comprising the following steps: Nucleotides at specific SNP sites on the genome of the wheat to be tested are detected to determine the genotype of the wheat to be tested. The wheat to be tested with the G:G genotype is selected as the parent for breeding. Wheat with the G:G genotype is selected in each generation of breeding to finally obtain wheat single plants, lines, strains or varieties with relatively strong resistance to stripe rust. The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G; The G:G genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is G; Method III: A method for screening and eliminating wheat plants with relatively weak resistance to stripe rust, comprising the following steps: Nucleotides at specific SNP sites on the genome of the wheat to be tested are detected to determine the genotype of the wheat to be tested, and the wheat to be tested with the C:C genotype is screened out and eliminated; The specific SNP site is located at position 36 of SEQ ID No. 4 on the short arm of wheat chromosome 3A, and the nucleotide at this SNP site is C or G; The C:C genotype is a homozygous type where the nucleotide at the specific SNP site on the wheat genome is C.

9. The method according to claim 8, characterized in that: The detection of nucleotides at specific SNP sites on the genome of the wheat to be tested is performed according to a method comprising the following steps: PCR amplification of the genomic DNA of the wheat to be tested using the reagent or kit described in claim 5; scanning of the amplified product for fluorescence signals; and then determining the genotype of the specific SNP site in the genome of the wheat to be tested as follows: if the fluorescence signal of the amplified product of the wheat to be tested corresponds to the signal corresponding to the fluorescent tag sequence A, then the wheat to be tested is of genotype C:C; if the fluorescence signal of the amplified product of the wheat to be tested corresponds to the signal corresponding to the fluorescent tag sequence B, then the wheat to be tested is of genotype G:G.

10. The application, KASP primer, reagent, kit, or method according to any one of claims 1-5 and 7-9, characterized in that: The stripe rust resistance refers to resistance to stripe rust races CYR32, CYR33 and / or CYR34.

Images