KASP molecular marker primer combination for detecting watermelon yellow fruit skin trait, detection method and application
By developing a KASP molecular marker primer combination for yellow watermelon rind and using KASP technology for seedling genotyping, the problems of blind selection and long time consumption in traditional breeding methods were solved, enabling early identification and efficient breeding of the yellow watermelon rind trait.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- 安徽省农业科学院蔬菜研究所
- Filing Date
- 2026-04-23
- Publication Date
- 2026-06-16
AI Technical Summary
Traditional watermelon yellow rind breeding methods suffer from problems such as blind selection and long time consumption. Furthermore, due to gene linkage effects, it is difficult to accurately identify and target the yellow rind trait during the seedling stage, which affects breeding efficiency.
A KASP molecular marker primer combo was developed to detect the yellow rind trait of watermelon. High-throughput molecular detection was performed using KASP technology, and PCR amplification and fluorescence signal detection were carried out by designing specific primers to achieve seedling genotype screening.
It enables early identification of the yellow rind trait in watermelons, improves breeding efficiency, reduces breeding costs, simplifies the operation process, and is suitable for genotype screening of large-scale breeding populations.
Smart Images

Figure CN122214531A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology and relates to the KASP molecular marker primer combination, detection method and application for detecting the yellow peel trait of watermelon. Background Technology
[0002] watermelon( Citrullus lanatus Watermelon is one of the world's most important fresh fruits and a significant economic crop in my country. Peel color is a key indicator for evaluating the appearance quality of watermelon fruit, making yellow peel a crucial direction for the breeding of distinctive watermelon varieties. Traditional hybridization breeding methods rely on natural mutations, which suffer from blind selection and time-consuming processes. Furthermore, due to gene linkage effects, the conversion to yellow peel traits may introduce undesirable traits or result in the loss of superior agronomic traits, severely limiting the efficiency of breeding programs targeting yellow peel. Therefore, developing molecular markers for detecting yellow peel provides a technical means for rapid screening and identification of yellow-peeled germplasm resources at the seedling stage and for accelerating the breeding of superior yellow-peeled new varieties.
[0003] KASP (Kompetitive Allele-Specific PCR) is a competitive allele-specific PCR technique based on touch-down PCR. Utilizing universal fluorescent probes, it can accurately biallelicly genotype target SNPs and InDels in a wide range of genomic DNA samples, including complex ones. KASP markers are characterized by rapid detection, low cost, and ease of large-scale application. They are ideal for genotyping large numbers of samples in the early stages of breeding and are suitable for high-throughput molecular detection platforms. Therefore, identifying functional SNP sites associated with yellow watermelon rind and developing KASP molecular markers suitable for high-throughput molecular detection platforms is of significant application value for improving the breeding efficiency of yellow-rind watermelons. Summary of the Invention
[0004] To address the lack of markers for yellow rind in watermelons, which hinders accurate identification and targeted improvement during the seedling stage, this invention discloses primer combinations, detection methods, and applications for the KASP molecular marker used to detect the yellow rind trait in watermelons. The KASP-YR marker is closely linked to the yellow rind trait in watermelons and can be used to identify and screen yellow-rind watermelon germplasm, providing an auxiliary selection tool for molecular breeding of yellow-rind watermelons and improving breeding efficiency.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a molecular marker primer combination for detecting the yellow peel of watermelon, comprising two specific forward primers and one reverse primer. The sequence of the first forward primer KASP-YR-F-1 is shown in SEQ ID NO:1, the sequence of the second forward primer KASP-YR-F-2 is shown in SEQ ID NO:2, and the sequence of the reverse primer KASP-YR-R is shown in SEQ ID NO:3.
[0006] The 5' end of the first forward primer is connected to the VIC fluorescent tag sequence, and the 5' end of the second forward primer is connected to the FAM fluorescent tag sequence.
[0007] The present invention also provides a kit for detecting KASP molecular markers associated with yellow rind of watermelon, comprising the aforementioned molecular marker primer combination.
[0008] The SEQ ID NO:1 is: 5'- GAAGGTCGGAGTCAACGGATT CTTTGTCATGAATAACATCTTCAATT-3'; The SEQ ID NO:2 is: 5'- GAAGGTGACCAAGTTCATGCT CTTTGTCATGAATAACATCTTCAATC-3'.
[0009] The SEQ ID NO:3 is: 5'-GACCTAAAAAAGGACGGATATAATG-3' Note: A single underscore indicates a VIC fluorescent tag sequence, and a double underscore indicates a FAM fluorescent tag sequence.
[0010] The amplified sequences of the molecular marker primer set are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0011] The SEQ ID NO:4 is: CTTTGTCATGAATAACATCTTCAAT T AAAGCTTCAGAAGTTTCGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC The SEQ ID NO:5 is: CTTTGTCATGAATAACATCTTCAAT C AAAGCTTCAGAAGTTTCGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC Note: The underlined part corresponds to the SNP locus, and the genotype is T / C. The T genotype corresponds to a green peel, and the C genotype corresponds to a yellow peel.
[0012] The present invention also discloses a kit for detecting the KASP molecular marker, comprising the primer pair described above.
[0013] The present invention also aims to provide a method for detecting the yellow rind morphology of watermelon, the method comprising the following steps: (1) Extract genomic DNA from the watermelon plants to be tested; (2) Using the genomic DNA of the watermelon sample to be tested as a template, PCR amplification was performed using the primer combination described in claim 1 to obtain the PCR amplification product; (3) The amplification products from step (2) are subjected to endpoint fluorescence signal detection. The fluorescence values of each sample are read using a fluorescence detection instrument. The genotype of the sample is determined based on the intensity combination of the two fluorescence signals, FAM and VIC. The genotype (T:T) showing only the VIC fluorescent marker color corresponding to KASP-YR-F-1 is a green-skinned watermelon; the genotype (C:C) showing only the FAM fluorescent marker color corresponding to KASP-YR-F-2 is a yellow-skinned watermelon; and the genotype (T:C) showing both the FAM fluorescent marker corresponding to KASP-YR-F-1 and the VIC fluorescent marker corresponding to KASP-YR-F-2 is a heterozygous yellow-skinned watermelon. In this embodiment, the T:T genotype is red, the C:C genotype is blue, and the T:C genotype is green.
[0014] Compared with existing technologies, the KASP molecular marker primer combination, detection method, and application for detecting the yellow rind trait of watermelon provided by this invention have the following beneficial effects: 1. Accurate and Reliable Identification: This invention develops the KASP-YR marker based on the SNP5 locus (T / C) on chromosome 4 of watermelon, which co-segregates with the yellow rind trait. Validation in an F2 segregating population of 891 plants showed a 100% concordance rate between the marker genotype and the field phenotype. Furthermore, in 36 watermelon germplasm resources from different sources, the marker accurately distinguished between yellow-rind and green-rind materials. This indicates that the marker is closely linked to the target trait, and the identification results are stable and reliable.
[0015] 2. Achieving early seedling identification: Using the primer combinations and detection methods provided by this invention, genotyping can be completed from the cotyledon stage to the two-leaf-one-heart stage of watermelon, without waiting for fruit maturity. Compared with traditional breeding methods that rely on fruit phenotypes, this significantly shortens the breeding cycle and reduces field planting and labor costs.
[0016] 3. Simple operation, high throughput, and low cost: This invention uses KASP technology, requiring only conventional PCR amplification and endpoint fluorescence signal reading, without the need for gel electrophoresis. A single reaction system requires only 5 μL, suitable for high-throughput operation in 96-well or 384-well plates, and applicable to genotype screening of large-scale breeding populations.
[0017] 4. Highly practical for assisting breeding: This invention can be directly used for the identification of yellow rind genotypes in watermelon germplasm resources, and can also be used for molecular marker-assisted selection of the yellow rind trait, helping breeders to selectively eliminate green rind genotype (T:T) plants during the seedling stage, and retain homozygous yellow rind (C:C) or heterozygous yellow rind (T:C) plants, thereby improving the breeding efficiency of yellow rind watermelons.
[0018] In summary, this invention provides a simple, accurate, and low-cost technical tool for the early identification of yellow rind traits in watermelons and for molecular marker-assisted breeding, and has good prospects for widespread application. Attached Figure Description
[0019] Figure 1 Phenotypic diagrams of yellow-skinned watermelon maternal material W-21-4-2, green-skinned watermelon paternal material W-21-301, and hybrid F1 generation plants; Figure 2 The images show the conventional PCR amplification and gel electrophoresis detection of the SNP variant sites in this invention for yellow peel material W-21-4-2, green peel material W-21-301, and hybrid F1 generation. Figure 3 Sanger sequencing images of PCR amplification products of SNP variant sites in this invention for yellow peel material W-21-4-2, green peel material W-21-301, and hybrid F1 generation; Figure 4 For the BSA-based watermelon yellow rind gene ClYR Location map; Figure 5 The genotype of KASP-YR for the segregating population W-21-4-2 × W-21-301 F2 is shown in part. Figure 6 The genotyping diagram of KASP-YR from 36 different watermelon samples; Blue indicates the C:C genotype consistent with the yellow-peeled material W-21-4-2; red indicates the T:T genotype consistent with the green-peeled material W-21-301; and green indicates the T:C genotype consistent with F1. Detailed Implementation
[0020] The present invention will be further described below with reference to the accompanying drawings and embodiments. The content of the embodiments is not intended to limit the scope of protection of the present invention.
[0021] 1. The sequence information involved in this invention is summarized as follows: 2. Verification of SNP5 polymorphism Using yellow-skinned watermelon maternal material W-21-4-2, green-skinned watermelon paternal material W-21-301, and hybrid F1 as standard templates (e.g. Figure 1 As shown in the figure, primers were designed based on the SNP (TC) site on chromosome 4 in this invention for routine PCR amplification verification.
[0022] SNP5-F:5'-AACCATGAGTTCCAAAGTGAAGAAC-3' = SEQ ID NO:6 SNP5-R:5'-CAGGCTGAGAAGAAGCTAGCTATAA-3' = SEQ ID NO:7 The amplification product is 523 bp, and the reference sequence is as follows: Sequence 1: AACCATGAGTTCCAAAGTGAAGAACTGCATCAGCCTTGAAGATATTCTCAACATACGAGTAATATGCTGCAAAACCATGATGGGGGCTAGCAGATTTAGAGAAGAGAAGTCTCATCGGATCACCCTCATATCCGAATGTTGGTTGAACACCAATGAAGACATTTC CATATTGCTTTCCATACACCAGCAGATTCTCTCCATCAGAGTTCAAATTACCAGGAGGTTTTCCCAATTCTCTTCCAATGCTGTGGAATAAGGTGTTAATTGTTGGTATTCACGAACATTCATTTTATATGCAATGTTGAGATTGGGGCTGTTGAATTGCGCCT CTTTGTCATGAATAACATCTTCAATTAAAGCTTCAGAAGTTT CGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC TTTTAAGACAGAGAAGATGGATGAGAAGACATTCAAATATGCAGCAGTTCCAACATTTCCCTTATCAGGAGGGAAACTAAAGACAGTTATAGCTAGCTTCTTCTCAGCCTG =SEQ ID NO:8.
[0023] The underlined portion represents the complete sequence of SEQ ID NO:4 (T allele), which is the target product region amplified by the KASP-YR primer combination. Sequence 2: AACCATGAGTTCCAAAGTGAAGAACTGCATCAGCCTTGAAGATATTCTCAACATACGAGTAATATGCTGCAAAACCATGATGGGGGCTAGCAGATTTAGAGAAGAGAAGTCTCATCGGATCACCCTCATATCCGAATGTTGGTTGAACACCAATGAAGACATTTC CATATTGCTTTCCATACACCAGCAGATTCTCTCCATCAGAGTTCAAATTACCAGGAGGTTTTCCCAATTCTCTTCCAATGCTGTGGAATAAGGTGTTAATTGTTGGTATTCACGAACATTCATTTTATATGCAATGTTGAGATTGGGGCTGTTGAATTGCGCCT CTTTGTCATGAATAACATCTTCAATCAAAGCTTCAGAAGTTT CGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC TTTTAAGACAGAGAAGATGGATGAGAAGACATTCAAATATGCAGCAGTTCCAACATTTCCCTTATCAGGAGGGAAACTAAAGACAGTTATAGCTAGCTTCTTCTCAGCCTG =SEQ ID NO:9.
[0024] The underlined sequence is the complete sequence of SEQ ID NO:5 (the KASP amplification product corresponding to the C allele).
[0025] The amplification products were subjected to agarose gel electrophoresis, such as... Figure 2 As shown, the results indicated the amplification of a single, correctly sized band. The PCR product was then subjected to Sanger sequencing (e.g., [example needed]). Figure 3 As shown, the sequencing results were compared with SEQ ID NO:4 and 5. The sequencing results confirmed that the amplified product sequences contained SEQ ID NO:4 / 5, and the genotypes at the target SNP site (291393rd position on chromosome 4 of watermelon) were T:T, C:C, and heterozygous T:C, respectively. Based on this SNP site, a KASP-YR marker was developed for subsequent high-throughput genotyping of samples. Underlined sequences are those consistent with subsequent KASP-YR amplified products; bold underlines are used. T / C Label the target SNP sites.
[0026] Note: The length of the SNP5 amplified sequence here is different from that of the KASP-YR amplified sequence, but the former contains the complete sequence of the latter. This is because sequences that are too short cannot be detected by Sanger sequencing.
[0027] Example 1 Obtaining KASP molecular markers for detecting the yellow rind trait of watermelon (1) Obtaining and genetically analyzing the yellow rind trait of watermelon This experiment used the watermelon high-generation inbred lines W-21-4-2, W-21-301, and W-21-129 as experimental materials. W-21-4-2 exhibited a yellowish-green ovary (fruit) pericarp, which gradually turned yellow after pollination, reaching a completely yellow color in the young fruit stage without stripes. The flesh was red, and the fruit shape was oval. The petioles, veins, and stems of W-21-4-2 also showed a yellow phenotype. W-21-301 maintained a green pericarp with light, fine stripes throughout its growth period, with red flesh and a high-round shape. Its petioles, veins, and stems remained green throughout the entire growth cycle. W-21-129 also maintained a green pericarp throughout its growth period, with red flesh, an oblong shape, and light, fine stripes. Its petioles, veins, and stems remained green throughout the entire growth cycle. Using W-21-4-2 as the female parent, crosses were conducted with W-21-301 and W-21-129 as male parents to obtain F1 plants. After self-pollination, segregating F2 populations of W-21-4-2 × W-21-301 and W-21-4-2 × W-21-129 were obtained. Both F1 plants exhibited yellow pericarps, indicating that yellow pericarps were the dominant trait. In the W-21-4-2 × W-21-301 F2 segregating population, 659 plants exhibited yellow pericarp, and 232 plants exhibited green pericarp. In the W-21-4-2 × W-21-129 F2 segregating population, 206 plants exhibited yellow pericarp, and 78 plants exhibited green pericarp. Genetic analysis showed that in both the W-21-4-2 × W-21-301 and W-21-4-2 × W-21-129 F2 segregating populations, the chi-square test showed a segregation ratio of 3:1 for yellow pericarp to green pericarp, consistent with Mendelian laws of inheritance. Therefore, yellow pericarp is considered a dominant quality trait.
[0028] (2) Extraction of watermelon genomic DNA Total DNA was extracted from the leaves of the parents, F1, and all F2 segregating populations using the conventional CTAB method.
[0029] (3) The gene for yellow rind of watermelon was initially located using the BSA-seq method. Population segregation method (BSA) was used to randomly select 30 plants each of extreme yellow peel and extreme green peel from the W-21-4-2 × W-21-301 and W-21-4-2 × W-21-129 F2 segregating populations to establish a yellow peel pool (YR-pool) and a green peel pool (GR-pool). High-throughput sequencing was performed using Illumina HiSeq 4000 (Novogene, Beijing, China). After removing low-quality sequencing reads, a sliding window analysis with a window size of 1 MB and an increment of 1 Kb was used to calculate the SNP index of the two populations, obtaining ΔSNP-index. The larger the absolute value of ΔSNP-index, the greater the probability of linkage with the trait. A 60% confidence interval threshold was drawn; values exceeding the threshold were considered significant and considered candidate regions. Combining the SNP-index curve and chi-square distribution results, we identified the potential candidate region as the 0–6.5 Mb region of chromosome 4 of watermelon (e.g., ...). Figure 4 (As shown).
[0030] (4) Fine mapping of candidate genes and development of linkage markers Use W-21-4-2 × W-21-301 F 2:3 Fine-tuning of the family pedigree was performed. First, whole-genome resequencing was conducted on both parents. Sequencing data were analyzed to identify indels and SNP differences within the initially mapped regions. Sequences flanking the differentially expressed sites were extracted, and primers were designed using Premier 5.0 software. PCR amplification was performed between the two parents. Indel markers were detected by 6% denaturing polyacrylamide gel electrophoresis, and SNP markers were detected for polymorphism using first-generation Sanger sequencing. Eleven primer pairs showed polymorphism (6 pairs of indel markers and 5 pairs of SNP markers). A F1 genome containing 1345 individual strains was used. 2:3 The pedigree was further screened using 11 pairs of polymorphic primers to look for differences between marker genotypes and phenotypic traits, and the marker and yellow peel gene were obtained. YR The recombinant plants were identified through crossover. Polymorphic markers flanking the gene gradually shifted towards fewer crossover plants, narrowing the target region to between primers YR-SNP-4 and YR-Indel-6, while no recombinant plants were identified with marker YR-SNP5. Using JoinMap 4.0 software, the Indel marker results were combined with plant phenotypic mapping, indicating that the yellow pericarp gene... ClYRThe co-segregation with the YR-SNP5 marker indicates that the yellow rind trait of watermelon is closely linked to the YR-SNP5 marker. The SNP5 site is located at nucleotide 291393 on chromosome 4 of the reference sequence of the watermelon '97103 v2' genome version, which is included in the Cucurbitaceae genomics database CuGenDB (http: / / cucurbitgenomics.org / organism / 21) and exhibits T / C polymorphism. Based on this SNP5 site, a KASP-YR molecular marker primer combination was designed. The KASP-YR marker includes two specific forward primers and one reverse primer. The sequence of the first forward primer KASP-YR-F-1 is shown in SEQ ID NO:1, the sequence of the second forward primer KASP-YR-F-2 is shown in SEQ ID NO:2, and the sequence of the reverse primer KASP-YR-R is shown in SEQ ID NO:3. The sequences of the amplification products are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0031] The SEQ ID NO:1 is: 5'- GAAGGTCGGAGTCAACGGATT CTTTGTCATGAATAACATCTTCAATT-3'; The SEQ ID NO:2 is: 5'- GAAGGTGACCAAGTTCATGCT CTTTGTCATGAATAACATCTTCAATC-3'.
[0032] The SEQ ID NO:3 is: 5'-GACCTAAAAAAGGACGGATATAATG-3' Note: A single underscore indicates a VIC fluorescent tag sequence, and a double underscore indicates a FAM fluorescent tag sequence.
[0033] The SEQ ID NO:4 is: CTTTGTCATGAATAACATCTTCAAT T AAAGCTTCAGAAGTTTCGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC The SEQ ID NO:5 is: CTTTGTCATGAATAACATCTTCAAT C AAAGCTTCAGAAGTTTCGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC Note: The underlined part corresponds to the SNP locus, and the genotype is T / C. The T genotype corresponds to a green peel, and the C genotype corresponds to a yellow peel.
[0034] Example 2 Application of KASP-YR labeled primers in the identification of yellow rind characteristics of watermelon.
[0035] The marker primers KASP-YR of this invention were used for PCR amplification and sequencing detection in watermelon yellow-peel maternal parent W-21-4-2, green-peel paternal parent W-21-301, and F1 and F2 populations. Phenotypic identification methods were used as controls to examine the accuracy of the primers provided by this invention for identifying the yellow-peel trait in watermelons. The specific methods are as follows: (1) Extract genomic DNA from the watermelon to be tested.
[0036] (2) The primers of the present invention were added to the PCR reaction system, and the DNA of the watermelon genome was amplified by PCR; The reaction system for PCR amplification is shown in Table 1; the PCR amplification procedure is shown in Table 2.
[0037] The primer pair includes two forward primers, KASP-YR-F-1 and KASP-YR-F-2, and one reverse primer, KASP-YR-R. The sequence of the first forward primer, KASP-YR-F-1, is shown in SEQ ID NO:1; the sequence of the second forward primer, KASP-YR-F-2, is shown in SEQ ID NO:2; the sequence of the reverse primer, KASP-YR-R, is shown in SEQ ID NO:3; and the sequences of the amplification products are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0038] The SEQ ID NO:1 is: 5'- GAAGGTCGGAGTCAACGGATT CTTTGTCATGAATAACATCTTCAATT-3'; The SEQ ID NO:2 is: 5'- GAAGGTGACCAAGTTCATGCT CTTTGTCATGAATAACATCTTCAATC-3'.
[0039] The SEQ ID NO:3 is: 5'-GACCTAAAAAAGGACGGATATAATG-3' Note: A single underscore indicates a VIC fluorescent tag sequence, and a double underscore indicates a FAM fluorescent tag sequence.
[0040] The SEQ ID NO:4 is: CTTTGTCATGAATAACATCTTCAAT T AAAGCTTCAGAAGTTTCGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC The SEQ ID NO:5 is: CTTTGTCATGAATAACATCTTCAAT C AAAGCTTCAGAAGTTTCGGGAAGGCCTTCAACATTATATCCGTCCTTTTTTAGGTC Note: The underlined part corresponds to the SNP locus, and the genotype is T / C. The T genotype corresponds to a green peel, and the C genotype corresponds to a yellow peel.
[0041] (3) After PCR amplification, the fluorescence values of each sample were read using a fluorescence detection instrument. The genotype of the sample was determined based on the intensity combination of the two fluorescence signals, FAM and VIC. The genotype (T:T) showing only the VIC fluorescent marker color corresponding to KASP-YR-F-1 was a green-skinned watermelon; the genotype (C:C) showing only the FAM fluorescent marker color corresponding to KASP-YR-F-2 was a yellow-skinned watermelon; and the genotype (T:C) showing both the FAM fluorescent marker corresponding to KASP-YR-F-1 and the VIC fluorescent marker corresponding to KASP-YR-F-2 was a heterozygous yellow-skinned watermelon. In this example, the T:T genotype was red, the C:C genotype was blue, and the T:C genotype was green (the genotyping results of some samples are shown in the figure). Figure 5 (As shown in the table). The specific identification results are shown in Table 3.
[0042] Table 3. Results of the identification of yellow rind trait in 921 watermelon samples using the KASP-YR labeled primers of the present invention. Note: The 921 watermelon samples included 10 plants from each of the two parent lines, 10 F1 plants, and 891 F2 segregating populations.
[0043] As shown in Table 3, all plants with the C:C genotype exhibited a yellow rind phenotype, while all plants with the T:T genotype exhibited a green rind phenotype. Plants with the T:C genotype also exhibited a yellow rind phenotype (yellow rind is a dominant trait controlled by a single gene). The accuracy of the identification results was 100%. The KASP-YR marker primers provided in this invention can be used for the identification of the yellow rind trait in watermelons.
[0044] Example 3 The 36 selected watermelon germplasm resources included: 9 mainstream domestic green-skinned cultivars (such as Zaochun Hongyu, Zaojia 8424, and Meidu), 9 yellow-skinned cultivars, and 18 inbred lines preserved by our research group. The rind color of these materials was identified through field phenotypic testing, as shown in Table 4. PCR amplification and fluorescence detection were performed on the yellow-skinned maternal parent W-21-4-2 and the green-skinned paternal parent W-21-301 and their F1 cells to identify their genotypes and examine the accuracy of the primers provided in this invention for identifying the yellow rind trait in watermelons. The specific detection method was the same as in Example 2.
[0045] Table 4. Statistics on pericarp color of 36 materials used for KASP-YR marker typing Depend on Figure 6 The results showed that among the 36 watermelon inbred lines, 9 shared the same genotype (T:T) as the green-peeled maternal parent W-21-301, 26 shared the same genotype (C:C) as the yellow-peeled maternal parent W-21-4-2, and 1 shared the same genotype (T:C) as the F1 generation. This result indicates that the KASP-YR marker primers provided in this invention can distinguish between materials with yellow-peeled and green-peeled phenotypes.
[0046] The results of the above embodiments show that the KASP-YR-labeled primers provided by the present invention for the identification of yellow rind characteristics of watermelon are not only accurate in identification results, but also simple and efficient, and can be used for the early identification of yellow rind characteristics of watermelon.
[0047] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments.
[0048] The above embodiments of the present invention are merely examples for clearly illustrating the present invention and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. A molecular marker primer combination for detecting the yellow rind trait of watermelon, characterized in that, The KASP-YR primer combination includes two specific forward primers and one reverse primer. The sequence of the first forward primer KASP-YR-F-1 is shown in SEQ ID NO:1, the sequence of the second forward primer KASP-YR-F-2 is shown in SEQ ID NO:2, and the sequence of the reverse primer KASP-YR-R is shown in SEQ ID NO:
3.
2. The molecular marker primer combination according to claim 1, characterized in that, The 5' end of the first forward primer is connected to the VIC fluorescent tag sequence, and the 5' end of the second forward primer is connected to the FAM fluorescent tag sequence.
3. The primer according to claim 1, characterized in that, The first forward primer contains the specific nucleotide sequence shown in SEQ ID NO:1 from position 22 to 47 starting from the 5' end, the second forward primer contains the specific nucleotide sequence shown in SEQ ID NO:2 from position 22 to 47 starting from the 5' end, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:
3.
4. A reagent kit for detecting yellow rind of watermelon, characterized in that, Includes the molecular marker primer combination as described in any one of claims 1 to 3.
5. A method for identifying the yellow rind of a watermelon, characterized in that, Includes the following steps: (1) Extract genomic DNA from the watermelon plants to be tested; (2) Using the genomic DNA of the watermelon sample to be tested as a template, PCR amplification was performed using the primer combination described in claim 1 to obtain the PCR amplification product; (3) The amplification products in step (2) were subjected to endpoint fluorescence signal detection. Only the genotype (T:T) corresponding to the fluorescent marker color of KASP-YR-F-1 was shown to be green watermelon; only the genotype (C:C) corresponding to the fluorescent marker color of KASP-YR-F-2 was shown to be yellow watermelon; and the genotype (T:C) corresponding to both the fluorescent markers of KASP-YR-F-1 and KASP-YR-F-2 was shown to be heterozygous yellow watermelon. The genotypes were displayed in different colors on the genotyping chart: red for T:T genotype, blue for C:C genotype, and green for T:C genotype.
6. The identification method according to claim 5, characterized in that, Dilute to 10 μM with TE (pH 8.0), then mix with the first forward primer KASP-YR-F-1 : the second forward primer KASP-YR-F-2 : the reverse universal primer KASP-YR-R in a ratio of 1:1:3 before loading the mixture onto the instrument. Add 1.25 μL of primer mixture to every 5 μL of reaction system. The PCR amplification reaction system is shown in Table 1: Table 1 PCR reaction system The PCR amplification procedure is shown in Table 2: Table 2 PCR amplification program 。 7. The application of the SNP primer combination of claim 1 in any of the following aspects (1) to (3): (1) Application in identifying or assisting in the identification of yellow rind of watermelon; (2) Application in the preparation of a kit for identifying yellow pericarps; (3) Application in molecular marker-assisted breeding of yellow-skinned watermelons.
8. The use of the kit according to claim 4 in at least one of the following: (1) Application in identifying or assisting in the identification of yellow rind of watermelon; (2) Application in molecular marker-assisted breeding of yellow-skinned watermelon.
9. The method according to claim 5, characterized in that, The identification was completed during the period from the seed leaf stage to the two-leaf-one-heart stage of the watermelon.