A method for constructing an miRNA-21 electrochemical biosensor, the biosensor and application of the biosensor
By combining the miRNA-21 electrochemical biosensor with the RCA and CRISPR-Cas12a systems, the problems of complexity and high cost of existing detection methods are solved, and high sensitivity and specificity of miRNA-21 detection are achieved, which is suitable for the early diagnosis of malignant tumors.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGXI MEDICAL UNIVERSITY
- Filing Date
- 2026-03-23
- Publication Date
- 2026-06-16
AI Technical Summary
Existing miRNA-21 detection methods, such as real-time quantitative polymerase chain reaction and high-throughput sequencing, are complex and costly, making it difficult to meet clinical needs. They also lack sensitivity and specificity, hindering the early diagnosis of malignant tumors.
By combining RCA technology with the CRISPR-Cas12a system and utilizing the electrochemical signal amplification strategy of ferrocene tyramine (Fc-Tyr), a miRNA-21 electrochemical biosensor was constructed. The CRISPR-Cas12a system was activated by generating a long single-stranded macromolecular nucleic acid product through RCA, and the electrochemical signal was amplified by combining with Fc-Tyr. The signal was then fixed on the surface of a screen-printed electrode to form a self-assembled sensor.
It achieves high sensitivity and specificity detection of miRNA-21, simplifies the operation process, reduces costs, and is suitable for clinical diagnosis, especially the early diagnosis of liver cancer.
Smart Images

Figure CN122218063A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of electrochemical biosensor technology, specifically to a method for constructing a miRNA-21 electrochemical biosensor, the biosensor itself, and its applications. Background Technology
[0002] Cancer, the second leading cause of death worldwide, poses a serious threat to human health, with breast cancer, lung cancer, and liver cancer being particularly prominent. The pathogenesis of these cancers is complex, with the core being the activation of proto-oncogenes and the inactivation of tumor suppressor genes, leading to cellular gene mutations and promoting cancer cell proliferation and invasion. MicroRNAs (miRNAs) play a crucial role in this process. miRNAs are highly conserved short non-coding RNAs that influence cell proliferation, apoptosis, and differentiation by regulating post-transcriptional gene expression. In particular, miRNA-21, as a tumor marker for various cancers, is closely associated with tumor proliferation, invasion, and angiogenesis, indicating a poor prognosis. miRNA-21 promotes malignant transformation of tumors by inhibiting tumor suppressor genes (such as PDCD4 and TPM1) and activating the PI3K / Akt signaling pathway, as well as inhibiting tumor suppressor proteins such as MAP4K1.
[0003] Currently, quantitative real-time polymerase chain reaction (qPCR) and high-throughput sequencing are commonly used methods for detecting miRNA-21. Although they are highly sensitive, they are complex to operate and costly, making it difficult to meet clinical needs. Summary of the Invention
[0004] In view of this, the purpose of this invention is to provide a method for constructing an electrochemical biosensor for miRNA-21, the biosensor itself, and its applications. This invention combines RCA technology with the specific recognition and cleavage capabilities of the CRISPR-Cas12a system, and incorporates an electrochemical signal amplification strategy using ferrocene-Tyramine (Fc-Tyr), innovatively constructing an electrochemical biosensor specifically for detecting the tumor marker miRNA-21. This sensor not only aims to improve the sensitivity and specificity of detection but also focuses on its application in actual clinical diagnosis, hoping to overcome the limitations of current early diagnosis technologies for malignant tumors.
[0005] The specific technical solution adopted in this invention is as follows: The first aspect of this invention provides a method for constructing a miRNA-21 electrochemical biosensor, comprising the following steps: (1) Preparation of circular DNA template: Incubate a mixed solution consisting of Padlock DNA, miRNA-21, and 10×T4 DNA ligase reaction buffer. After cooling to room temperature, add T4 DNA ligase and diethyl pyrocarbonate-treated water, incubate overnight, then inactivate the enzyme and cool to room temperature to obtain a circular DNA solution. (2) RCA reaction: After mixing the circular DNA solution, diethyl pyrocarbonate treated water, phi29 DNA polymerase, 10×phi29 DNA polymerase reaction buffer, and dNTPs evenly, the mixture was incubated, the enzyme was then inactivated, and the mixture was cooled to room temperature to obtain the RCA product. (3) Activating the reverse cleavage of Cas12a: After mixing Linker DNA, Cas12a, crRNA, RNase inhibitor, 10×NEBuffer 2.1 and DEPC water evenly, add RCA product and incubate to obtain a Linker DNA mixture solution after incubation with the activated CRISPR-Cas12a system. (5) Using SPCE as the working electrode, the SPCE working electrode was vertically immersed in HAuCl4 with a mass fraction of 0.01%, the solution was stirred, electrodeposition was performed, and after the deposition was completed, it was rinsed clean to obtain the electrode SPCE / Au NPs; (6) Take the Linker DNA mixture solution after incubation with the activated CRISPR-Cas12a system, add a mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide and p-hydroxybenzoic acid solution, and incubate to activate to obtain Linker-cut-PHBA; then take the Linker-cut-PHBA and drop it onto the surface of the electrode SPCE / Au NPs, incubate, wash after incubation, and obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA; (7) Add 20 μL of 1% BSA solution to the electrode surface, incubate to block non-binding sites, clean and dry to obtain modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA; (8) Add a mixed solution of Tyr, Fc-Tyr, horseradish peroxidase solution and H2O2 to the surface of the electrode SPCE / AuNPs / Linker-cut-PHBA / BSA, incubate in the dark to allow Fc-Tyr to fully precipitate, clean it after the reaction is complete, and air dry to obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr.
[0006] Preferably, the modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr is soaked in 15 mL of 0.5 M dilute H2SO4 solution before use, and pretreated by CV method to remove organic impurities on the electrode surface and adsorb charges on the electrode surface. The electrode is scanned 20 times at a rate of 100 mV / s under a voltage of -0.2-1.0 V. After scanning, it is washed and dried for later use.
[0007] Preferably, the specific preparation steps of Fc-Tyr used in step (8) are as follows: (1) Weigh 1.84 g of ferrocene carboxylic acid and stir to dissolve it in 40 mL of dichloromethane solution. Stir to ensure complete dissolution. (2) Under nitrogen protection at room temperature, 1.2 mL of oxalyl chloride was slowly added to the mixed solution. The mixture was placed in a 100 mL round-bottom flask and stirred with a magnetic stirrer for 5 h under nitrogen protection. Then the mixture was heated under reflux for 30 min. (3) The product after reflux was concentrated using a rotary evaporator, and the concentrated residue was then dissolved in tetrahydrofuran solution to quantitatively obtain the compound ferrocene oxalyl chloride. (4) Take 1.12 g of tyramine and place it in 20 mL of dichloromethane solution and stir to dissolve; then add 2.2 g of diisopropylethylamine and add ferrocene carboxyl chloride dropwise, and stir magnetically at room temperature for 24 h. (5) At 25°C, the mixture was washed sequentially with 10% HCl, 10% NaHCO3 and deionized water. After washing, the solid was dried with anhydrous magnesium sulfate and then filtered. The product was then vacuum dried to evaporate the solvent and finally recrystallized with ethanol to obtain the compound Fc-Tyr molecule.
[0008] Preferably, in step (2), the concentration of phi29 DNA polymerase is 2 U / μL and the incubation time is 5 h.
[0009] Preferably, in step (3), the molar ratio of Cas12a to crRNA is 1:1.5; the incubation time is 45 min; the concentration of Cas12a is 1.5 μM; and the concentration of Linker DNA is 15 μM.
[0010] Preferably, in step (8), the molar ratio of Tyr to Fc-Tyr is 1:2, and the precipitation time of Fc-Tyr is 45 min.
[0011] Preferably, in step (6), the mass ratio of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide in the 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide mixture is 1:4.
[0012] A second aspect of the present invention is to provide a miRNA-21 electrochemical biosensor, which is constructed by the above method.
[0013] A third aspect of the present invention is to provide the application of the above-mentioned miRNA-21 electrochemical biosensor in the detection of miRNA-21.
[0014] The CRISPR-Cas12a system is a gene editing and detection tool based on CRISPR-Cas technology. CRISPR-Cas technology is a revolutionary gene editing technology that uses CRISPR RNA (crRNA) to guide Cas proteins to cut specific DNA sequences.
[0015] Rolling circle amplification (RCA) is an isothermal amplification technique based on DNA polymerase. It utilizes a short DNA or RNA primer to hybridize with a specific sequence on a circular DNA template, and then, under the action of DNA polymerase, continuous DNA synthesis occurs using the circular DNA as a template. Because the synthesis process occurs by rolling along the circular template, it is named rolling circle amplification. RCA has many advantages, such as high sensitivity, high specificity, ease of operation, and no need for special equipment. This makes it a promising candidate for widespread applications in biomedicine, environmental monitoring, food safety, and other fields.
[0016] Ferrocene is a stable redox probe that enables quantitative analysis of analyte targets through changes in electrochemical signals. Tyramide signal amplification (TSA) utilizes HRP-catalyzed tyramide deposition to aggregate ferrocene molecules on the electrode surface, thereby further amplifying the electrical signal.
[0017] This invention utilizes RCA technology to generate long single-stranded high-molecular-weight nucleic acid products that can activate the CRISPR-Cas12a system, as well as the reverse cleavage process of Cas12a. By covalently binding a linker DNA linker to PHBA, a binding site is provided for the deposition reaction of Fc-Tyr, thus constructing a complete electrochemical biosensor. This invention combines RCA technology with the specific recognition and cleavage functions of the CRISPR-Cas12a system, and incorporates an electrochemical signal amplification strategy using ferrocene-Tyramine (Fc-Tyr), innovatively constructing an electrochemical biosensor specifically for detecting the tumor marker miRNA-21. This sensor not only aims to improve the sensitivity and specificity of detection but also focuses on its application in actual clinical diagnosis, hoping to overcome the limitations of current early liver cancer diagnosis technologies. This invention provides an electrochemical biosensor capable of accurately and rapidly detecting miRNA-21, which is not only simple to operate and low in cost but also highly clinically applicable. Using RCA technology, we converted the target miRNA-21 into a long-chain DNA product. This product specifically binds to crRNA in the CRISPR-Cas12a system, thereby activating the cleavage activity of the Cas12a enzyme and releasing a detectable electrochemical signal. Subsequently, gold nanoparticles (Au NPs) were immobilized on the surface of a screen-printed carbon electrode (SPCE) using electrodeposition. Then, through chemical bonds and other interactions, electrochemically active materials such as Fc-Tyr were connected to the electrode to form a self-assembled electrochemical biosensor. The interface morphology and height of the modified electrode were characterized using scanning electron microscopy (SEM), verifying the successful construction of the sensor. This invention established a standard detection curve for miRNA-21 using electrochemical methods and verified the specificity, stability, and reproducibility of the sensing strategy. Furthermore, this invention validated the biocompatibility of the sensor using serum samples from liver cancer patients and healthy controls. The results showed that the sensor can accurately distinguish the expression levels of miRNA-21 in the serum of liver cancer patients and healthy individuals. Attached Figure Description
[0018] Figure 1 This is a technical roadmap for synthesizing the electroactive probe Fc-tyr in Example 1 of the present invention; Figure 2SEM images of electrodes at different modification stages used in the preparation of the electrochemical biosensor in Example 1 of this invention; A is SPCE; B is SPCE / Au NPs; C is SPCE / Au NPs / Linker-cut-PHBA; D is SPCE / Au NPs / Linker-cut-PHBA / BSA; E is SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr; Figure 3 Performance analysis of the electrochemical biosensor prepared in Example 1 of the present invention: A is the DPV curve of different concentrations of miRNA-21; B is the statistical analysis of DPV of different concentrations of miRNA; C is the standard curve of logarithm of different concentrations of miRNA-21 versus response current. Figure 4 Repeatability analysis of the electrochemical biosensor prepared in Example 1 of the present invention: A is a statistical chart of repeatability analysis for two different concentrations; B is a radar chart of stability analysis of the sensor prepared with 0.5 pM target RNA; C is a radar chart of stability analysis of the sensor prepared with 0.1 nM target RNA. Figure 5 XPS characterization of the electrochemical biosensor prepared in Example 1 of this invention for repeatability analysis: 0.5 pM, 0.1 nM; Figure 6 Analysis of the specificity and anti-interference ability of the electrochemical biosensor prepared in Example 1 of the present invention: A is a statistical chart of specificity and anti-interference ability analysis; B is a radar chart of specificity and anti-interference ability analysis. Figure 7 Stability assessment of the electrochemical biosensor prepared in Example 1 of this invention: A is a statistical chart of stability assessment; B is a radar chart of stability assessment. Figure 8 The electrochemical biosensor prepared in Example 1 of this invention was used to detect miRNA-21 in clinical serum samples: A is the expression level of miRNA-21 in serum samples of healthy controls and patients; B is a heatmap of the expression level of miRNA-21 in serum samples of healthy controls and patients. Detailed Implementation
[0019] To more clearly illustrate the present invention, the following description, in conjunction with preferred embodiments and accompanying drawings, further clarifies the invention. Those skilled in the art should understand that the specific description below is illustrative rather than restrictive and should not be construed as limiting the scope of protection of the present invention.
[0020] Unless otherwise specified, the materials described in the embodiments are all commonly used materials in the art and can be obtained commercially.
[0021] Example 1
[0022] Table 1 lists the experimental reagents used in the experiments of this invention.
[0023] Table 2 shows the nucleic acid sequences used in the experiments of this invention. All DNA and RNA nucleic acids were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0024] In the experiment of this invention: The nucleotide sequence of the Padlock DNA used is shown in SEQ ID NO.01; The nucleotide sequence of the miRNA-21 used is shown in SEQ ID NO.02; The nucleotide sequence of the crRNA used is shown in SEQ ID NO.03; The nucleotide sequence of the LinkerDNA used is shown in SEQ ID NO.04.
[0025] Table 3 lists the experimental instruments used in the experiments of this invention:
[0026] All electrochemical detections were performed at room temperature using a CHI660E workstation (Shanghai Chenhua, China). The entire experiment employed a conventional three-electrode configuration, including a carbon working electrode, a carbon counter electrode, and an Ag / AgCl reference electrode. In the experiments, CV was used to detect electrochemical signals in a PBS buffer solution (pH=7.4) containing 5 mM K3Fe(CN)6 / K4Fe(CN)6 and 0.1 M KCl, with a potential range of -0.8–0.8 V and a scan rate of 100 mV / s. DPV was performed in a PBS buffer solution containing 0.2 M NaClO4, with a scan voltage range of 0–0.6 V and a scan rate of 100 mV / s.
[0027] Construction method Preparation of Fc-Tyr: like Figure 1 As shown, the preparation of Fc-Tyr begins with the reaction of ferrocene carboxylic acid and oxalyl chloride to generate ferrocene carboxyl chloride. The ferrocene carboxyl chloride is then reacted with tyramine, and the reaction product is finally separated and purified to obtain the electroactive probe molecule Fc-Tyr. The specific steps are as follows: (1) Weigh 1.84 g (8.00 mmol) of ferrocene carboxylic acid and stir to dissolve it in 40 mL of dichloromethane solution. Stir to ensure complete dissolution.
[0028] (2) Under nitrogen protection at room temperature, 1.2 mL (13.66 mmol) of oxalyl chloride was slowly added to the mixed solution. The mixture was placed in a 100 mL round-bottom flask and stirred with a magnetic stirrer for 5 h under nitrogen protection. Then the mixture was heated under reflux for 30 min.
[0029] (3) The product after reflux was concentrated using a rotary evaporator, and the concentrated residue was then dissolved in tetrahydrofuran solution to quantitatively obtain the compound ferrocene oxalyl chloride.
[0030] (4) Take 1.12 g (8.00 mmol) of tyramine and place it in 20 mL of dichloromethane solution and stir to dissolve; then add 2.2 g (17 mmol) of diisopropylethylamine and add ferrocene carboxyl chloride dropwise, and stir magnetically at room temperature for 24 h.
[0031] (5) At 25°C, the mixture was washed with 10% HCl, 10% NaHCO3 and deionized water respectively. After washing, the solid was dried with anhydrous magnesium sulfate and then filtered. The product was dried under vacuum to evaporate the solvent. Finally, the product was recrystallized with ethanol to obtain compound Fc-Tyr molecules (2.27 g, 81%).
[0032] RCA reaction: (1) Preparation of circular DNA template: The mixture of 2 μL Padlock DNA (10 μM), 6 μL miRNA-21 of different concentrations (1 pM-5 μM), and 2 μL 10×T4 DNA ligase reaction buffer was heated at 95°C for 10 min, and then incubated at 55°C for 2 h. After cooling the mixture to room temperature, 1 μL T4 DNA ligase (600 U / μL) and 9 μL diethyl pyrocarbonate (DEPC) were added to the water and incubated at 16°C overnight. Then the solution was incubated at 65°C for 15 min to inactivate the enzyme. After cooling to room temperature, the circular DNA solution was obtained and stored at −20°C for further use.
[0033] (2) RCA reaction: 20 μL of reaction system (containing 10 μL of the above solution, 5 μL of diethyl pyrocarbonate (DEPC) treated water, 1 μL of phi29 DNA polymerase (2U / μL), 2 μL of 10×phi29 DNA polymerase reaction buffer and 2 μL of 2.5 mM dNTPs) was mixed evenly and incubated at 30°C for 5 h. Then the solution was incubated at 65°C for 10 min to inactivate the enzyme and then cooled to room temperature. The obtained RCA product was stored at 4°C.
[0034] Activate the reverse cleavage of Cas12a: 20 μL of Linker DNA (15 μM), 1 μL of Cas12a (1.5 μM), 1.2 μL of crRNA (1 μM), 1 μL of RNase inhibitor (40 U / μL), 3 μL of 10×NEBuffer 2.1, and 1.8 μL of DEPC water were mixed thoroughly, and then 2 μL of RCA product was added. The mixture was then incubated at 37 °C for 45 min to obtain a Linker DNA mixture solution incubated with the activated CRISPR-Cas12a system.
[0035] A Cas12a to crRNA molar ratio of 1:1.5 was selected as the optimal reaction condition to maximize the specificity and cleavage efficiency of the CRISPR system. 45 min was chosen as the optimal reaction time for the CRISPR-Cas12a system to ensure sufficient cleavage of the linker DNA while avoiding side reactions. The current response value decreased within the Cas12a enzyme concentration range of 0.25–1.5 μM, reaching a peak at 1.5 μM, indicating that 1.5 μM is the optimal concentration of Cas12a enzyme.
[0036] Fabrication of electrochemical biosensors: (1) Using SPCE as the working electrode, the electrode was immersed in 15 mL of 0.5 M dilute H2SO4 solution before use and pretreated by CV method to remove organic impurities on the electrode surface and adsorb charges on the electrode surface to prepare for subsequent modification. The electrode was scanned 20 times at a rate of 100 mV / s under a voltage of -0.2 to 1.0 V. After scanning, the electrode was washed with ultrapure water and dried for later use.
[0037] (2) The pretreated electrode was vertically immersed in 15 mL of 0.01% HAuCl4 and the solution was stirred with a magnetic stirrer. Electrodeposition was carried out at a constant potential of -0.5 V for 120 s. After deposition, the electrode was rinsed with ultrapure water to obtain the SPCE / Au NPs electrode.
[0038] (3) To the Linker DNA mixture after incubation in the activated CRISPR-Cas12a system, add 15 μL of a 10 mM mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimine hydrochloride (EDC) / N-hydroxysuccinimide (NHS) (mass ratio 1:4) and 10 μL of 1 mg / mL p-hydroxybenzoic acid (PHBA) solution, and incubate at 37°C for h to activate it and obtain Linker-cut-PHBA. Then, take 20 μL of Linker-cut-PHBA and drop it onto the electrode surface, incubate at room temperature for h, and wash with DEPC water after incubation to obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA.
[0039] (4) In order to reduce non-specific adsorption, 20 μL of 1% BSA solution was added to the electrode surface, incubated at room temperature for h to block non-binding sites, and then cleaned with DEPC water and dried to obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA.
[0040] (5) A mixed solution of 10 μL 1 mg / mL Tyr, 20 μL 1 mg / mL Fc-Tyr, 10 μL 1 mg / mL horseradish peroxidase (HRP) solution, and 10 μL 5 mM H2O2 was added to the electrode surface and incubated at room temperature in the dark for 45 min to allow Fc-Tyr to precipitate fully. After the reaction was completed, the electrode was washed with DEPC water and dried to obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr.
[0041] Electrochemical detection: (1) SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr was used as the working electrode, and 0.2 M NaClO4 PBS buffer solution was used as the electrolyte solution. Electrochemical detection was performed using DPV. The scanning voltage range was 0-0.6 V and the scanning rate was 100 mV / s. The target RNA was quantitatively detected by the relationship between the electrochemical signal generated by the Fc-Tyr probe and the concentration of miRNA-21.
[0042] (2) Using SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr as the working electrode and 5 mM K3Fe(CN)6 / K4Fe(CN)6 and 0.1 M KCl in PBS buffer solution (pH=7.4) as the electrolyte solution, the electrochemical signal was detected by CV with a potential range of -0.8 to 0.8 V and a scan rate of 100 mV / s.
[0043] The electrodes were characterized using SEM at each modification stage, and the surface morphology changes of each modified electrode were analyzed. For example... Figure 2 As shown in Figure A, the pretreated SPCE electrode surface exhibits a typical rough and porous structure of carbon-based materials. After etching with dilute H₂SO₄, it provides a high specific surface area substrate for subsequent Au NPs deposition; Figure 2 As shown in Figure B, after electrodeposition of Au NPs, spherical nanoparticles are uniformly distributed on the electrode surface, proving that Au NPs have been successfully deposited on the electrode surface, providing sufficient active sites for subsequent biomolecule immobilization; Figure 2 As shown in Figure C, after linker-cut-PHBA was immobilized via Au-S bonds, SEM images revealed an organic layer covering the surface of Au NPs, with blurred nanoparticle outlines, indicating that the covalent binding of linker DNA and PHBA formed a dense monolayer; Figure 2 As shown in Figure D, after BSA blocking, a continuous and dense protein layer forms on the electrode surface, effectively blocking non-specific adsorption; for example... Figure 2 As shown in Figure E, after the target miRNA-21 triggers RCA and Cas12a cleavage, the linker DNA is specifically cleaved, reducing the PHBA exposure sites, and the SEM image shows sparse nanoparticles on the surface. SEM morphology analysis of the electrode surface confirms the successful construction of an electrochemical biosensor.
[0044] Establishment of a standard detection curve for miRNA-21: The analytical performance of the electrochemical biosensor prepared above was detected using DPV. The DPV curve and the curve showing the relationship between peak current and miRNA-21 concentration are shown below. Figure 3 A and Figure 3 As shown in B. The results are as follows: Figure 3 As shown in Figure C, the peak response current of DPV increases with increasing miRNA-21 concentration. Within the range of 1 pM to 5 μM, there is a linear relationship between the current response value and the logarithm of the miRNA-21 concentration, with the linear regression equation being y = -0.012701x + 2.43501 (R²). 2 =0.99124), the detection limit is calculated by the formula: LOD=3*Sb / k=29 fM (Sb is the standard deviation of 3 blank samples, and k is the slope of the obtained linear relationship).
[0045] As shown in Table 4, compared with existing electrochemical sensing platforms for target RNA detection, the miRNA-21 detection electrochemical biosensor constructed in this invention exhibits significant advantages in analytical performance. The above experimental results demonstrate that the CRISPR-Cas12a system based on the RCA reaction, combined with ferrocene tyramine deposition, provides excellent analytical performance for detecting miRNA-21.
[0046]
[0047] Sensor repeatability and sensitivity analysis: The repeatability of this electrochemical biosensor was investigated by performing parallel detections with five electrodes on low and high concentrations of miRNA-21 (0.5 pM and 0.1 nM). The results are as follows: Figure 4 As shown, the current expression of miRNA-21 at the same concentration is basically consistent. The relative standard deviations (RSDs) for the two concentrations of 0.5 pM and 0.1 nM were calculated to be 4.47% and 7.09%, respectively. These experimental results indicate that the electrochemical biosensor constructed in this invention has good reproducibility.
[0048] One electrode from each of the two different concentrations was randomly selected for XPS characterization and detection. The results are as follows: Figure 5 As shown in Table 5, the Fe 2p peak detected by the electrodes of both concentrations was low due to the reverse amplification signal mechanism. Furthermore, the atomic content of the low-concentration (0.5 pM) target RNA modified electrode (1.18%) was higher than that of the high-concentration (0.1 nM) target RNA modified electrode (1.08%). The elemental content of the electrodes for stability detection was analyzed by XPS, which proved that the detected electrochemical results corresponded to the Fc-Tyr deposition amount, further demonstrating its good stability and the high sensitivity of the sensor constructed in this invention.
[0049]
[0050] Analysis of sensor specificity and anti-interference capabilities: Specificity and interference resistance are two important parameters for evaluating the performance of electrochemical biosensors. To further investigate the specificity and interference resistance of this electrochemical biosensor, this invention utilizes it to perform DPV detection on different substrates. The interference resistance was assessed by comparing the detection results of the electrochemical biosensor on miRNA-21 with other mismatched RNAs (M1, M2, and M3) and their mixtures (Mix); the specificity was assessed by comparing the detection results of the electrochemical biosensor on miRNA-21 with other types of microRNAs (miRNA-7a, miRNA-16, and miRNA-141); and the concentrations (10 μM) of the other mismatched RNAs and other types of microRNAs used were all 10 times higher than the concentrations (1 μM) of the experimental group miRNA-21 and the Mix group. M1, M2, and M3 refer to three mismatched RNAs. Compared to miRNA-21, M1 has one mismatched base, M2 has two mismatched bases, and M3 has three mismatched bases. miRNA-7a, miRNA-141, and miRNA-16 are other types of RNA. The specific nucleic acid sequences are as follows (5'-3'): The nucleotide sequence of miRNA-21 is shown in SEQ ID NO.02: UAGCUUAUCAGACUGAUGUUGA; The nucleotide sequence of M1 is shown in SEQ ID NO.05: UAGCUUAUCAUACUGAUGUUGA; The nucleotide sequence of M2 is shown in SEQ ID NO.06: UAGCUUAUCAUCCUGAUGUUGA; The nucleotide sequence of M3 is shown in SEQ ID NO.07: UAGCUUAUCAUCGUGAUGUUGA; The nucleotide sequence of miRNA-7a is shown in SEQ ID NO.08: UGAGGUAGUAGGUUGUAUAGUU; The nucleotide sequence of miRNA-141 is shown in SEQ ID NO.09: UAACACUGUCUGGUAAAGAUGG; The nucleotide sequence of miRNA-16 is shown in SEQ ID NO.10: UAGCACGUAAAUAUUGGCG.
[0051] The results are as follows Figure 6As shown, the signal expression was low when detecting miRNA-21 and the mixed group (containing miRNA-21), but high when analyzing other substrates without miRNA-21, approaching the signal intensity of the blank group. This experimental result demonstrates that other interfering RNAs did not affect the sensor's ability to recognize miRNA-21. Therefore, the electrochemical biosensor constructed in this invention has excellent specificity in recognizing miRNA-21 and good anti-interference ability.
[0052] Sensor stability analysis: Following the above preparation method, a batch of electrochemical biosensors were prepared under the same conditions and stored at a dry temperature of 4°C. Electrochemical detection was performed on three electrodes at three-day intervals. The DPV (Displacement Potential Value) of the sensors was measured at 0, 3, 6, 9, 12, and 15 days, and the stability was evaluated using the peak current results. The results are as follows: Figure 7 As shown, the peak value of the DPV current of the sensor was relatively stable within 15 days, and only decreased by 4.52% after 15 days. The results indicate that the electrochemical biosensor can remain stable under the condition of drying at 4℃ for 15 days.
[0053] Clinical trials: All blood samples used in the experiment, including those from clinically diagnosed liver cancer patients and healthy controls, were provided by the Laboratory of Laboratory Medicine, First Affiliated Hospital of Guangxi Medical University (Nanning, China), and approved by the Ethics Committee of Guangxi Medical University. Clinical blood samples were collected using EDTA-anticoagulated tubes, allowed to stand for 1 hour, and centrifuged at 1000 rpm for 10 minutes. Total RNA samples were extracted from the collected clinical serum according to the RNA extraction protocol. Finally, the RNA samples were stored at -80℃, thawed before the experiment, and subjected to repeated freeze-thaw cycles. The total RNA concentration and A260 / A280 ratio in the extracted samples were detected using a nucleic acid protein scanning analyzer. The A260 / A280 ratio indicates the purity of the extracted RNA, and the results were recorded. Simultaneously, the constructed electrochemical biosensor was used to detect and analyze miRNAs in the clinical blood samples.
[0054] Previous studies have shown that the level of miRNA-21 in cancer patients is higher than that in healthy individuals. To further investigate the clinical application of this electrochemical platform, this invention studied the expression level of miRNA-21 in HCC patients and healthy controls (n=20; 10 HCC patients and 10 healthy controls). First, total RNA was extracted from clinical serum samples. The results are shown in Table 6. The A260 / A280 value was close to 1.8-2.0, indicating that the extracted RNA had high purity and met the experimental requirements. Subsequently, the content of miRNA in clinical serum samples was detected using electrochemical methods. In the absence of miRNA-21, a large number of Fc-Tyr molecules were deposited on the electrode surface. However, as the concentration of miRNA-21 increased, the number of deposition sites for the electrochemical probe Fc-Tyr molecules decreased, resulting in a lower electrochemical signal. The results are as follows: Figure 8 As shown in Figure A, the expression of miRNA-21 chemical signal was lower in HCC patients than in the normal control group. This demonstrates that the level of miRNA-21 in the serum of HCC patients was higher than that in the normal control group when detected using this electrochemical biosensor. Furthermore, a heatmap was used to express the normalized signal in HCC patients and healthy controls, where the expression level of miRNA-21 was represented by color intensity; a darker color indicated higher detected miRNA-21 signal expression and lower blood miRNA-21 levels, while a lighter color indicated lower detected signal and higher serum miRNA-21 levels. The results are as follows... Figure 8 As shown in Figure B, the darker color in the healthy control group indicates higher expression of the detected miRNA-21 signal and lower levels of miRNA-21 in the serum, which is consistent with clinical research results.
[0055]
[0056] Clinical trial results demonstrate that the electrochemical biosensor established in this invention can successfully detect miRNA-21 in serum samples in clinical practice.
[0057] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or terminal device. Unless otherwise specified, an element defined by the phrase "comprising..." or "including..." does not exclude the presence of additional elements in the process, method, article, or terminal device that includes said element. Additionally, in this document, "greater than," "less than," "exceeding," etc., are understood to exclude the stated number; "above," "below," "within," etc., are understood to include the stated number.
[0058] Although the above embodiments have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the above descriptions are merely embodiments of the present invention and do not limit the scope of patent protection of the present invention. Any equivalent structural or procedural transformations made using the content of the present invention's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the scope of patent protection of the present invention.
Claims
1. A method for constructing a miRNA-21 electrochemical biosensor, characterized in that, Includes the following steps: (1) Preparation of circular DNA template: Incubate a mixed solution consisting of Padlock DNA, miRNA-21, and 10×T4 DNA ligase reaction buffer. After cooling to room temperature, add T4 DNA ligase and diethyl pyrocarbonate-treated water, incubate overnight, then inactivate the enzyme and cool to room temperature to obtain a circular DNA solution. (2) RCA reaction: The circular DNA solution, diethyl pyrocarbonate treated water, phi29 DNA polymerase, 10×phi29 DNA polymerase reaction buffer and dNTPs were mixed evenly and incubated. Then the enzyme was inactivated and cooled to room temperature to obtain the RCA product. (3) Activating the reverse cleavage of Cas12a: After mixing Linker DNA, Cas12a, crRNA, RNase inhibitor, 10×NE Buffer 2.1 and DEPC water evenly, add RCA product and incubate to obtain a Linker DNA mixture solution after incubation with the activated CRISPR-Cas12a system. (4) Using SPCE as the working electrode, the SPCE working electrode was vertically immersed in HAuCl4 with a mass fraction of 0.01%, the solution was stirred, electrodeposition was performed, and after the deposition was completed, it was rinsed clean to obtain the electrode SPCE / Au NPs; (5) Take the Linker DNA mixture solution after incubation with the activated CRISPR-Cas12a system, add a mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide and p-hydroxybenzoic acid solution, and incubate to activate to obtain Linker-cut-PHBA; then take Linker-cut-PHBA and drop it onto the surface of the electrode SPCE / Au NPs, incubate, wash after incubation, and obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA; (6) Add 20 μL of 1% BSA solution to the electrode surface, incubate to block non-binding sites, clean and dry to obtain modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA; (7) Add a mixed solution of Tyr, Fc-Tyr, horseradish peroxidase solution and H2O2 to the surface of the electrode SPCE / Au NPs / Linker-cut-PHBA / BSA, incubate in the dark to allow Fc-Tyr to fully precipitate, clean it after the reaction is complete, and air dry to obtain the modified electrode SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr.
2. The method for constructing the miRNA-21 electrochemical biosensor according to claim 1, characterized in that, Before use, the modified electrodes SPCE / Au NPs / Linker-cut-PHBA / BSA / Fc-Tyr were soaked in 15 mL of 0.5 M dilute H2SO4 solution and pretreated using CV method to remove organic impurities from the electrode surface and adsorb charges onto the electrode surface. The electrodes were scanned 20 times at a rate of 100 mV / s under a voltage of -0.2-1.0 V. After scanning, the electrodes were washed and dried for later use.
3. The method for constructing the miRNA-21 electrochemical biosensor according to claim 1, characterized in that, The specific preparation steps of Fc-Tyr used in step (8) are as follows: (1) Weigh 1.84 g of ferrocene carboxylic acid and stir to dissolve it in 40 mL of dichloromethane solution. Stir to ensure complete dissolution. (2) Under nitrogen protection at room temperature, 1.2 mL of oxalyl chloride was slowly added to the mixed solution. The mixture was placed in a 100 mL round-bottom flask and stirred with a magnetic stirrer for 5 h under nitrogen protection. Then the mixture was heated under reflux for 30 min. (3) The product after reflux was concentrated using a rotary evaporator, and the concentrated residue was then dissolved in tetrahydrofuran solution to quantitatively obtain the compound ferrocene oxalyl chloride. (4) Take 1.12 g of tyramine and place it in 20 mL of dichloromethane solution and stir to dissolve; then add 2.2 g of diisopropylethylamine and add ferrocene carboxyl chloride dropwise, and stir magnetically at room temperature for 24 h. (5) At 25°C, the mixture was washed sequentially with 10% HCl, 10% NaHCO3 and deionized water. After washing, the solid was dried with anhydrous magnesium sulfate and then filtered. The product was then vacuum dried to evaporate the solvent and finally recrystallized with ethanol to obtain the compound Fc-Tyr molecule.
4. The method for constructing the miRNA-21 electrochemical biosensor according to claim 1, characterized in that, In step (2), the concentration of phi29 DNA polymerase is 2 U / μL, and the incubation time is 5 h.
5. The method for constructing the miRNA-21 electrochemical biosensor according to claim 1, characterized in that, In step (3), the molar ratio of Cas12a to crRNA is 1:1.5; the incubation time is 45 min; the concentration of Cas12a is 1.5 μM and the concentration of Linker DNA is 15 μM.
6. The method for constructing the miRNA-21 electrochemical biosensor according to claim 1, characterized in that, In step (8), the molar ratio of Tyr to Fc-Tyr is 1:2, and the precipitation time of Fc-Tyr is 45 min.
7. The method for constructing the miRNA-21 electrochemical biosensor according to claim 1, characterized in that, In step (6), the mass ratio of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide in the 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide mixture is 1:
4.
8. A miRNA-21 electrochemical biosensor, characterized in that, It is prepared by any one of the construction methods described in claims 1-7.
9. The application of the miRNA-21 electrochemical biosensor according to claim 8 in the detection of miRNA-21.