A reagent for capturing and analyzing circulating tumor cells based on DNA hydrogel and a preparation method and application thereof

Abstract

The application provides a reagent for capturing and analyzing circulating tumor cells based on DNA hydrogel as well as a preparation method and application thereof, and belongs to the technical field of biological sensing. The DNA hydrogel is constructed through a ring formation reaction and integrates a recognition response unit and a strand displacement signal generation mechanism. The DNA hydrogel can specifically recognize and capture circulating tumor cells expressing specific surface markers through an aptamer-signal probe, and a large amount of signal probes labeled with electrochemically active groups are released through a strand displacement reaction, so that electrochemical quantitative analysis of target cells with high sensitivity is realized.

Description

Technical Field

[0001] This application belongs to the field of biosensing technology, specifically relating to a reagent for capturing and analyzing circulating tumor cells based on DNA hydrogel, its preparation method, and its application. Background Technology

[0002] The leading cause of cancer death is the detachment of tumor cells from the primary tumor tissue, their spread to distant organs via the blood or lymphatic system, and the formation of metastatic lesions. In-depth research into the mechanisms and development patterns of distant cancer metastasis, and the construction of a scientific and efficient disease monitoring system and intervention strategies, are crucial for improving patients' quality of life and prolonging their survival. Circulating tumor cells (CTCs), as a core biomarker of cells detached from the primary tumor lesion and entering the peripheral blood circulation, are closely linked to the metastatic process of tumors and can provide important clinical references for dynamic disease monitoring, early screening, and disease assessment.

[0003] In recent years, researchers have conducted extensive research on the detection technology of circulating tumor cells (CTCs), developing various analytical methods that integrate molecular recognition and signal output functional components. These technologies exhibit high detection sensitivity and specificity under ideal buffer conditions in the laboratory. However, in actual clinical sample testing, these methods still face numerous technical challenges that urgently need to be addressed: most current mainstream detection methods use antibodies or nucleic acid aptamers as recognition elements, identifying and capturing CTCs through point-to-point binding to cell surface proteins. However, due to the extremely low number of CTCs in peripheral blood, the low expression levels of target proteins on cell surfaces, and the interference from a large number of non-target cells such as leukocytes in the blood, the capture effect of target cells and the accuracy of subsequent detection results are difficult to meet the actual requirements of clinical diagnosis and treatment. Summary of the Invention

[0004] The purpose of this invention is to provide a reagent for capturing and analyzing circulating tumor cells based on DNA hydrogels. It utilizes aptamers in aptamer-signal probes to identify specific markers on the surface of circulating tumor cells, thus labeling them. Then, by employing a strand displacement mechanism between the DNA hydrogel and the signal probe in the aptamer-signal probe, it triggers the release of a large number of electrochemically active group-labeled signal probes while simultaneously achieving multi-point synergistic recognition and capture. This allows for the electrochemical quantitative analysis of captured cells, integrating capture and detection functions into one unit, ensuring rapid and accurate sample detection.

[0005] This invention provides a reagent for capturing and analyzing circulating tumor cells based on DNA hydrogel, comprising a DNA hydrogel and an aptamer-signal probe; The aptamer-signal probe is formed by hybridizing an aptamer chain and a signal chain modified with electrochemically active groups. The aptamer chain comprises a tandem nucleic acid aptamer, a spacer sequence, and a substitution fragment; the aptamer chain hybridizes with a signaling chain via a portion of the substitution fragment; the nucleic acid aptamer is used to bind specific biomarkers on the surface of circulating tumor cells; The DNA hydrogel is formed by hybridization of long chain 1 and long chain 2 with complementary sequences; the long chain 1 and / or long chain 2 contains a plurality of recognition response units complementary to the substitution fragment.

[0006] Preferably, the long chain 1 is prepared by rolling circle amplification of template DNA loop 1, wherein the template DNA loop 1 is obtained by circulization reaction of template chain T1 with the assistance of primer chain P1; the nucleotide sequence of template chain T1 is shown in SEQ ID NO:1; the nucleotide sequence of primer chain P1 is shown in SEQ ID NO:2. The long chain 2 is prepared by rolling circle amplification of template DNA loop 2, which is obtained by circulant reaction of template strand T2 with the assistance of primer strand P2; the nucleotide sequence of template strand T2 is shown in SEQ ID NO:3; the nucleotide sequence of primer strand P2 is shown in SEQ ID NO:4. The nucleotide sequence of the recognition response unit in the long chain 1 or long chain 2 is shown in SEQ ID NO:5.

[0007] Preferably, when the source of circulating tumor cells is breast cancer, the circulating tumor cell surface-specific markers include at least one of the following: mucin 1, trophoblast cell surface antigen 2, and epidermal growth factor receptor; The nucleotide sequence of the mucin 1 aptamer is shown in SEQ ID NO:6; The nucleotide sequence of trophoblast cell surface antigen 2 is shown in SEQ ID NO:7; The nucleotide sequence of the epidermal growth factor receptor is shown in SEQ ID NO:8.

[0008] Preferably, the nucleotide sequence of the signal chain modified with electrochemically active groups is shown in SEQ ID NO:10.

[0009] Preferably, the electrochemically active group includes any one of the following: methylene blue, ferrocene, and silver nanoparticles.

[0010] This invention provides a method for preparing the reagent, comprising the following steps: Template DNA loop 1 or template DNA loop 2 obtained by the circularization reaction of template strand T1 or template strand T2 is amplified by rolling circle under the action of DNA polymerase to obtain DNA long chain 1 or DNA long chain 2; the DNA long chain 1 and DNA long chain 2 are hybridized to form a DNA hydrogel. The nucleic acid aptamer and the signal strand modified with electrochemically active groups are hybridized to obtain the aptamer-signal probe.

[0011] This invention provides the application of the reagent in capturing circulating tumor cells.

[0012] This invention provides the use of the reagent in the preparation of kits for capturing and / or detecting circulating tumor cells or metastatic tumors.

[0013] Preferably, the circulating tumor cells originate from breast cancer.

[0014] This invention provides a method for capturing or detecting circulating tumor cells for non-diagnostic purposes, comprising the following steps: The aptamer-signal probe in the reagent is mixed with the sample to be tested and incubated to separate the cell solid phase; The cells were resuspended in a solid phase and then mixed with long chain 1 and long chain 2 in the reagent and incubated to separate the DNA hydrogel precipitate and liquid phase. The DNA hydrogel precipitate was washed, and the washing solution was combined with the liquid phase to obtain the test solution. Electrochemical tests were performed on the test solution, and electrochemical signals were collected. The content of circulating tumor cells in the test sample was obtained based on the electrochemical signals.

[0015] This invention provides a reagent for capturing and analyzing circulating tumor cells (CTCs) based on DNA hydrogels, comprising a DNA hydrogel and an aptamer-signal probe. The aptamer-signal probe is formed by hybridization of an aptamer chain and a signal chain modified with electrochemically active groups. The aptamer chain includes a tandem nucleic acid aptamer, a spacer sequence, and a substitution fragment. The aptamer chain hybridizes with the signal chain via a portion of the substitution fragment. The nucleic acid aptamer binds to specific biomarkers on the surface of CTCs. The DNA hydrogel is formed by hybridization of long chain 1 and long chain 2 with complementary sequences. Long chain 1 and / or long chain 2 contains several recognition response units complementary to the substitution fragment. The DNA hydrogel can specifically capture CTCs expressing specific biomarkers on their surface through the substitution fragment in the aptamer-signal probe, while simultaneously releasing a large number of electrochemically active group-labeled signal chains through chain substitution reactions. Based on the strength of the electrochemical signal, electrochemical quantitative analysis of the target cells is achieved. Experiments show that this invention not only enables simultaneous capture and quantitative detection but also achieves higher detection sensitivity than traditional methods. Taking CTCs derived from breast cancer as an example, the detection sensitivity of the reagent of this invention reaches 2.6 cells / mL. The advantages of the reagent provided by this invention are also: (1) The DNA hydrogel-based circulating tumor cell capture and analysis platform has excellent biocompatibility and structural designability. Its components are derived from nucleic acid molecules, are non-cytotoxic, can reduce damage to circulating tumor cells, and ensure the accuracy of subsequent detection. (2) Many recognition response units distributed in the three-dimensional hydrogel network can bind to a single circulating tumor cell at the same time, forming a multi-point synergistic recognition and capture effect, which greatly improves the capture efficiency of low-abundance circulating tumor cells. (3) The hydrogel integrates the chain displacement signal generation mechanism. While achieving efficient capture of circulating tumor cells, it can trigger the release of a large number of signal probes labeled with electrochemically active groups, enabling electrochemical quantitative analysis of captured cells. It integrates capture and detection functions, simplifies the detection process, and better meets the needs of rapid and accurate detection of clinical samples. Attached Figure Description

[0016] Figure 1 A diagram illustrating the preparation of DNA hydrogels and their application in capturing and analyzing circulating tumor cells in breast cancer. Figure 2 The image shows the scanning electron microscopy characterization results of a DNA hydrogel with a three-dimensional network structure. Figure 3 Fluorescence spectra of the supernatant of untreated MCF-7 cell sample (a) and MCF-7 cell sample (b) after DNA hydrogel capture; Figure 4 The fluorescence intensity of the supernatant after capturing MCF-7 cells and MDA-MB-453 cells using DNA hydrogel is measured in the following cases: (a) with the introduction of an aptamer-signal probe targeting MUC1, (b) without the introduction of an aptamer-signal probe, and (c) with the introduction of a control probe in which the MUC1 aptamer strand is replaced by an irrelevant single-stranded DNA. Figure 5 The fluorescence characterization results of selective cell capture in a mixed cell sample composed of DiO-prestained MCF-7 cells and DiI-prestained MDA-MB-453 cells at a ratio of 1:9. Figure 6 The fluorescence characterization results of selective cell capture in a mixed cell sample composed of DiO-prestained MCF-7 cells and DiI-prestained PBMCs cells at a ratio of 1:9. Figure 7 The results are shown in the square wave voltammetry peak current measurement. A represents the DNA hydrogel used for capture and electrochemical analysis (1×10⁻⁶). 6 Square wave voltammetry spectra obtained at 1 cell / mL MCF-7 cells and in the control experiment; B is the square wave voltammetry peak current value obtained when DNA hydrogel was used to capture and detect different concentrations of MCF-7 cells; Figure 8 The results are square wave voltammetry peak current values ​​obtained when DNA hydrogels were used for capturing and electrochemically analyzing circulating tumor cells in breast cancer in clinical samples. Note: Samples 1-6 were collected from 6 healthy volunteers, and samples 7-18 were collected from 12 patients with metastatic breast cancer. Detailed Implementation

[0017] This invention provides a reagent for capturing and analyzing circulating tumor cells based on DNA hydrogel, comprising a DNA hydrogel and an aptamer-signal probe; The aptamer-signal probe is formed by hybridizing an aptamer chain and a signal chain modified with electrochemically active groups. The aptamer chain comprises a tandem nucleic acid aptamer, a spacer sequence, and a substitution fragment; the aptamer chain hybridizes with a signaling chain via a portion of the substitution fragment; the nucleic acid aptamer is used to bind specific biomarkers on the surface of circulating tumor cells; The DNA hydrogel is formed by hybridization of long chain 1 and long chain 2 with complementary sequences; the long chain 1 and / or long chain 2 contains a plurality of recognition response units complementary to the substitution fragment.

[0018] In this invention, the mechanism by which the reagent captures and analyzes circulating tumor cells is as follows: Figure 1 As shown: First, using two different DNA loop sequences as templates, a looping reaction is initiated under the catalysis of DNA polymerase. This reaction generates two long DNA single strands containing numerous complementary repeating sequences. These two long single strands can hybridize through base pairing and self-assemble to form a DNA hydrogel with a three-dimensional network structure. The DNA hydrogel not only possesses good biocompatibility and structural stability, but its long chain sequence also includes recognition response units that can trigger chain displacement reactions. In the cell capture stage, an aptamer-signal probe, formed by hybridizing a nucleic acid aptamer chain targeting specific markers on the surface of circulating tumor cells with a signal chain labeled with electrochemically active groups, is first incubated with and specifically binds to the target cells, thereby anchoring them to the target cell surface. Subsequently, the target cells bound to the aptamer-signal probe are mixed with the two long DNA chains involved in the formation of the DNA hydrogel. The displacement fragments in the aptamer chain on the cell surface undergo complementary hybridization with the recognition response units in the long chain, thereby efficiently capturing target breast cancer circulating tumor cells in the three-dimensional network of the hydrogel through a multi-point synergistic effect. Simultaneously, hybridization between the aptamer chain and the recognition response unit in the long chain triggers a chain substitution reaction, which drives the massive release of electrochemically active group-labeled signal chains. Since the number of signal chains released is positively correlated with the number of target cells captured, the cell number can be converted into a quantifiable electrical signal using electrochemical detection technology, ultimately achieving highly sensitive and specific quantitative analysis of circulating tumor cells in breast cancer.

[0019] In this invention, the long chain 1 is preferably prepared by rolling circle amplification of template DNA loop 1, wherein the template DNA loop 1 is obtained by the circularization reaction of template strand T1 with the assistance of primer strand P1; the long chain 2 is preferably prepared by rolling circle amplification of template DNA loop 2, wherein the template DNA loop 2 is obtained by the circularization reaction of template strand T2 with the assistance of primer strand P2. The sequences of template strand T1, template strand T2, primer strand P1, and primer strand P2 are not known sequences, but are designed according to the following principles: ① The two sets of template strands and primer strands must be matched accordingly, and the primer strands only bind to their own template strands, with no cross-binding between the template strands and primer strands, ensuring the specificity of rolling circle amplification; ② The template strands can be efficiently circularized, and the primer strands have no secondary structures of their own, and the two sets of template strands and primer strands are adapted to the same amplification conditions, ensuring sufficient and complete products; ③ The core repeat sequences of the two sets of template strands must be designed with complementary segments to ensure that the base sequences of their rolling circle amplification products can be specifically paired to achieve hybridization; ④ Template strand 1 and / or template strand 2 embed sequences that are completely complementary to the strand substitution fragments of the subsequent aptamer strands to form recognition response units, but this does not affect the amplification efficiency and hybridization with the other set of amplified long-chain products. In one embodiment of the present invention, the nucleotide sequence of the template strand T1 is shown in SEQ ID NO:1 (5'-Phosphate-CAGCCATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTAGGAAGATCAAATGA-3'); the nucleotide sequence of the primer strand P1 is shown in SEQ ID NO:2 (5'-TGGCTGTCATTTGATCTTCCTA-3'). The nucleotide sequence of the template strand T2 is shown in SEQ ID NO:3 (5'-Phosphate-TCATTTGATCTTCCTATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTGGCTG-3'); the nucleotide sequence of the primer strand P2 is shown in SEQ ID NO:4 (5'-TAGGAAGATCAAATGACAGCCA-3'). The nucleotide sequence of the recognition response unit in the long chain 1 or long chain 2 is preferably as shown in SEQ ID NO:5 (5'-GCAATACTCCCCCAGGT-3').

[0020] In this invention, when the source of circulating tumor cells is preferably breast cancer, the circulating tumor cell surface-specific markers preferably include at least one of the following: mucin 1, trophoblast cell surface antigen 2, and epidermal growth factor receptor. The nucleotide sequence of the mucin 1 aptamer is preferably as shown in SEQ ID NO:6 (GCAGTTGATCCTTTGGATACCCTTG). The nucleotide sequence of the trophoblast cell surface antigen 2 aptamer is preferably as shown in SEQ ID NO:7 (5'-TCTGTTCCGTGTTCGTTCCTTTC). The nucleotide sequence of the epidermal growth factor receptor aptamer is preferably as shown in SEQ ID NO:8 (5'-TACCAGTGCGATGCTCAGTGCCGTTTCTTCTCTTTCGCTTTTTTTG). As shown in SEQ ID NO:9 (ACCTGGGGGAGTATTGC), the design of the substitution fragment must follow three basic principles: first, it must be complementary to the bases of the signal strand, with a pairing length of 12-15 bp; second, it must be complementary to the recognition response unit in long chain 1 and / or long chain 2, and the pairing length must be 5-6 bp longer than its pairing length with the signal strand SP to ensure that a strand substitution reaction can occur; and third, it must not contain sequences that hybridize complementaryly with nucleic acid aptamers to avoid affecting the targeted recognition ability of nucleic acid aptamers. In this embodiment of the invention, the nucleotide sequence of the substitution fragment is shown in SEQ ID NO:9 (ACCTGGGGGAGTATTGC). The nucleotide sequence of the signal strand modified with electrochemically active groups is preferably shown in SEQ ID NO:10 (GCAATACTCCCC). The electrochemically active groups preferably include any one of the following: methylene blue, ferrocene, and silver nanoparticles. The electrochemically active groups are preferably modified at the 5' end of the signal strand. The modification of the electrochemically active groups is preferably completed during DNA synthesis. In this embodiment of the invention, the signal chain modified with electrochemically active groups was commissioned to Sangon Biotech (Shanghai) Co., Ltd.

[0021] This invention provides a method for preparing the reagent, comprising the following steps: Template DNA loop 1 or template DNA loop 2 obtained by the circularization reaction of template strand T1 or template strand T2 is amplified under the action of DNA polymerase to obtain DNA long chain 1 or DNA long chain 2; the DNA long chain 1 and DNA long chain 2 are hybridized to form a DNA hydrogel. The nucleic acid aptamer and the signal strand modified with electrochemically active groups are hybridized to obtain the aptamer-signal probe.

[0022] In this invention, the preparation of template DNA loop 1 or template DNA loop 2 using template strand T1 (T2) and primer strand P1 (P2) includes reaction 1, reaction 2, and enzyme inactivation. The reaction system for reaction 1 is preferably 20 μl, comprising: 2 μL of 80-120 μM DNA template strand T1 (or T2), 2 μL of 80-120 μM DNA primer strand P1 (or P2), 2 μL of 0.8-1 M sodium chloride solution, and 14 μL of deionized water. The preferred reaction procedure for reaction 1 is to react in a 90-95°C water bath for 5-10 minutes, or in a 92°C water bath for 8 minutes. The reaction system for reaction 2 is based on the reaction system of reaction 1, with the addition of 7 μL of 2-3 U / μL T4 DNA ligase, 70 μL of 10× T4 DNA ligase buffer, and 603 μL of double-distilled water. The preferred reaction procedure for reaction 2 is to react in a 15-20°C metal bath for 8-10 hours, or in a 18°C ​​metal bath for 9 hours. The preferred method for enzyme inactivation is high-temperature enzyme inactivation. The preferred temperature for high-temperature enzyme inactivation is 60-70°C, and can be 65°C. The preferred time for high-temperature enzyme inactivation is 8-10 minutes, and can be 9 minutes.

[0023] In this invention, when amplifying under the action of DNA polymerase, the preferred reaction system consists of template DNA loop 1 (or loop 2), 2 μL of 8-10 U / μL DNA polymerase, 10 μL of 10× DNA polymerase buffer, 1 μL of 10-20 mg / mL bovine serum albumin solution, 10 μL of 0.8-1 M sodium chloride solution, 4 μL of 20-25 mM dNTPs, and 55.8 μL of deionized water. The preferred reaction program is at 37°C and a rotation speed of 400-450 rpm for 5-6 hours. After amplification, enzyme inactivation is preferably performed. The preferred enzyme inactivation temperature is 60-70°C, but can be 65°C. The preferred enzyme inactivation time is 8-10 minutes, but can be 9 minutes. The length of the amplified long chain 1 or long chain 2 is preferably 40-50 kb.

[0024] In this invention, during the preparation of the DNA gel, the hybridization conditions are preferably 36.5-37.5°C at a reaction speed of 550-650 rpm for 8-12 minutes, or 37°C at a reaction speed of 600 rpm for 10 minutes. In one embodiment of this invention, the freeze-dried DNA hydrogel was characterized by scanning electron microscopy, and the results showed that the DNA hydrogel exhibited a uniform and dense three-dimensional network porous structure.

[0025] In this invention, a nucleic acid aptamer and a signal strand modified with electrochemically active groups are hybridized to obtain an aptamer-signal probe. The hybridization reaction system is preferably a 1:1 molar mixture of a nucleic acid aptamer (AP) stock solution and a signal strand (SP) stock solution. The concentrations of the AP and SP stock solutions are preferably 10 μM, and their volumes are 50 μL each. The hybridization reaction is preferably carried out in a 95°C water bath for 5 minutes.

[0026] In another embodiment of the invention, after staining target cells with dye, compared with untreated control cells, control groups without aptamer-signal probes, and control groups with introduced irrelevant single-stranded DNA, the addition of DNA hydrogel and aptamer-signal probes specifically captured target cells, with extremely low fluorescence intensity in the residual supernatant. This indicates that both the nucleic acid aptamer and the DNA hydrogel in the aptamer-signal probe play a role in cell capture and are highly specific, unaffected by other cell types in the test sample.

[0027] This invention provides the use of the reagent in capturing circulating tumor cells or in preparing kits for capturing and / or detecting circulating tumor cells or metastatic tumors.

[0028] In this invention, there are no specific limitations on the tumor source of circulating tumor cells. aptamer-signal probes can be prepared using nucleic acid aptamers of specific markers expressed on the surface of circulating tumor cells from tumor sources well-known or of interest in the art. In one embodiment of this invention, circulating tumor cells derived from breast cancer are used as an example to illustrate the capture or detection method of the reagent. In another embodiment of this invention, clinical samples are used as the detection target, and the reagent is used for detection. The results show that samples from healthy volunteers only exhibit a low electrochemical response similar to the background signal; while the vast majority of metastatic breast cancer patients can produce a significantly high electrochemical response, indicating that metastatic breast cancer patients have a higher level of breast cancer circulating tumor cells.

[0029] This invention provides a method for capturing or detecting circulating tumor cells for non-diagnostic purposes, comprising the following steps: The aptamer-signal probe in the reagent is mixed with the sample to be tested and incubated to separate the cell solid phase; The cells were resuspended in a solid phase and then mixed with long chain 1 and long chain 2 in the reagent and incubated to separate the DNA hydrogel precipitate and liquid phase. The DNA hydrogel precipitate was washed, and the washing solution was combined with the liquid phase to obtain the test solution. Electrochemical tests were performed on the test solution, and electrochemical signals were collected. The content of circulating tumor cells in the test sample was obtained based on the electrochemical signals.

[0030] In this invention, the aptamer-signal probe in the reagent is mixed and incubated with the sample to be tested to separate the cell solid phase.

[0031] In this invention, the test sample includes tissue fluids such as peripheral blood and lymph. The test sample is preferably a cell mixture with red blood cells removed. The mixing volume ratio of the aptamer-signal probe to the test sample is preferably 1:1. The working concentration of the aptamer-signal probe is preferably 4-6 μM, and can be 5 μM. The incubation conditions are preferably 20-25°C for 20-30 minutes, or 22-24°C for 22-28 minutes, or 23°C for 25 minutes. The method for separating the cell solid phase is preferably centrifugation. The centrifugation speed is preferably 250-300 g, and can be 280 g. The centrifugation time is preferably 5-10 minutes, and can be 8 minutes.

[0032] After obtaining the cell solid phase, the present invention resuspends the cell solid phase and mixes it with long chain 1 and long chain 2 in the reagent and incubates it to separate the DNA hydrogel precipitate and liquid phase.

[0033] In this invention, the resuspension method preferably involves resuspending the cell solid phase in 1× phosphate buffer of the same sample volume. The preferred method for incubating with the long-chain 1 and long-chain 2 solutions is to add the long-chain 1 solution to the resuspension, react at 37°C and 400-450 rpm for 15-20 minutes, then add the long-chain 2 solution, and react again at 37°C and 500-600 rpm for 10-15 minutes. The preferred volume ratio of the resuspension, long-chain 1 solution, and long-chain 2 solution is 2:1:1.

[0034] After preparing the DNA hydrogel precipitate, the present invention washes the DNA hydrogel precipitate, and combines the washing solution with the liquid phase to obtain the test solution.

[0035] In this invention, the washing solution is preferably 1× phosphate buffer. The volume ratio of the washing solution to the sample is preferably 0.2~0.25:1, and can be 0.2:1. The washing is preferably performed 2~4 times, and can be 3 times. The purpose of the washing is to remove the signal strands modified with electrochemically active groups remaining in the DNA hydrogel precipitate, thereby increasing the accuracy of detection.

[0036] After obtaining the test solution, the present invention performs electrochemical testing on the test solution, collects electrochemical signals, and obtains the content of circulating tumor cells in the test sample based on the electrochemical signals.

[0037] In this invention, prior to the electrochemical test, the test solution is preferably subjected to enzymatic digestion and enzyme inactivation. The protease used for digestion is preferably DNase I. The preferred reaction system for digestion is 2 μL of 0.5–1 U / μL DNase I and 20 μL of 10×DNase I buffer. The preferred reaction procedure for digestion is incubation at 20–25°C for 30–40 minutes, or incubation at 23°C for 35 minutes. The purpose of the digestion is to degrade the signal chain into short fragments of small molecular weight, which is beneficial for improving the electrochemical signal intensity.

[0038] In this invention, the electrode used for electrochemical testing preferably comprises a gold electrode or an indium tin oxide (ITO) electrode. The electrode is preferably activated before use. In this embodiment, an indium tin oxide (ITO) electrode is used as an example for electrochemical testing. The activation method for the indium tin oxide electrode preferably involves ultrasonically cleaning the ITO electrode sequentially with acetone, ethanol, and double-distilled water; treating the electrode in a mixed solution; thoroughly rinsing the electrode surface with double-distilled water; and treating the electrode in 200 μL of 0.8–1 mM sodium hydroxide solution for 4–5 hours; ultrasonically cleaning the electrode with double-distilled water for 2–3 minutes; and drying it with nitrogen gas. The mixed solution preferably comprises 28% ammonia, 30% hydrogen peroxide, and double-distilled water in a volume ratio of 1:1:6. The treatment conditions are preferably at 80–90°C for 25–30 minutes. The electrochemical testing method preferably includes square wave voltammetry or linear voltammetry.

[0039] In this invention, to achieve quantitative detection of target circulating tumor cells, a standard curve was also constructed. The preferred method for constructing the curve involves using concentrations of 5 cells / mL, 50 cells / mL, 500 cells / mL, and 1×10⁻⁶ cells / mL. 4 Cells / mL, 5×10 4 cells / mL, 1×10 5 The target circulating tumor cells per milliliter were detected using the method described above, and the corresponding square wave voltammetric peak current values ​​were collected. A standard curve was obtained by plotting the square wave voltammetric peak current value on the ordinate and the logarithm of the cell concentration on the abscissa after fitting. In this embodiment of the invention, the linear equation plotted is as follows: I = 0.265lg C – 0.087 ( R 2 =0.998). Based on the equation, the detection sensitivity and clinical samples were calculated, and the detection limit for MCF-7 cells was as low as 2.6 cells / mL, demonstrating superior sensitivity compared to existing electrochemical analysis methods.

[0040] In this invention, to further analyze and detect the captured target circulating tumor cells, the method further includes dissociating the captured cells from the DNA hydrogel. The dissociation reagent is preferably DNase I and 10× DNase I buffer. DNase I acts as an enzymatic digestor of the nucleotide sequence, thereby releasing the bound target circulating tumor cells. The preferred dissociation conditions are: resuspending the separated DNA hydrogel in 1× phosphate buffer, adding 2 μL of 1-2 U / μL DNase I and 10 μL of 10× DNase I buffer, mixing thoroughly, and incubating at 20-25°C for 30-40 minutes. This dissociation achieves the non-destructive release of the captured circulating tumor cells.

[0041] The following detailed description, in conjunction with embodiments, illustrates a reagent for capturing and analyzing circulating tumor cells based on DNA hydrogels, its preparation method, and its applications. However, these descriptions should not be construed as limiting the scope of protection of this invention.

[0042] Example 1 The steps of DNA hydrogel-based breast cancer cell capture are as follows: (1) Preparation of template DNA loops for the circumduction reaction: Take 2 μL of 100 μM DNA template strand T1 (or T2), 2 μL of 100 μM DNA primer strand P1 (or P2), 2 μL of 0.8 M sodium chloride solution and 14 μL of double-distilled water into a microtube, mix well and place in a 90~95℃ water bath for 5 min, and cool naturally to room temperature; then add 7 μL of 3 U / μL T4 DNA ligase, 70 μL of 10× T4 DNA ligase buffer and 603 μL of double-distilled water into the microtube, mix well and place in a 16℃ metal bath for 8 hours, and then transfer to a 65℃ metal bath for 10 min to inactivate T4 DNA ligase.

[0043] (2) Preparation of long DNA chains for DNA hydrogel formation: Take 17.2 μL of template DNA loop 1 (or loop 2) prepared in step (1), 2 μL of 10 U / μL DNA polymerase, 10 μL of 10× DNA polymerase buffer, 1 μL of 20 mg / mL bovine serum albumin solution, 10 μL of 0.8 M sodium chloride solution, 4 μL of 25 mM dNTPs and 55.8 μL of deionized water into a microtube, mix well and place on a shaker, react at 450 rpm for 6 hours at 37℃, and then place the microtube in a 65℃ metal bath for 8 min to end the reaction.

[0044] (3) Preparation of aptamer-signal probe: The specific process is as follows: Take the stock solution containing the nucleic acid aptamer sequence targeting MUC1 on the surface of breast cancer circulating tumor cells, AP and SP in a 1:1 molar ratio in a microtube, mix them evenly, and place them in a 95℃ water bath for 5 min, and then cool them naturally to room temperature; the concentration of AP and SP stock solutions used is 10 μM and the volume is 50 μL.

[0045] (4) Take 100 μL of a solution containing a certain concentration of breast cancer cells and 2.5 μL of 120 μM DiO solution into a microtube, mix them evenly and incubate at 37°C for 30 min; then, centrifuge the mixed solution at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0046] (5) Take 100 μL of the cell resuspension obtained in step (4) and 100 μL of the aptamer-signal probe prepared in step (3) into a microtube, mix them evenly and incubate them at 25°C for 30 min; then, centrifuge the mixed solution at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0047] (6) Add 50 μL of DNA long chain 1 prepared in step (2) to the cell resuspension obtained in step (5), mix well and place on a shaker, and react at 450 rpm for 20 min at 37°C; then add 50 μL of DNA long chain 2 prepared in step (2) to the solution, mix well and place on a shaker, and react at 600 rpm for 10 min at 37°C to obtain DNA hydrogel precipitate and supernatant.

[0048] (7) Use a pipette to aspirate the supernatant from the microtube obtained in step (6) and transfer it to a new microtube. Gently wash the DNA hydrogel three times with 1× phosphate buffer, and combine the washing solution with the supernatant. Then centrifuge the mixture at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0049] (8) The fluorescence signal of the cell resuspension obtained in step (7) was measured using a fluorescence spectrometer. The specific parameters were: excitation wavelength of 480 nm and emission wavelength scanning range of 490 nm to 550 nm.

[0050] in: The DNA template strand T1 used in step (1) has the following sequence: 5'-Phosphate-CAGCCATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTAGGAAGATCAAATGA-3', the template strand T2 has the following sequence: 5'-Phosphate-TCATTTGATCTTCCTATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTGGCTG-3', the primer strand P1 has the following sequence: 5'-TGGCTGTCATTTGATCTTCCTA-3', and the primer strand P2 has the following sequence: 5'-TAGGAAGATCAAATGACAGCCA-3'.

[0051] The aptamer chain AP sequence used in step (3) is 5'-GCAGTTGATCCTTTGGATACCCTTG-Space 9-ACCTGGGGGAGTATTGC-3' (SEQ ID NO:11), and the signal chain SP sequence is 5'-GCAATACTCCCC-3'.

[0052] Figure 2 Scanning electron microscopy (SEM) characterization results of the DNA hydrogel prepared via a cyclization reaction are presented. Observation after freeze-drying pretreatment revealed that the DNA hydrogel exhibits a uniform and dense three-dimensional network porous structure. This structure not only aligns with the principles anticipated in this invention but also provides ample spatial support for the multi-point synergistic capture of circulating tumor cells in breast cancer. Subsequently, the performance of this DNA hydrogel for capturing circulating tumor cells in breast cancer was investigated using MUC1-positive breast cancer cells (MCF-7) as a model. Figure 3 The corresponding fluorescence spectral results are presented. To obtain measurable fluorescence signals, MCF-7 cells were pre-stained with the lipophilic dye DiO (fluorescence intensity is linearly positively correlated with cell number). The blank control group a (untreated MCF-7 cells) produced a significant and stable fluorescence signal at the characteristic emission wavelength of DiO, indicating good staining effect; while for experimental group b (MCF-7 cells incubated with DNA hydrogel), the fluorescence intensity of the supernatant was significantly reduced (by more than 85%), showing only a weak signal. This indicates that most MUC1-positive MCF-7 cells were specifically captured by the DNA hydrogel, verifying its highly efficient capture performance.

[0053] Figure 4Further, the fluorescence characterization results of MCF-7 cells and control breast cancer cells (MUC1-negative MDA-MB-453 cells) captured using DNA hydrogels were shown with and without the introduction of aptamer-signal probes targeting MUC1. For MCF-7 cells, the fluorescence signal in the supernatant of experimental group a, which introduced the aptamer-signal probe, was significantly reduced after incubation; while the supernatant of control group b, which did not introduce the aptamer-signal probe, and control group c, which replaced the MUC1 aptamer chain with irrelevant single-stranded DNA (5'-ACGTGATCTAGGGTTACCGATCCAAC-3', SEQ ID NO:11), maintained a significant fluorescence signal, indicating that MCF-7 cells were not effectively captured in these two cases, confirming that specific aptamer recognition is the key to efficient cell capture. For MDA-MB-453 control cells, regardless of whether aptamer-signal probes were introduced, the fluorescence signal of the supernatant after incubation with DNA hydrogel was basically consistent with that of the untreated cell samples. This result not only further verifies the role of aptamer recognition in cell capture, but also fully demonstrates the high specificity of DNA hydrogel-based capture of circulating tumor cells in breast cancer in this invention.

[0054] Example 2 The steps for capturing target breast cancer cells from a mixed cell sample are as follows: (1) Prepare template DNA loops for the circulation reaction. The specific process is as follows: Take 2 μL of 100 μM DNA template strand T1 (or T2), 2 μL of 100 μM DNA primer strand P1 (or P2), 2 μL of 0.8 M sodium chloride solution and 14 μL of double-distilled water into a microtube, mix well and place in a 95℃ water bath for 5 min, and then cool naturally to room temperature; then add 7 μL of 3 U / μL T4 DNA ligase, 70 μL of 10× T4 DNA ligase buffer and 603 μL of double-distilled water into the microtube, mix well and place in a 16℃ metal bath for 8 hours, and then transfer to a 65℃ metal bath for 10 min to inactivate T4 DNA ligase.

[0055] (2) Preparation of long DNA chains for DNA hydrogel formation: Take 17.2 μL of template DNA loop 1 (or loop 2) prepared in step (1), 2 μL of 10 U / μL DNA polymerase, 10 μL of 10× DNA polymerase buffer, 1 μL of 20 mg / mL bovine serum albumin solution, 10 μL of 0.8 M sodium chloride solution, 4 μL of 25 mM dNTPs and 55.8 μL of deionized water into a microtube, mix well and place on a shaker, react at 450 rpm for 6 hours at 37℃, and then place the microtube in a 65℃ metal bath for 8 min to end the reaction.

[0056] (3) Preparation of aptamer-signal probe: The specific process is as follows: Take the stock solution containing the nucleic acid aptamer sequence targeting MUC1 on the surface of breast cancer circulating tumor cells, AP and SP in a 1:1 molar ratio in a microtube, mix them evenly, and place them in a 95℃ water bath for 5 min, and then cool them naturally to room temperature; the concentration of AP and SP stock solutions used is 10 μM and the volume is 50 μL.

[0057] (4) Take 100 μL of a solution containing a certain concentration of MCF-7 cells and 2.5 μL of 120 μM DiO solution into a microtube, mix them evenly and incubate at 37°C for 30 min; then, centrifuge the mixture at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0058] (5) Take 100 μL of a solution containing a certain concentration of MDA-MB-453 cells (or peripheral blood mononuclear cells PBMCs) and 2.5 μL of 120 μM DiI solution into a microtube, mix them evenly and incubate at 37°C for 30 min; then, centrifuge the mixed solution at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0059] (6) Take 10 μL of the cell resuspension obtained in step (4), 90 μL of the cell resuspension obtained in step (5) and 100 μL of the aptamer-signal probe prepared in step (3) into a microtube, mix them evenly and incubate them at 25°C for 30 min; then, centrifuge the mixed solution at 300 g centrifugation force for 5 min, and resuspend the resulting cell pellet in 100 μL 1× phosphate buffer.

[0060] (7) Add 50 μL of DNA long chain 1 prepared in step (2) to the cell resuspension obtained in step (6), mix well and place on a shaker, and react at 450 rpm for 20 min at 37°C; then add 50 μL of DNA long chain 2 prepared in step (2) to the solution, mix well and place on a shaker, and react at 600 rpm for 10 min at 37°C to obtain DNA hydrogel precipitate and supernatant.

[0061] (8) Use a pipette to aspirate the supernatant from the microtube obtained in step (7) and transfer it to a new microtube. Gently wash the DNA hydrogel three times with 1× phosphate buffer, and combine the washing solution with the supernatant. Then centrifuge the mixture at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0062] (9) Resuspend the DNA hydrogel treated in step (7) in 88 μL of 1× phosphate buffer, add 2 μL of 1~2 U / μL DNase I and 10 μL of 10× DNase I buffer, mix well and incubate at 20~25℃ for 30~40 min to achieve non-destructive release of captured breast cancer cells; then, use a pipette to aspirate the supernatant and transfer it to a new microtube, and gently wash the DNA hydrogel three times with 1× phosphate buffer, and combine the washing solution with the supernatant above; then, centrifuge the mixed solution at 300 g for 5 min, and resuspend the obtained cell pellet in 100 μL of 1× phosphate buffer.

[0063] (10) Use a fluorescence microscope to obtain fluorescence images of the cell resuspensions obtained in steps (8) and (9), and use ImageJ software to perform quantitative analysis of the green and orange-red fluorescence channels.

[0064] Wherein: the sequence of DNA template strand T1 used in step (1) is: 5'-Phosphate-CAGCCATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTAGGAAGATCAAATGA-3'. The sequence of template strand T2 is: 5'-Phosphate-TCATTTGATCTTCCTATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTGGCTG-3', and the sequence of primer strand P1 is: 5'-TGGCTGTCATTTGATCTTCCTA-3'. The sequence of primer P2 is: 5'-TAGGAAGATCAAATGACAGCCA-3'.

[0065] The AP sequence of the aptamer strand used in step (3) is 5'-GCAGTTGATCCTTTGGATACCCTTG-Space 9-ACCTGGGGGAGTATTGC-3'; The sequence of the signal chain SP is 5'- GCAATACTCCCC-3'.

[0066] Figure 5This study demonstrates the experimental results of specifically capturing target breast cancer cells from a mixed cell sample using DNA hydrogel. The sample consisted of a 1:9 mixture of MCF-7 cells pre-stained with DiO (green fluorescence) and MDA-MB-453 cells stained with the lipophilic dye DiI (orange-red fluorescence). Quantitative analysis of the green and orange-red fluorescence channels using ImageJ software revealed that in the untreated original mixed sample, both channels showed fluorescence signals of varying intensities; however, after incubation with the DNA hydrogel, the cell population captured by the hydrogel only showed fluorescence signals in the green channel, while the remaining cell population only showed fluorescence signals in the orange-red channel. This result indicates that the DNA hydrogel capture strategy has high selectivity and accuracy for the target breast cancer cells. To further validate this strategy, parallel experiments were conducted in a mixed sample constructed from DiO-labeled MCF-7 cells and DiI-labeled PBMCs at the same ratio (1:9). Similarly, the DNA hydrogel successfully achieved precise capture and enrichment of the target breast cancer cells. Figure 6 This further confirms its excellent selectivity and accuracy.

[0067] Example 3 The steps for capturing and electrochemically analyzing breast cancer cells based on DNA hydrogels are as follows: (1) Prepare template DNA loops for the circulation reaction. The specific process is as follows: Take 2 μL of 100 μM DNA template strand T1 (or T2), 2 μL of 100 μM DNA primer strand P1 (or P2), 2 μL of 0.8 M sodium chloride solution and 14 μL of double-distilled water into a microtube, mix well and place in a 95℃ water bath for 5 min, and then cool naturally to room temperature; then add 7 μL of 3 U / μL T4 DNA ligase, 70 μL of 10× T4 DNA ligase buffer and 603 μL of double-distilled water into the microtube, mix well and place in a 16℃ metal bath for 8 hours, and then transfer to a 65℃ metal bath for 10 min to inactivate T4 DNA ligase.

[0068] (2) Preparation of long DNA chains for DNA hydrogel formation: Take 17.2 μL of template DNA loop 1 (or loop 2) prepared in step (1), 2 μL of 10 U / μL DNA polymerase, 10 μL of 10× DNA polymerase buffer, 1 μL of 20 mg / mL bovine serum albumin solution, 10 μL of 0.8 M sodium chloride solution, 4 μL of 25 mM dNTPs and 55.8 μL of deionized water into a microtube, mix well and place on a shaker, react at 450 rpm for 6 hours at 37℃, and then place the microtube in a 65℃ metal bath for 8 min to end the reaction.

[0069] (3) Preparation of aptamer-signal probe: The specific process is as follows: Take the aptamer strand AP containing the nucleic acid aptamer sequence targeting MUC1 on the surface of breast cancer circulating tumor cells and the signal strand SP modified with methylene blue group at the 5' end in a 1:1 molar ratio in a microtube, mix them evenly, and place them in a 95℃ water bath for 5 min, and then cool them naturally to room temperature; the concentration of AP and SP stock solutions used is 10 μM and the volume is 50 μL.

[0070] (4) Take 100 μL of a solution containing a certain concentration of breast cancer cells and 100 μL of the aptamer-signal probe prepared in step (3) into a microtube, mix them evenly and incubate them at 25°C for 30 min; then, centrifuge the mixed solution at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0071] (5) The cell resuspension obtained in step (4) is mixed with 50 μL of DNA long chain 1 prepared in step (2) in a microtube, and then placed on a shaker at 37°C and reacted at 450 rpm for 20 min; then, 50 μL of DNA long chain 2 prepared in step (2) is added to the microtube, mixed evenly, and placed on a shaker at 37°C and reacted at 600 rpm for 10 min to obtain DNA hydrogel precipitate and supernatant.

[0072] (6) Use a pipette to aspirate the supernatant from the microtube obtained in step (5) and transfer it to a new microtube. Gently wash the DNA hydrogel three times with 1× phosphate buffer, and combine the washing solution with the supernatant. Then add 2 μL of 0.5~1 U / μL DNase I and 20 μL of 10× DNase I buffer to the mixture, mix thoroughly, and incubate at 25°C for 40 min.

[0073] (7) Pretreatment of ITO electrode: The ITO electrode was ultrasonically cleaned with acetone, ethanol and double-distilled water in sequence; then, the electrode was placed in 200 μL of a mixed solution of 28% ammonia, 30% hydrogen peroxide and double-distilled water with a volume ratio of 1:1:6 and treated at 85℃ for 30 min; after treatment, the electrode surface was thoroughly rinsed with double-distilled water and the electrode was placed in 200 μL of 1 mM sodium hydroxide solution for 4 hours; then, the electrode was ultrasonically cleaned with double-distilled water for 3 min and dried with nitrogen.

[0074] (8) Place the ITO electrode obtained from the pretreatment in step (7) into the solution obtained in step (6) and use square wave voltammetry to collect electrochemical signals. The specific parameters are: scanning potential, -0.4 V to 0 V; amplitude, 25 mV.

[0075] Wherein: the sequence of DNA template strand T1 used in step (1) is: 5'-Phosphate-CAGCCATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTAGGAAGATCAAATGA-3'. The sequence of template strand T2 is: 5'-Phosphate-TCATTTGATCTTCCTATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTGGCTG-3', the sequence of primer strand P1 is: 5'-TGGCTGTCATTTGATCTTCCTA-3', and the sequence of primer strand P2 is: 5'-TAGGAAGATCAAATGACAGCCA-3'.

[0076] The AP sequence of the aptamer strand used in step (3) is 5'-GCAGTTGATCCTTTGGATACCCTTG-Space 9-ACCTGGGGGAGTATTGC-3'; The sequence of the signal chain SP is 5'-methylene blue-GCAATTCCCC-3'.

[0077] Figure 7 Figure A shows the effect of this DNA hydrogel on 1×10 6 Square wave voltammetry spectra were obtained during capture and electrochemical analysis of MCF-7 cells per mL, as well as in the control experiment. The figures show that the presence of target MCF-7 cells resulted in an electrochemical response peak at approximately -0.2 V at which methylene blue was attributed (curve a). In contrast, the blank control group lacking target cells, the control group lacking aptamer-signal probes, and the control group where the MUC1 aptamer strand was replaced with irrelevant single-stranded DNA (5'-ACGTGATCTAGGGTTACCGATCCAAC-3') showed only small background signal peaks at the same potential (curves b to d). These results not only confirm the feasibility of using the DNA hydrogel proposed in this invention for the capture and analysis of target breast cancer cells but also reflect the crucial value of aptamer recognition in this process.

[0078] The concentrations were 5 cells / mL, 50 cells / mL, 500 cells / mL, and 1×10⁻⁶ cells / mL, respectively. 4 Cells / mL, 5×10 4 cells / mL, 1×10 5 MCF-7 cells per milliliter were processed according to the steps described above, and the corresponding square wave voltammetric peak current values ​​were collected. A graph was plotted with the square wave voltammetric peak current value on the ordinate and the logarithm of the MCF-7 cell concentration on the abscissa, and a standard curve was obtained after fitting.

[0079] Figure 7 Figure B shows the experimental results of capturing and analyzing MCF-7 cells at different concentrations using DNA hydrogels. As shown in the figure, the concentrations ranged from 5 to 1 × 10⁻⁶ cells. 5 Within the range of cells / mL, the square wave voltammetry peak increased with increasing MCF-7 cell concentration, and the peak current value... I Logarithm of MCF-7 cell concentration (lg) C The linear relationship is well observed, and the linear equation is: I = 0.265lg C – 0.087 ( R 2 =0.998). Based on this equation, the detection limit for MCF-7 cells is as low as 2.6 cells / mL.

[0080] Example 4 The steps for capturing and electrochemically analyzing circulating tumor cells from breast cancer in clinical blood samples are as follows: (1) Prepare template DNA loops for the circulation reaction. The specific process is as follows: Take 2 μL of 100 μM DNA template strand T1 (or T2), 2 μL of 100 μM DNA primer strand P1 (or P2), 2 μL of 0.8 M sodium chloride solution and 14 μL of double-distilled water into a microtube, mix well and place in a 95℃ water bath for 5 min, and then cool naturally to room temperature; then add 7 μL of 3 U / μL T4 DNA ligase, 70 μL of 10× T4 DNA ligase buffer and 603 μL of double-distilled water into the microtube, mix well and place in a 16℃ metal bath for 8 hours, and then transfer to a 65℃ metal bath for 10 min to inactivate T4 DNA ligase.

[0081] (2) Preparation of long DNA chains for DNA hydrogel formation: Take 17.2 μL of template DNA loop 1 (or loop 2) prepared in step (1), 2 μL of 10 U / μL DNA polymerase, 10 μL of 10× DNA polymerase buffer, 1 μL of 20 mg / mL bovine serum albumin solution, 10 μL of 0.8 M sodium chloride solution, 4 μL of 25 mM dNTPs and 55.8 μL of deionized water into a microtube, mix well and place on a shaker, react at 450 rpm for 6 hours at 37℃, and then place the microtube in a 65℃ metal bath for 8 min to end the reaction.

[0082] (3) Preparation of aptamer-signal probe: The specific process is as follows: Take the aptamer strand AP containing the nucleic acid aptamer sequence targeting MUC1 on the surface of breast cancer circulating tumor cells and the signal strand SP modified with methylene blue group at the 5' end in a 1:1 molar ratio in a microtube, mix them evenly, and place them in a 95℃ water bath for 5 min, and then cool them naturally to room temperature; the concentration of AP and SP stock solutions used is 10 μM and the volume is 50 μL.

[0083] (4) After obtaining approval from the Ethics Committee of Shanghai University and informed consent from the participants, peripheral blood samples (3 mL each) were collected from 6 healthy volunteers and 12 patients with metastatic estrogen receptor-positive breast cancer. After collection, each sample was first mixed with 10 times its volume of erythrocyte lysis buffer at 4°C for 10 min. Subsequently, the mixture was centrifuged at 300 g at 4°C for 5 min. The resulting cell pellet was washed and resuspended in 3 mL of 1× phosphate buffer.

[0084] (5) Take 100 μL of the cell resuspension obtained in step (4) and 100 μL of the aptamer-signal probe prepared in step (3) into a microtube, mix them evenly and incubate them at 25°C for 30 min; then, centrifuge the mixed solution at 300 g for 5 min and resuspend the resulting cell pellet in 100 μL of 1× phosphate buffer.

[0085] (6) The cell resuspension obtained in step (5) is mixed with 50 μL of DNA long chain 1 prepared in step (2) in a microtube, and then placed on a shaker at 37°C and reacted at 450 rpm for 20 min; then, 50 μL of DNA long chain 2 prepared in step (2) is added to the microtube, mixed evenly, and placed on a shaker at 37°C and reacted at 600 rpm for 10 min to obtain DNA hydrogel precipitate and supernatant.

[0086] (7) Use a pipette to aspirate the supernatant from the microtube obtained in step (6) and transfer it to a new microtube. Gently wash the DNA hydrogel three times with 1× phosphate buffer and combine the washing solution with the supernatant. Then add 2 μL of 1 U / μL DNase I and 20 μL of 10× DNase I buffer to the mixture, mix thoroughly, and incubate at 25°C for 40 min.

[0087] (8) Pretreatment of ITO electrode: The ITO electrode was ultrasonically cleaned with acetone, ethanol and double-distilled water in sequence. Then, the electrode was placed in 200 μL of a mixed solution of 28% ammonia, 30% hydrogen peroxide and double-distilled water with a volume ratio of 1:1:6 and treated at 85°C for 30 min. After treatment, the electrode surface was thoroughly rinsed with double-distilled water and the electrode was placed in 200 μL of 1 mM sodium hydroxide solution for 4 hours. Then, the electrode was ultrasonically cleaned with double-distilled water for 3 min and dried with nitrogen.

[0088] (9) Place the ITO electrode obtained from the pretreatment in step (8) into the solution obtained in step (7) and collect the electrochemical signal using square wave voltammetry. The specific parameters are: scanning potential, -0.4 V to 0 V; amplitude, 25 mV.

[0089] Wherein: the sequence of DNA template strand T1 used in step (1) is: 5'-Phosphate-CAGCCATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTAGGAAGATCAAATGA-3'. The sequence of template strand T2 is: 5'-Phosphate-TCATTTGATCTTCCTATCCCTCTATGATCCTACTCATCTGTGAAGAGAACCTGGGGGAGTATTGCGGAGGAAGGTACTTGGTACTTTGGCTG-3', and the sequence of primer strand P1 is: 5'-TGGCTGTCATTTGATCTTCCTA-3'. The sequence of primer P2 is: 5'-TAGGAAGATCAAATGACAGCCA-3'.

[0090] The AP sequence of the aptamer strand used in step (3) is 5'-GCAGTTGATCCTTTGGATACCCTTG-Space 9-ACCTGGGGGAGTATTGC-3'; The sequence of the signal chain SP is 5'-methylene blue-GCAATTCCCC-3'.

[0091] Figure 8 The results of using DNA hydrogels for capturing and electrochemically analyzing circulating tumor cells (CTCs) in clinical samples are presented. As can be seen from the figures, samples from healthy volunteers showed only low electrochemical responses comparable to the background signal; while the vast majority (11 / 12) of patients with metastatic breast cancer exhibited significantly high electrochemical responses. These results indicate that patients with metastatic breast cancer have higher levels of CTCs and also confirm the practical application value of the DNA hydrogel of this invention in complex clinical samples.

[0092] Table 1 Comparison of Electrochemical Detection Methods for Tumor Cells

[0093] As shown in Table 1, the detection limit of the method in this application reaches 2.6 cells / mL, and the detection sensitivity is superior to the detection sensitivity results obtained by different methods reported in the prior art.

[0094] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A reagent for capturing and analyzing circulating tumor cells based on DNA hydrogels, characterized in that, Including DNA hydrogels and aptamer-signal probes; The aptamer-signal probe is formed by hybridizing an aptamer chain and a signal chain modified with electrochemically active groups. The aptamer chain comprises a tandem nucleic acid aptamer, a spacer sequence, and a substitution fragment; the aptamer chain hybridizes with a signaling chain via a portion of the substitution fragment; the nucleic acid aptamer is used to bind specific biomarkers on the surface of circulating tumor cells; The DNA hydrogel is formed by hybridization of long chain 1 and long chain 2 with complementary sequences; the long chain 1 and / or long chain 2 contains a plurality of recognition response units complementary to the substitution fragment.

2. The reagent according to claim 1, characterized in that, The long chain 1 is prepared by rolling circle amplification of template DNA loop 1, which is obtained by circulant reaction of template strand T1 with the assistance of primer strand P1; the nucleotide sequence of template strand T1 is shown in SEQ ID NO:1; the nucleotide sequence of primer strand P1 is shown in SEQ ID NO:

2. The long chain 2 is prepared by rolling circle amplification of template DNA loop 2, which is obtained by circulant reaction of template strand T2 with the assistance of primer strand P2; the nucleotide sequence of template strand T2 is shown in SEQ ID NO:3; the nucleotide sequence of primer strand P2 is shown in SEQ ID NO:

4. The nucleotide sequence of the recognition response unit in the long chain 1 or long chain 2 is shown in SEQ ID NO:

5.

3. The reagent according to claim 1, characterized in that, When the circulating tumor cells originate from breast cancer, the circulating tumor cell surface-specific markers include at least one of the following: mucin 1, trophoblast cell surface antigen 2, and epidermal growth factor receptor; The nucleotide sequence of the mucin 1 aptamer is shown in SEQ ID NO:6; The nucleotide sequence of trophoblast cell surface antigen 2 is shown in SEQ ID NO:7; The nucleotide sequence of the epidermal growth factor receptor is shown in SEQ ID NO:

8.

4. The reagent according to claim 1, characterized in that, The nucleotide sequence of the signal chain modified with electrochemically active groups is shown in SEQ ID NO:

10.

5. The reagent according to claim 1 or 4, characterized in that, The electrochemically active groups include any one of the following: methylene blue, ferrocene, and silver nanoparticles.

6. A method for preparing the reagent according to any one of claims 1 to 5, characterized in that, Includes the following steps: Template DNA loop 1 or template DNA loop 2 obtained by the circularization reaction of template strand T1 or template strand T2 is amplified by rolling circle under the action of DNA polymerase to obtain DNA long chain 1 or DNA long chain 2; the DNA long chain 1 and DNA long chain 2 are hybridized to form a DNA hydrogel. The nucleic acid aptamer and the signal strand modified with electrochemically active groups are hybridized to obtain the aptamer-signal probe.

7. The use of the reagent according to any one of claims 1 to 5 in capturing circulating tumor cells.

8. The use of the reagent according to any one of claims 1 to 5 in the preparation of a kit for capturing or detecting circulating tumor cells or metastatic tumors.

9. The application according to claim 7 or 8, characterized in that, The circulating tumor cells are derived from sources including breast cancer.

10. A method for capturing or detecting circulating tumor cells for non-diagnostic purposes, characterized in that, Includes the following steps: The aptamer-signal probe in any one of the reagents described in claims 1 to 5 is mixed with the sample to be tested and incubated to separate the cell solid phase; After resuspending the cells in a solid phase, they are mixed and incubated with long chain 1 and long chain 2 in any one of the reagents described in claims 1 to 5 to separate the DNA hydrogel precipitate and the liquid phase. The DNA hydrogel precipitate was washed, and the washing solution was combined with the liquid phase to obtain the test solution. Electrochemical tests were performed on the test solution, and electrochemical signals were collected. The content of circulating tumor cells in the test sample was obtained based on the electrochemical signals.

Images