Compounds and methods for inhibiting lpa

Abstract

Oligomeric duplexes, oligomeric compounds and antisense agents, methods, and pharmaceutical compositions are provided for reducing the amount or activity of LPA RNA in a cell or animal, and in certain cases, reducing the amount of Lp(a) in a subject. Such oligomeric duplexes, oligomeric compounds and agents, methods, and pharmaceutical compositions can be used to treat or manage inflammatory, cardiovascular, and / or metabolic diseases, disorders, or conditions.

Description

[0001] Cross-reference to related applications This application claims priority to U.S. Provisional Application No. 63 / 584,489, filed September 21, 2023, which is incorporated herein by reference in its entirety for any purpose.

[0002] sequence list This application is submitted together with the electronic sequence listing. The sequence listing is provided as a file named BIOL0478WOSEQ.xml, created on August 27, 2024, and is 19,863 KB in size. The contents of the electronic sequence listing are incorporated herein by reference in their entirety. Technical Field

[0003] This document provides oligomeric duplexes, oligomeric compounds, compositions, and uses thereof, including methods for regulating the amount and / or activity of ApoA expression, LPA RNA, and / or Lp(a), and methods for treating or managing inflammatory, cardiovascular, and / or metabolic diseases, disorders, or conditions, and in some embodiments, methods for improving at least one symptom of an inflammatory, cardiovascular, and / or metabolic disease, disorder, or condition. Background Technology

[0004] Lipoprotein(a) [Lp(a)] particles contain unique LDL particles, one of which, an apolipoprotein B (apoB) protein, is linked via a disulfide bond to a single apolipoprotein(a) [apo(a)] protein. The apo(a) protein exhibits high homology with plasminogen, particularly within the kringle IV type 2 repeat domain. Circulating Lp(a) levels are inversely proportional to the number of kringle IV type 2 variable repeat sequences present in the molecule, and heterozygous plasma isotype profiles can be observed between individuals due to the co-expression of both alleles within individuals (Kraft et al., Eur J Hum Genet, 1996; 4(2): 74-87). The kringle repeat domain in apo(a) is considered to be responsible for its prothrombotic and antifibrinolytic properties, potentially enhancing the progression of atherosclerosis. Apo(a) has been shown to preferentially bind to oxidized phospholipids and enhance vascular inflammation (Bergmark et al., J Lipid Res 2008; 49:2230–2239; Tsimikas et al., Circulation.2009;119(13):1711–1719). Furthermore, studies have shown that Lp(a) particles can also stimulate endothelial permeability, induce plasminogen activator inhibitor type 1 expression, and activate macrophage interleukin-8 secretion (Koschinsky and Marcovina, CurrOpin Lipidol 2004; 15:167–174). Importantly, genetic association studies revealed that Lp(a) is an independent risk factor for myocardial infarction, stroke, peripheral vascular disease, and abdominal aortic aneurysm (Rifai et al., Clin Chem 2004; 50:1364–71; Erqou et al., JAMA 2009;302:412–23; Kamstrup et al., Circulation 2008;117:176–84). Furthermore, Clarke... et al. The PROCARDIS study (Clarke et al., NEJM (2009) 361; 2518-2528) described a robust and independent association between coronary heart disease and plasma Lp(a) concentration; and Solfrizzi et al. proposed that increased serum Lp(a) may be associated with an increased risk of Alzheimer's disease (AD) (Solfrizzi et al., J Neurol Neurosurg Psychiatry 2002, 72:732-736).

[0005] In a clinical context, examples of indirect apo(a) inhibitors used to treat cardiovascular disease include aspirin, niacin (Niaspan), mipomersen, anacetrapib, epirotirome, and lomitapide, which reduce plasma Lp(a) levels by 18%, 39%, 32%, 36%, 43%, and 17%, respectively. Lp(a) plasma separation and replacement therapy has been used clinically to reduce Lp(a) particles containing apo(a). To date, proposed therapeutic strategies for treating cardiovascular disease by directly targeting apo(a) levels have been described (e.g., U.S. Patent Nos. 5,877,022, 8,138,328, 8,673,632, and 7,259,150; U.S. Patent Publication No. US20040242516; International Patent Application Publications Nos. WO2005 / 000201, WO2003 / 014397, WO2013 / 177468, WO 2014 / 179625, WO2017 / 059223, WO2020 / 099476, and WO 2022 / 032288; and Merki et al., J Am Coll Cardiol 2011; 57:1611–1621 and Tsimikas). et al. (Lancet. 2015 Oct 10;386:1472-83). Although active therapeutic agents have been developed, they have not yet been approved for commercial use. There remains a need for agents that can effectively and selectively reduce Lp(a) levels in subjects, including patients at increased risk of cardiovascular events due to chronically elevated plasma Lp(a) levels. In particular, there is a need for novel therapeutic agents that can be safely and frequently administered for the treatment and prevention of cardiovascular disease. Summary of the Invention

[0006] This document provides oligoduplexes, pharmaceutical compositions, and methods of use for reducing the amount or activity of LPA RNA in cells or subjects, and for reducing the expression of Apo(a) protein and / or Lp(a) in cells or subjects. In some embodiments, the subject has a disease or disorder associated with lipoprotein dysregulation or mutations in lipoprotein regulatory pathways. In some embodiments, the subject has elevated lipoprotein(a). In some embodiments, the subject has a severe cardiovascular disease, disorder, or condition, or is at risk of a severe cardiovascular disease, disorder, or condition. In some embodiments, the subject has a metabolic or inflammatory disease, disorder, or condition, or is at risk of a metabolic or inflammatory disease, disorder, or condition. In some embodiments, the agents that can be used to reduce the amount or activity of LPA RNA are oligoduplexes, oligomeric compounds, or compositions as provided herein. In some embodiments, the agents that can be used to reduce the expression of Apo(a) or the level of lipoprotein(a) are oligomeric compounds, oligoduplexes, antisense agents, and / or RNAi agents.

[0007] Modified oligonucleotides and compounds and compositions comprising them are provided, including but not limited to antisense agents, oligomers, oligoduplexes, and pharmaceutical compositions comprising modified oligonucleotides. In some embodiments, the modified oligonucleotides provided herein comprise a nucleobase sequence that is at least 80% complementary to an isolength portion of an LPA nucleic acid. In some embodiments, the modified oligonucleotides consist of 12 to 35, 14 to 30, 15 to 28, 16 to 25, or 18 to 23 linked nucleosides targeting LPA nucleic acids. In some embodiments, the modified oligonucleotides provided herein comprise a nucleobase sequence complementary to an isolength portion of the nucleobase sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the provided oligoduplexes comprise a first oligomeric compound and a second oligomeric compound, wherein the first oligomeric compound comprises a modified oligonucleotide consisting of 18 to 50 linked nucleosides, wherein the nucleobase sequence of the first oligomeric compound comprises SEQ ID NO: 1. The modified oligonucleotide contains at least 18, 19, 20, 21, 22, or 23 consecutive nucleobases in any one of the nucleobase sequences of 6 to 829 and 3078 to 3083, wherein each of the nucleosides of the modified oligonucleotide comprises a modified sugar moiety or sugar substitute, and wherein no more than 22%, 20%, 18%, 15%, 10%, or 5% of the modified nucleosides in the first oligomeric compound comprise a 2'-fluorosugar moiety or a 3'-fluoro-hexitol sugar substitute; and wherein the second oligomeric compound comprises a modified oligonucleotide consisting of 16 to 50 consecutive linked nucleosides, wherein the nucleobase sequence of the second oligomeric compound contains SEQ ID NO: The second oligomer contains at least 16, 17, 18, 19, 20, or 21 consecutive nucleobases in any of the sequences 830 to 1540 and 3096 to 3101, wherein each of the nucleosides comprises a modified sugar moiety or sugar substitute, and wherein no more than 25%, 20%, 18%, 16%, 14%, 12%, or 10% of the modified nucleosides in the second oligomer contains a 2'-fluorosugar moiety or a 3'-fluoro-hexitol sugar substitute. In some embodiments, the modified oligonucleotides provided herein comprise at least one modified sugar moiety and / or at least one modified nucleoside internucleotide bond. In some embodiments, the oligomers provided herein comprise a modified oligonucleotide containing at least one 3'-fluoro-hexitol sugar moiety. In some embodiments, the oligomers provided herein comprise a modified oligonucleotide containing at least one 2'-deoxynucleoside.In some embodiments, the oligomeric compounds provided herein comprise modified oligonucleotides conjugated to cell-targeting agents. The modified oligonucleotides described herein, as well as compositions comprising them (including, but not limited to, oligoduplexes, oligomeric compounds, modified oligonucleotides, and compositions), can be used to reduce or inhibit LPA expression in cells, organs, tissues, systems, organisms, or subjects.

[0008] In some embodiments, an oligomeric compound comprising a modified oligonucleotide comprising a nucleobase sequence selected from any of SEQ ID NO: 6 to 829 and 3078 to 3083, wherein the modified oligonucleotide comprises independently selected from efyyyfyyyyyyyyfyfyyyyyy, yfyyyfyyyyyyyyfyfyyyyyy, efyyydyyeyyyydydyyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyfyfyyyyyee, e[FHNA]yyy A modified glycosyl motif of one of fyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyeyyyyfyfyyyyyee, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents a 2'-OMe sugar motif, each 'f' represents a 2'-F sugar motif, each '[FHNA]' represents a 3'-fluoro-hexitol sugar motif, and each 'd' represents a 2'-deoxy sugar motif, wherein all are identical to the glycosyl motif except for 0, 1, or 2 modifications. In some embodiments, an oligomeric compound comprising a modified oligonucleotide comprising a sequence containing at least 18, at least 19, or at least 20 consecutive nucleobases of any one of the sequences SEQ ID NO: 1541 to 2364 and 3090 to 3095.

[0009] In some embodiments, an oligomeric compound comprising a modified oligonucleotide comprising a nucleobase sequence selected from any of SEQ ID NO: 830 to 1540 and 3096 to 3101, wherein the modified oligonucleotide comprises a modified glycosyl motif independently selected from yyyyyyfyfffyyyyyyyyy and eeyyyyyyyyffyyyyyyyee, wherein each “e” represents a 2'-MOE sugar motif, each “y” represents a 2'-OMe sugar motif, and each “f” represents a 2'-F sugar motif, wherein all are identical to the glycosyl motif except for 0, 1, or 2 modifications. In some embodiments, an oligomeric compound comprising a modified oligonucleotide comprising a sequence of at least 18, at least 19, or at least 20 consecutive nucleobases containing any of the sequences of SEQ ID NO: 2365 to 3075 and 3084 to 3089.

[0010] In some embodiments, an oligomeric compound comprising a modified oligonucleotide having a sequence selected from any one of SEQ ID NO: 6 to 1540, 3078 to 3089, and 3096 to 3101 is provided. In some embodiments, an oligomeric duplex comprising an oligomeric compound having a sequence selected from any one of SEQ ID NO: 6 to 3075 and 3078 to 3101 is provided. In some embodiments, an oligomerizing agent comprising an oligomeric compound having a sequence selected from any one of SEQ ID NO: 1541 to 3075 and 3084 to 3095 is provided. In some embodiments, an oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound is provided, the first oligomeric compound having a sequence selected from any one of SEQ ID NO: 1541 to 2364 and 3090 to 3095, and the second oligomeric compound having a sequence selected from any one of SEQ ID NO: 2365 to 3075 and 3084 to 3089. In some embodiments, an oligomeric duplex composed of a first oligomeric compound and a second oligomeric compound is provided, the first oligomeric compound having a sequence selected from any one of SEQ ID NO: 1541 to 2364 and 3090 to 3095, and the second oligomeric compound having a sequence selected from any one of SEQ ID NO: 2365 to 3075 and 3084 to 3089.

[0011] Additionally, methods are provided for reducing or inhibiting LPA expression, LPA RNA levels, and / or Apo(a) protein levels and / or Lp(a) activity in cells, tissues, organs, or subjects. In some embodiments, the methods include contacting cells or subjects with a composition provided herein, the composition comprising, for example, an oligomeric duplex, an oligomeric compound, or a modified oligonucleotide as described herein. In some embodiments, the subject is a person who has or is at risk of having a cardiovascular, metabolic, or inflammatory disease, disorder, condition, or injury associated with increased lipoprotein a levels, lipoprotein turnover disorders, or mutations in LPA. In some embodiments, the subject is a person who has or is at risk of having hypertriglyceridemia. In some embodiments, the subject is a person who has or is at risk of having atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

[0012] This article provides methods for treating diseases, disorders, conditions, or lesions associated with lipoprotein metabolism disorders, regulation of lipoprotein turnover, or mutations in the LPA. In some embodiments, methods for treating diseases, disorders, conditions, or lesions associated with lipoprotein metabolism disorders, regulation of Lp(a) levels, or mutations in the LPA include administering the provided oligomeric duplex, oligomeric compound, or composition provided herein to a subject (e.g., a human subject) who has or is at risk of developing a disease, disorder, or condition associated with elevated Lp(a), wherein the disease, disorder, condition, or lesion is selected from cardiovascular diseases, disorders, conditions, metabolic diseases, or inflammatory diseases, disorders, or lesions. In some embodiments, the subject has or is at risk of developing cardiovascular disease (CVD), coronary artery disease (CAD), hypercholesterolemia, myocardial infarction (MI), peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, or stroke. In some embodiments, the treatment methods provided herein cause a reduction (whether by reduced frequency or severity) of at least one symptom of a disease, disorder, condition, or injury associated with lipoprotein metabolism disorders. In some embodiments, the treatment methods provided herein cause prevention, delay, postponement, or mitigation of the development or progression of at least one symptom of a disease, disorder, or condition associated with elevated Lp(a).

[0013] This document also provides methods for alleviating at least one symptom of a disorder associated with lipoprotein metabolism disorders. In some embodiments, the disorder is severe hypertriglyceridemia, hyperlipidemia, dyslipidemia, and / or hyperlipoproteinemia. In some embodiments, symptoms of hypertriglyceridemia, hyperlipidemia, dyslipidemia, and / or hyperlipoproteinemia in a subject include, but are not limited to, abdominal pain, physical fatigue, mental difficulty, diarrhea, acute pancreatitis, exanthematous xanthoma, lipemic retinopathy, or hepatosplenomegaly, or a combination of two or more of the foregoing. In some embodiments, the methods provided herein for preventing, treating, alleviating, delaying the onset of, or reducing the frequency of at least one symptom of hypertriglyceridemia, hyperlipidemia, dyslipidemia, and / or hyperlipoproteinemia comprise administering to a subject (e.g., a human subject) who has or is at risk of developing at least one symptom the composition provided herein, such as the modified oligonucleotide, oligoduplex, oligomeric compound, or pharmaceutical composition provided herein. Detailed Implementation

[0014] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only, and not restrictive. In this document, unless otherwise specified, the use of the singular includes the plural. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not restrictive. Additionally, unless otherwise specified, terms such as "element" or "component" cover both elements and components that comprise one unit and elements and components that comprise more than one subunit.

[0015] definition The following definitions, along with additional definitions throughout this specification, are provided to provide a complete understanding of the invention. Unless specifically defined herein, the nomenclature used in conjunction with the analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein, as well as the procedures and techniques therein, are those well-known and commonly used in the art. Unless otherwise stated, certain terms have the following meanings: As used herein, a substituent at the “2’ position” means that the substituent is directly attached to the carbon at the 2’ position of the furanyl sugar moiety.

[0016] As used herein, “2’-deoxynucleoside” means a nucleoside containing a 2’-deoxyfuranosyl sugar moiety. Unless otherwise stated, a 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside containing a 2’-β-D-deoxyribosyl sugar moiety in the β-D conformation of naturally occurring deoxyribonucleic acid (DNA). A 2’-deoxynucleoside or nucleoside containing an unmodified 2’-deoxyribosyl sugar moiety may be debased, contain modified nucleosides, or may contain RNA nucleosides (uracil).

[0017] As used herein, “2’-deoxyglycan moiety” means 2’-H(H)deoxyfuranosyl glycan moiety. Unless otherwise stated, 2’-deoxyglycan moiety is 2’-β-D-deoxyribosyl glycan moiety having the β-D stereochemical configuration found in naturally occurring deoxyribonucleic acid (DNA).

[0018] As used herein, “2’-MOE” refers to the 2’-OCH2CH2OCH3 group at the 2’-position of the furanyl sugar moiety. “2’-MOE sugar moiety” refers to a sugar moiety having the 2’-OCH2CH2OCH3 group at the 2’-position of the furanyl sugar moiety. Unless otherwise stated, the 2’-MOE sugar moiety has a β-D-ribosyl stereochemistry. “MOE” refers to O-methoxyethyl.

[0019] As used in this article, "2'-MOE nucleoside" or "2'-OCH2CH2OCH3 nucleoside" refers to a nucleoside containing a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 furanose sugar moiety).

[0020] As used herein, “2'-OMe” refers to a 2'-O-methyl or 2'-OCH3 group at the 2'-position of the furanyl sugar moiety. “2'-OMe sugar moiety” refers to a sugar moiety having a 2'-O-methyl or 2'-OCH3 group at the 2'-position of the furanyl sugar moiety. Unless otherwise stated, the 2'-OMe sugar moiety has a β-D-ribosyl stereochemistry.

[0021] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.

[0022] As used herein, “2’-F” refers to a 2’-fluorine group at the 2’-position of the furanyl sugar moiety. “2’-F sugar moiety” refers to a sugar moiety having a 2’-F group at the 2’-position of the furanyl sugar moiety. Unless otherwise stated, the 2’-F sugar moiety is β-D-ribosyl configuration.

[0023] As used in this article, "2'-F nucleoside" refers to a nucleoside containing the 2'-F sugar moiety.

[0024] As used in this article, “2'-NMA” refers to the 2'-OCH2C(=O)-N(H)CH3 group at the 2' position of the furanyl sugar moiety. “2'-NMA sugar moiety” refers to the sugar moiety having the 2'-OCH2C(=O)-N(H)CH3 group at the 2' position of the furanyl sugar moiety.

[0025] As used in this article, "2'-NMA nucleoside" refers to a nucleoside containing the 2'-NMA sugar moiety.

[0026] As used herein, “2’-substituted nucleoside” means a modified nucleoside that contains a 2’-substituted furanyl sugar moiety. 2’-substituted nucleoside includes, but is not limited to, 2’-OMe nucleoside, 2’-MOE nucleoside, 2’-F nucleoside, 2’-NMA nucleoside, cEt nucleoside and LNA nucleoside.

[0027] As used herein, “2’-substitution” or “2’-substituted sugar moiety” means a modified furanyl sugar moiety in which the 2’-position is attached to at least one substituent other than H or OH. 2’-substituted sugar moieties include bicyclic sugar moieties in which a second ring is bonded to a furanyl ring at the 2’-position. 2’-substituted sugar moieties include, but are not limited to, 2’-OMe sugar moieties, 2’-MOE sugar moieties, 2’-F sugar moieties, 2’-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties.

[0028] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached at the 5-position. 5-methylcytosine is a modified nucleobase.

[0029] As used in this article, "debased nucleoside" refers to a modified nucleoside in which the sugar portion is not attached to a nucleobase.

[0030] As used in this article, "acyclic sugar substitute nucleoside" refers to a nucleoside having formula II, III, or IV: Formula II Formula III Formula IV in X is O, S, C(R5R6), N(E1), NC(=O)-(E1); Each J1 and J2 is independently H or C1-C6 alkyl; n is 0, 1, or 2; m is 0, 1, or 2; p is 0 or 1; o is 0 or 1; s is 0 or 1; R1 can be H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, or (CH2). q R8; R2, R3, and R4 are each independently H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2). q R8; E1 is H, C1-C6 alkyl, or substituted C1-C6 alkyl; R5 and R6 are independently H, OH, C1-C6 alkyl or N(R7); wherein if R5 is OH, then R6 is not OH; R7 is H, C1-C6 alkyl or C(=O)R9, wherein R9 is C1-C6 alkyl; R8 is OH, halogen, methoxy, ethoxy, azide, C2-C6 alkenyl, or C2-C6 alkynyl, and q is 1, 2, or 3; and Bx is a nucleobase.

[0031] As used in this article, "acyclic sugar substitute" refers to the sugar portion of the nucleoside in the acyclic sugar substitute.

[0032] As used herein, “improvement” in relation to the symptoms of a disease means an improvement, reduction, or elimination of at least one symptom of the disease. Improvement may be a reduction in the severity or frequency of symptoms, a delay in the onset of symptoms, prevention of symptom occurrence, or a slowing of the progression of symptoms in terms of severity or frequency. Indicators of progression, frequency, or severity may be determined by subjective or objective indicators known in the art and / or described herein.

[0033] As used herein, “antisense activity” means any detectable and / or measurable change attributable to (whether directly and / or indirectly) the hybridization of an antisense oligonucleotide with a target nucleic acid. For example, when a compound in in vivo These compounds exhibit antisense activity when the amount or activity of the target nucleic acid is altered by 25% or more during the assay; or, for example, when the compound is in in vivo These compounds exhibit antisense activity when the amount or activity of the target nucleic acid is altered by 25% or more in an assay. Antisense activity can be assessed in a standard assay. In this paper, antisense activity is defined as a reduction or inhibition of the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid, compared to the target nucleic acid or protein level in the absence of oligonucleotides.

[0034] As used in this article, "antisense agent" refers to an oligomer that contains antisense oligonucleotides.

[0035] As used in this article, "antisense oligonucleotide" refers to a nucleotide that has a similarity to the target nucleic acid (…). For example An oligonucleotide is an oligonucleotide that is complementary to at least one region (“target region”) of the target region. The antisense oligonucleotide may pair with a second oligonucleotide (“sense oligonucleotide”) that is complementary to the antisense oligonucleotide (e.g., to form an “oligomeric duplex”), which may be an unpaired antisense oligonucleotide (single-stranded antisense oligonucleotide) or a “hairpin oligonucleotide” having at least one self-complementary region.

[0036] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising a furanyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-homogeneous atoms in the ring of the furanyl sugar moiety, thereby forming a bicyclic structure. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and restricted ethyl (cEt) sugar moieties as defined herein.

[0037] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0038] As used herein, "cell-targeting moiety" means a conjugate group or part of a conjugate group that has an affinity for one or more specific cell types. For example, a cell-targeting moiety may have an affinity for cell surface portions, such as cell surface receptors on a specific cell type.

[0039] As used herein, "cleavable moiety" means a group of atoms containing at least one bond that is cleaved under physiological conditions, such as in a cell or in a subject. For example, a cleavable moiety is cleaved within a cell or subcellular compartment, such as an endosome or lysosome. A cleavable moiety can be cleaved by endogenous enzymes, such as nucleases. A cleavable moiety can be cleaved by endogenous changes in conditions such as pH.

[0040] As used herein, the term "complementary nucleobase" or "complementary" in relation to nucleosides means nucleosides that form hydrogen bonds with each other when two linked nucleoside regions (e.g., an oligonucleotide and a target nucleic acid; two oligonucleotides). Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (… mC) and guanine (G). Certain modified nucleobases complementary to unmodified nucleobases or other modified nucleobases are known in the art. For example, the nucleobase hypoxanthine of the nucleoside inosine (I) can pair with adenine, cytosine, thymine, or uracil. In this document, hypoxanthine (I) is considered to be a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C).

[0041] As used herein, the term "complementary sequence" or "complementary" refers to two nucleobase sequences in which some, most, or all of the nucleobases in the two sequences are complementary nucleobases when the sequences are aligned. "Nucleobase sequence" means the sequence of consecutive nucleobases in a linked nucleoside chain or its region (e.g., an oligonucleotide or its region, or a target nucleic acid or its region), regardless of any sugar or nucleoside bond modifications. A complementary nucleobase sequence can be the nucleobase sequence of two separate chains of a linked nucleoside or its region (e.g., a region of an oligonucleotide and a region of a target nucleic acid); or a complementary nucleobase sequence can be two regions of separate chains of a linked nucleoside (e.g., the self-complementary region of a hairpin oligonucleotide). As used herein, when a first nucleobase sequence (e.g., an oligonucleotide) or its region is described as complementary to a second nucleobase sequence (e.g., a target nucleic acid or another oligonucleotide), it means that most of the nucleobases of the first nucleobase sequence or its region pair with the complementary nucleobases of the second nucleobase sequence upon alignment. Not every pair of nucleosides in an aligned sequence needs to match for the two sequences to be “complementary.” Instead, some mismatches are tolerable. Where complementarity is expressed as a percentage, this percentage indicates the percentage of nucleosides in one sequence that are complementary to those in an equal-length second sequence when the sequences are aligned. Unless otherwise specified, “complementarity” is assumed to be at least 70%. Complementary nucleobase sequences can be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if the nucleobase sequence of a 20-nucleotide oligonucleotide is 80% complementary to another nucleobase sequence, then when the sequences are aligned, there are 16 complementary nucleobase pairs and 4 mismatches. If the nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then during sequence alignment, there will be 16, 17, 18, 19, or 20 complementary nucleobase pairs and 0 to 4 mismatches. As used herein, “completely complementary” or “100% complementary” means that every nucleobase pair of the two nucleobase sequences is complementary when aligning equal-length sequences.

[0042] As used herein, "conjugate group" means a group that includes the conjugate portion and the conjugate linker that attaches the conjugate portion to the oligonucleotide.

[0043] As used herein, “conjugate linker” means a single bond or a group of atoms containing at least one bond that links the conjugate portion to the oligonucleotide.

[0044] As used herein, “conjugated moiety” means a group of atoms that, when covalently bound to a molecule (e.g., an oligonucleotide), modifies one or more properties of such a molecule compared to an identical molecule lacking a conjugated moiety, wherein such properties include, but are not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0045] As used herein, “restricted ethyl” or “cEt” or “cEt sugar moiety” refers to the β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is... S Configuration.

[0046] As used in this article, "cEt nucleoside" refers to a nucleoside that contains the cEt sugar moiety.

[0047] As used in this article, “cyclic sugar substitute nucleosides” are nucleosides having Formula I: Formula I in J is H, C1-C6 alkyl, or C2-C6 alkenyl; X is O, S, C(R1R2), N(R3); or X is X1-X2, where X1-X2 is C(R1)=C(R2), C(R1R2)-C(R1R2), OC(R1R2), C(R1R2)-O, SC(R1R2), C(R1R2)-S, N(R3)-C(R1R2) or C(R1R2)-N(R3); Y is C(R1R2); or Y 1- Y2, where Y 1- Y2 is C(R1) = C(R2) or C(R1R2) - C(R1R2); Z is C(G1G2); or Z1-Z2, where Z1-Z2 is C(G1)=C(R1), C(R1)=C(G1); C(G1G2)-C(R1R2), C(R1R2)-C(G1G2); or Z1-Z2-Z3, where Z1-Z2-Z3 is C(G1G2)-C(R1R2)-C(R1R2) or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; Each R1 and R2 is independently H, OH, C1-C6 alkyl, or N (R4); wherein if R1 is OH, then R2 is not OH; Each R3 and R4 is independently H, C1-C6 alkyl or C(=O)R5, wherein R5 is C1-C6 alkyl; Each G1 and G2 is independently H, OH, halogen, or O-[C(R6)(R7)] q -[(C=O) s -X G ] j -R8; where if G1 is OH, then G2 is not OH; Each R6 and R7 is independently H, halogen, C1-C6 alkyl, or substituted C1-C6 alkyl; Each X G It is O, S, or N (E1); R8 is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl or N(E2)(E3). E1, E2 and E3 are each independently H, C1-C6 alkyl or substituted C1-C6 alkyl; n is 0 or 1; m is 0 or 1; p is 0 or 1; q is 1 to 6; s is 0 or 1; j is 0 or 1; Bx is a nucleobase; and The condition is that if X is O, Z is C(G1G2), and Q is CH, then m is 1.

[0048] As used herein, “cyclic sugar substitute” means a cyclic sugar that replaces the sugar portion of a nucleoside, and is represented by formula Ia in this document.

[0049] As used herein, "double strand" refers to the complementary regions of a hybrid or bonded structure, including the complementary regions between the two separate strands of the linked nucleosides (e.g., an antisense oligonucleotide and a sense oligonucleotide) and the complementary regions within the separate strands of the linked nucleosides (e.g., a hairpin oligonucleotide). The paired complementary regions of the two separate linked nucleoside strands form a double strand of separate strands. The paired complementary regions of the separate strands of the linked nucleosides (i.e., the first region of the linked nucleoside strand and the second region of the linked nucleoside strand) form a "hairpin".

[0050] As used herein, a “furanosyl sugar moiety” is a group of atoms comprising a furanose ring and optional substituents, and having optional additional substituents at any of the 1', 2', 3', 4' and 5' positions according to the following structural designations.

[0051] .

[0052] As used in this article, "hybridization" refers to the linking of nucleosides ( For example Hybridization is the process by which two complementary regions of an oligonucleotide (or nucleic acid) anneal to form a double-stranded region. While not limited to a specific mechanism, the most common hybridization mechanism involves hydrogen bonds between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds.

[0053] As used herein, “nucleoside bond” means a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, “unmodified nucleoside bond” means a phosphodiester nucleoside bond. As used herein, “modified nucleoside bond” means any nucleoside bond other than a phosphodiester nucleoside bond. “Thiophosphate nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms of the phosphodiester nucleoside bond is replaced by a sulfur atom. “Methanesulfonylaminophosphate nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms of the phosphodiester nucleoside bond is replaced by NS(=O)2CH3. Unless otherwise stated, and in the context of each linked nucleoside containing a furanyl sugar moiety, the nucleoside bond links the 3'-carbon of one furanyl sugar moiety to the 5'-carbon of another furanyl sugar moiety.

[0054] As used in this article, “inverted nucleoside” means a nucleoside having 3' to 3' and / or 5' to 5' nucleosides interposed with the remainder of the oligonucleotide.

[0055] As used in this article, “linked nucleosides” refers to nucleosides linked by a continuous sequence. Right now (The nucleosides are adjacent to each other, and there are no additional nucleosides between the connected nucleosides).

[0056] As used herein, a “mismatch” between two aligned linked nucleoside chains means that the two nucleosides at a specified position in the aligned nucleobase sequence are not complementary nucleosides as defined herein.

[0057] As used herein, “modified nucleoside” means a compound or subunit comprising a sugar moiety and optionally a nucleobase, wherein the sugar moiety is modified and / or the nucleobase is modified or absent.

[0058] As used herein, "modified sugar moieties" refers to the sugar moieties in RNA other than the β-D-ribosyl sugar moieties or in DNA other than the β-D-deoxyribosyl sugar moieties. Modified sugar moieties are selected from modified furanosyl sugar moieties, cyclic sugar substitutes, acyclic sugar substitutes, or sugar mimics.

[0059] As used herein, "modified nucleobase" means a nucleobase other than the unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. Inosine (I) is a nucleoside containing the modified nucleobase hypoxanthine.

[0060] As used herein, “motif” refers to the pattern of independently unmodified and / or independently modified sugar moieties, nucleobases and / or nucleoside bonds in an oligonucleotide.

[0061] As used herein, “non-bicyclic modified sugar moiety” means a modified furanyl sugar moiety containing modifications (such as substituents) that do not form a bridge between the two atoms of the sugar to form a second ring. As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase.

[0062] As used herein, “nucleobase sequence of reference SEQ ID NO” means only the sequence of consecutive nucleobases provided in such SEQ ID NO, independent of any sugar or nucleoside inter-bond modification, and therefore, unless otherwise stated, includes compounds in which each sugar moiety and each nucleoside inter-bond is independently modified or unmodified, regardless of the presence or absence of the modification indicated in the reference SEQ ID NO.

[0063] As used in this article, "nucleoside" means "unmodified nucleoside" or "modified nucleoside".

[0064] As used herein, “oligomer” means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional related features selected from or consisting of: (a) one or more conjugation groups that may be directly or indirectly covalently attached to any oligonucleotide of such oligomer; (b) one or more terminal groups; and (c) one or more additional modified or unmodified oligonucleotides, each of which may hybridize or covalently link with at least one modified oligonucleotide and / or hybridize or covalently link with each other. In this document, in the case of describing two oligonucleotides covalently attached to each other, such attachment is not through a direct nucleotide-to-nucleotide bond. Therefore, a single unbranched oligonucleotide comprising only a direct nucleotide-to-nucleotide bond cannot be described as two separate covalently linked oligonucleotides.

[0065] As used herein, “oligomeric compound” means a compound comprising a modified oligonucleotide and optionally one or more covalently linked chemical features selected from one or more conjugate groups and one or more terminal groups.

[0066] As used herein, “oligonucleotide” means a chain of linked nucleosides, wherein each nucleoside and / or each internucleotide bond in the linked chain may be independently modified or unmodified. Unless otherwise stated, an oligonucleotide consists of 12 to 50 linked nucleosides. Unless otherwise stated, no more than 10% of the nucleosides in an oligonucleotide are debased nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside and / or internucleotide bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleotide bonds. An oligonucleotide may pair with a second oligonucleotide complementary to it to form an oligomeric duplex, or it may be unpaired.

[0067] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise a pharmaceutical agent (e.g., an oligomer, a duplex, or an antisense agent) and a sterile aqueous solution. Pharmaceutical compositions may exhibit activity in certain cell lines.

[0068] As used herein, "pharmaceutically acceptable carrier or diluent" means an ingredient in a pharmaceutical composition suitable for administration to a subject. Typically, a "carrier" or "diluent" lacks pharmacological activity but is desirable in the preparation of a pharmaceutical composition.

[0069] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. Pharmacologically acceptable salts retain the desired biological activity of the parent compound without conferring undesirable toxicological effects.

[0070] As used herein, “RNA nucleoside” refers to a nucleoside that contains the unmodified sugar portion of RNA. RNA nucleosides may contain modified or unmodified nucleobases. RNA nucleosides may contain thymine nucleobases or modified nucleobases, or they may be debased nucleosides.

[0071] As used in this article, "RNA sugar moiety" refers to the unmodified RNA sugar moiety. As used herein, “RNase H agent” means an antisense agent that acts at least partially via RNase H to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNase H agents may be single-stranded or double-stranded. RNase H compounds may contain conjugation groups and / or terminal groups. RNase H agents regulate the amount and / or activity of the target nucleic acid. The term RNase H agent does not include antisense agents that act primarily via RISC / Ago2. “RNAi agent” means an antisense agent that acts at least partially via RISC or Ago2 to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNA).i RNAi agents include milro RNA, including milro RNA mimics. RNAi agents may contain conjugation groups and / or terminal groups. In some embodiments, RNAi agents regulate the amount and / or activity of the target nucleic acid. The term RNAi agent does not include antisense agents that act via RNase H.

[0072] As used in this article, regarding nucleic acids ( For example The term "single-stranded" in oligonucleotides means that the strand or region is unpaired; that is, the chain of the linked nucleosides is not part of the double-stranded structure, nor is it part of the double-stranded region. For example Single-stranded oligonucleotides can hybridize with complementary nucleic acids to form double strands, at which point they are no longer single-stranded.

[0073] As used in this article, "stable phosphate moiety" means a 5'-phosphate analog that is metabolically more stable than 5'-phosphate when naturally present on DNA or RNA.

[0074] As used herein, in the context of a group of molecules with the same molecular formula, "stereo-random" or "stereo-random chiral center" refers to a chiral center that is uncontrolled during synthesis or enriched after synthesis for a specific absolute stereochemical configuration. The absolute stereochemical configuration of a chiral center can be determined by using stereochemically pure starting materials ( For example The stereochemical configuration of the chiral center is controlled by the synthesis of oligonucleotides using β-D-ribosylnucleoside monomers. Conversely, when the stereochemical configuration of the chiral center is the result of a synthetic method that does not aim to control the stereochemical configuration, the stereochemical configuration is random. For example, in the group of molecules containing stereoironic chiral centers, those with stereoironic chiral centers ( S The number of molecules with a stereoironic chiral center (“racemic”) configuration can be related to the number of molecules with a stereoironic chiral center (“racemic”). R The number of molecules with the same configuration is the same. The stereoironic chiral center may not be racemic because one absolute configuration predominates after synthesis. For example Due to the effect of achiral reagents enriching in the stereochemical vicinity of adjacent sugar moieties, stereoironic chiral centers can be located at the phosphorus atom of the internucleotide bond in stereoironic thiophosphates or stereoironic methanesulfonyl phosphates.

[0075] As used herein, "chain" or "linked nucleoside chain" refers to a continuous chain of linked nucleosides connected by internucleotide bonds. Linked nucleoside chains have a nucleobase sequence.

[0076] As used in this article, "subject" refers to a human or a non-human animal.

[0077] As used in this article, "sugar fraction" refers to either unmodified or modified sugar fraction.

[0078] As used herein, “glycomimetic” means a group of atoms that forms a nucleoside moiety corresponding to the β-D-ribosyl sugar in RNA, excluding modified furanose moieties, cyclic sugar substitutes, or acyclic sugar substitutes.

[0079] As used in this article, "sugar substitute nucleoside" refers to cyclic sugar substitute nucleoside or acyclic sugar substitute nucleoside.

[0080] As used herein, “symptoms” of a disease means any manifestation, indication, sign, or evidence of the disease. Symptoms include both subjective and objective markers of the disease and can be perceived, experienced, detected, observed, measured, and / or quantified. Symptoms may be apparent during diagnostic testing and, in some cases, only during invasive diagnostic testing, including but not limited to post-mortem testing. Symptoms can be the absence of a characteristic, such as failure to reach an expected developmental milestone. Symptoms may include, but are not limited to, angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle cramps, abdominal distension, and fever.

[0081] As used herein, “target nucleic acid” means an LPA nucleic acid that is designed to be affected by an antisense oligonucleotide. As used herein, “target RNA” means an LPA RNA transcript and, unless otherwise stated, includes precursor mRNA and / or mRNA.

[0082] As used in this article, "target region" refers to a portion of the target nucleic acid that is complementary to the target region of the antisense oligonucleotide.

[0083] As used in this article, "terminal group" refers to a chemical group or atomic group covalently attached to the end of an oligonucleotide.

[0084] As used herein, “therapeutic index” means the ratio of a measure of toxicity or intolerance to a measure of potency or activity. Typically, the therapeutic index is expressed as the ratio between the concentration (or dose) at which a compound becomes toxic or induces an unacceptable adverse reaction in a subject (or the highest concentration or dose at which the compound is non-toxic, or the highest concentration or dose at which it is tolerated before becoming toxic or inducing an unacceptable adverse reaction) and the concentration (or dose) at which the compound is pharmacologically effective or produces the desired effect.

[0085] As used herein, “treating / treatment” in relation to a disease refers to the administration of a compound or agent to a subject who has or is at risk of developing such a disease. Treatment of a disease may result in improvement of at least one symptom of such a disease. Treatment may reduce, improve, and / or prevent one or more symptoms, so that the symptoms of the disease are lessened or no longer noticeable.

[0086] As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G).

[0087] As used in this article, "unmodified nucleoside" means a compound or subunit that contains an unmodified sugar moiety and an unmodified nucleobase.

[0088] As used herein, "unmodified sugar moiety" refers to the 2'-OH(H)β-D-ribosyl sugar moiety found in RNA or the 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA. An unmodified sugar moiety is a furanyl or deoxyfuranyl sugar moiety in the β-D stereochemistry configuration, possessing one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, two hydrogen atoms at the 5' position, and two hydrogen atoms (DNA) or one hydrogen atom and one OH atom (RNA) at the 2' position.

[0089] Example 1. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound, wherein: The first oligomer compound comprises a first modified oligonucleotide consisting of 18 to 50 linked nucleosides, wherein the nucleobase sequence comprises at least 80% identical nucleobase sequences of at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleosides to any of SEQ ID NO: 6 to 829 and 3078 to 3083, wherein at least 22%, no more than 20%, no more than 18%, no more than 15%, no more than 10%, or no more than 5% of the modified nucleosides in the first modified oligonucleotide comprises a 2'-F sugar moiety and / or an FHNA sugar substitute, and The second oligomer compound comprises a second modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence comprises at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleosides that are at least 80% identical to the nucleobase sequence of any one of SEQ ID NO: 830 to 1540 and 3096 to 3101, wherein at least one, but not more than 25%, not more than 20%, not more than 18%, not more than 16%, not more than 14%, not more than 12%, or not more than 10% of the modified nucleosides in the second modified oligonucleotide comprises a 2'-F sugar moiety and / or an FHNA sugar substitute; The first modified oligonucleotide and the second modified oligonucleotide are complementary to each other; and Each of the first modified oligonucleotide and the nucleoside of the second modified oligonucleotide independently comprises a modified sugar moiety or a sugar substitute.

[0090] 2. The oligomeric duplex according to Example 1, 1) wherein the first modified oligonucleotide comprises at least one and no more than four modified nucleosides, the modified nucleosides comprising a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute, and / or wherein the second modified oligonucleotide comprises at least one and no more than four modified nucleosides, the modified nucleosides comprising a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute; and / or wherein the oligodistrand comprises at least one and no more than eight modified nucleosides, the modified nucleosides comprising a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute; and / or 2) wherein at least 18 nucleotides of the first modified oligonucleotide and at least 16 nucleotides of the second modified oligonucleotide each independently comprise a modified sugar moiety or sugar substitute selected from the 2'-F sugar moiety, the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, the DNA sugar moiety, and the FHNA sugar substitute; and / or 3) wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of SEQ ID NO: 6 to 829 and 3078 to 3083, and wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of any of SEQ ID NO: 830 to 1540 and 3096 to 3101.

[0091] 3. The oligoduplex according to Example 1 or Example 2, wherein the first modified oligonucleotide comprising a modified sugar moiety or sugar substitute containing a 2'-F sugar moiety or an FHNA sugar substitute is independently selected from one of the following: i. The second nucleotide, counted from the 5' end. ii. The second and fourteenth nucleotides counted from the 5' end, or iii. The second and sixteenth nucleotides counted from the 5' end, or iv. The second, fourteenth, and sixteenth nucleotides counted from the 5' end, or v. The second, sixth, fourteenth, and sixteenth nucleotides, counted from the 5' end.

[0092] 4. The oligoduplex according to any one of Examples 1 to 3, wherein the second modified oligonucleotide comprising a modified sugar moiety or sugar substitute containing a 2'-F sugar moiety and / or an FHNA sugar substitute is independently selected from one of the following: i. The ninth and tenth nucleotides counted from the 5' end, or ii. The tenth and eleventh nucleotides counted from the 5' end, or iii. The ninth, tenth, and eleventh nucleotides counted from the 5' end, or iv. The seventh, ninth, tenth, and eleventh nucleotides counted from the 5' end, or v. The seventh, ninth, and eleventh nucleotides counted from the 5' end.

[0093] 5. The oligoduplex according to any one of Examples 1 to 4, wherein one of the modified nucleosides of the first modified oligonucleotide containing a 2'-F sugar moiety and / or an FHNA sugar substitute comprises a 3'-fluoro-hexitol sugar moiety sugar substitute.

[0094] 6. The oligoduplex according to any one of Examples 1 to 4, wherein one or more nucleosides of the first modified oligonucleotide are 2'-deoxynucleosides.

[0095] 7. The oligoduplex according to Example 6, wherein one or more 2'-deoxynucleosides are one or more nucleosides of the sequence of the first modified oligonucleotide, between the fifth to the sixteenth nucleosides counted from the 5' end of the first modified oligonucleotide, and including the region of the fifth to the sixteenth nucleosides.

[0096] 8. The oligoduplex according to Example 7, wherein the one or more 2'-deoxynucleosides are any of the sixth, fourteenth and / or sixteenth nucleosides counted from the 5' end of the first modified oligonucleotide.

[0097] 9. The oligoduplex according to any one of Examples 1 to 8, wherein both of the 3' terminal nucleosides of the first modified oligonucleotide comprise two nucleoside dangling.

[0098] 10. The oligomeric double strand according to Example 9, wherein the pendant nucleoside comprises two modified adenosine (AA), two modified uridine (UU) nucleosides, two modified inosine (II) nucleosides, or two modified nucleosides, one of which is inosine and the other is adenosine (AI or IA).

[0099] 11. The oligoduplex according to any one of Examples 1 to 10, wherein one or more nucleosides of the first modified oligonucleotide contain a 2'-OMe sugar moiety, and wherein one or more nucleosides of the second modified oligonucleotide contain a 2'-OMe sugar moiety.

[0100] 12. The oligomeric duplex according to Example 11, wherein at least thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen nucleotides of the first modified oligonucleotide comprise a 2'-OMe sugar moiety; and The first modified oligonucleotide contains at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen nucleotides containing a 2'-OMe sugar moiety.

[0101] 13. The oligoduplex according to any one of Examples 1 to 12, wherein one or more of the nucleosides of the first modified oligonucleotide comprise a 2'-MOE sugar moiety; and Optionally, one or more of the nucleosides in the second modified oligonucleotide contain a 2'-MOE sugar moiety.

[0102] 14. The oligoduplex according to Example 13, wherein the 5'- and / or 3'-terminal nucleoside of the first modified oligonucleotide comprises a 2'-MOE sugar moiety; and optionally, the 5'- and / or 3'-terminal nucleoside of the second modified oligonucleotide comprises a 2'-MOE sugar moiety.

[0103] 15. The oligoduplex according to Example 14, wherein two of the 5'-terminal nucleotides and / or two of the 3'-terminal nucleotides of the first modified oligonucleotide contain a 2'-MOE sugar moiety; and optionally, two of the 5'-terminal nucleotides and / or two of the 3'-terminal nucleotides of the second modified oligonucleotide contain a 2'-MOE sugar moiety.

[0104] 16. The oligoduplex according to Example 13, wherein at least one nucleotide of the first modified oligonucleotide containing the 2'-MOE sugar moiety is an internal nucleotide of any of the ninth and / or tenth nucleotides counted from the 5' end of the first modified oligonucleotide in a region of the sequence of the first modified oligonucleotide.

[0105] 17. The oligoduplex according to any one of Examples 1 to 16, wherein the first modified oligonucleotide comprises a stable phosphate group attached to the 5'-terminal nucleoside.

[0106] 18. The oligomeric duplex according to Example 17, wherein the stabilized phosphate group comprises methylene phosphonate, cyclopropyl phosphonate or vinyl phosphonate.

[0107] 19. The oligoduplex according to any one of Examples 1 to 18, wherein the first modified oligonucleotide and / or the second modified oligonucleotide comprises at least one modified nucleoside interstrand.

[0108] 20. The oligomeric duplex according to Example 19, wherein at least one modified nucleoside interchain is a phosphate thioester nucleoside interchain.

[0109] 21. The oligomeric duplex according to Example 20, wherein each nucleoside interchain is independently selected from phosphate diester nucleoside interchains and thiophosphate nucleoside interchains.

[0110] 22. The oligomeric duplex according to Example 21, wherein the internucleotide bonds between the first and second nucleosides, counted from the 5' end of the first modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds, and / or wherein the internucleotide bonds between the first and second nucleosides, counted from the 3' end of the first modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds; and Optionally, the internucleotide bonds between the first and second nucleosides, counted from the 5' end of the second modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds, and / or the internucleotide bonds between the first and second nucleosides, counted from the 3' end of the second modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds.

[0111] 23. The oligoduplex according to Example 1, wherein the first modified oligonucleotide comprises a modified glycosyl motif independently selected from one of efyyyfyyyyyyyyyfyfyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyyee, e[FHNA]yyyfyyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyyyyfyfyyyyyee, wherein each 'e' represents a 2'-MOE sugar motif, and each 'y Each 'f' represents a 2'-OMe sugar moiety, each 'f' represents a 2'-F sugar moiety, each '[FHNA]' represents a 3'-fluoro-hexitol sugar moiety, and each 'd' represents a 2'-deoxy sugar moiety, wherein all of them are identical to the glycomolecular motif except for 0, 1, or 2 modifications; and / or the second modified oligonucleotide comprises a modified glycomolecular motif independently selected from one of yyyyyyfyfffyyyyyyyyy and eeyyyyyyyyffyyyyyyyee, wherein each 'e' represents a 2'-MOE sugar moiety, each 'y' represents a 2'-OMe sugar moiety, and each 'f' represents a 2'-F sugar moiety, wherein all of them are identical to the glycomolecular motif except for 0, 1, or 2 modifications.

[0112] 24. The oligoduplex according to Example 1, wherein the first modified oligonucleotide comprises a modified glycomotif independently selected from one of efyyyfyyyyyyyyyyfyfyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyyydydyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyyfyfyyyyyee, e[FHNA]yyyfyyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyyyyfyfyyyyyee Each 'e' represents a 2'-MOE sugar moiety, each 'y' represents a 2'-OMe sugar moiety, each 'f' represents a 2'-F sugar moiety, each '[FHNA]' represents a 3'-fluoro-hexitol sugar moiety, and each 'd' represents a 2'-deoxy sugar moiety; and / or the second modified oligonucleotide comprises a modified glycomolecular motif independently selected from yyyyyyfyfffyyyyyyyyy and eeyyyyyyyyffyyyyyyyee, wherein each 'e' represents a 2'-MOE sugar moiety, each 'y' represents a 2'-OMe sugar moiety, and each 'f' represents a 2'-F sugar moiety.

[0113] 25. The oligomeric duplex according to Example 24, wherein the first modified oligonucleotide comprises a modified glycosyl motif and pairs with a second modified oligonucleotide comprising a glycosyl motif selected from: efyyyfyyyyyyyyfyfyyyyyyy and yyyyyyfyfffyyyyyyyyyy; yfyyyfyyyyyyyyfyfyyyyyyy and yyyyyyfyfffyyyyyyyy; efyyydyyeyyyydydyyyyee and eeyyyyyyyffyyyy e[F HNA]yyyfyyeyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee; and e[FHNA]yyyfyyyyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee.

[0114] 26. The oligomeric double chain according to any one of Examples 1 to 25, wherein the agent comprises a conjugate group, the conjugate group comprising a conjugate portion and a conjugate linker.

[0115] 27. The oligomeric duplex according to Example 26, wherein the conjugation group comprises a cell-targeting portion.

[0116] 28. The oligomeric duplex according to Example 27, wherein the conjugation group comprises a hepatocyte-targeting portion.

[0117] 29. The oligomeric duplex according to Example 28, wherein the agent comprises a conjugate portion that binds to the desialyl glycoprotein receptor (ASGPR).

[0118] 30. The oligomeric duplex according to Example 29, wherein the conjugate portion is selected from the GalNAc portion.

[0119] 31. The oligomeric duplex according to Example 30, wherein the GalNAc conjugate portion is selected from Table A.

[0120] 32. The oligomeric duplex according to Example 30, wherein the conjugate group is composed of a GalNAc ligand and a conjugate linker.

[0121] 33. The oligomeric duplex according to Example 30, wherein the GalNAc ligand has the following structure: .

[0122] 34. The oligomeric duplex according to Example 15, wherein the conjugation group has the following structure: Or its ions or salts, wherein the conjugate linker is covalently linked to the oligonucleotide.

[0123] 35. The oligomeric duplex according to Example 30, wherein the conjugation group has the following structure: Or its ions or salts, wherein the conjugate linker is covalently linked to the oligonucleotide.

[0124] 36. The oligomeric duplex according to any one of Examples 26 to 35, wherein the conjugate group is directly conjugated to the modified oligonucleotide.

[0125] 37. The oligomeric duplex according to Example 36, wherein the conjugation group is conjugated to the 5' or 3' end of the modified oligonucleotide.

[0126] 38. The oligomeric duplex according to Example 37, wherein the conjugation group is attached to the 5'-terminal nucleoside of the modified oligonucleotide.

[0127] 39. The oligomeric duplex according to Example 37, wherein the conjugation group is attached to the 3'-terminal nucleoside of the modified oligonucleotide.

[0128] 40. The oligomeric duplex according to Example 36, wherein the conjugate linker of the conjugate group is composed of a single bond.

[0129] 41. The oligomeric duplex according to Example 36, wherein the conjugate linker of the conjugate group is cleavable.

[0130] 42. The oligomeric duplex according to Example 36, wherein the conjugate linker comprises 1 to 3 linker-nucleosides.

[0131] 43. The oligomeric duplex according to Example 38, wherein the conjugation group has the following structure: Alternatively, its ions or salts may be attached to the 5'-terminal nucleoside of the modified oligonucleotide.

[0132] 44. The oligomeric duplex according to Example 39, wherein the conjugation group has the following structure: Alternatively, its ions or salts may be attached to the 3'-terminal nucleoside of the modified oligonucleotide.

[0133] 45. An oligomeric duplex comprising: i) a first oligomeric compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence comprises at least 80% identical to at least 16 consecutive nucleosides of any one of SEQ ID NO: 6 to 829 and 3078 to 3083, wherein all nucleosides except 0, 1, or 2 are identical to those in SEQ ID NO: The nucleobase sequences of 6 to 829 or 3078 to 3083 are identical, and each of the first modified oligonucleotides contains a modified sugar moiety selected from the following: efyyyfyyyyyyyyfyfyyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyydydyyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyfyfyyyyyee, e[FHNA]yyyfyyyyyyyfyfyyy yyee and e[FHNA]yyyfyyeyyyyfyfyyyyyee, wherein each 'e' represents the 2'-MOE sugar moiety, each 'y' represents the 2'-OMe sugar moiety, each 'f' represents the 2'-F sugar moiety, each '[FHNA]' represents the 3'-fluoro-hexitol sugar moiety, and each 'd' represents the 2'-deoxy sugar moiety; and ii) a second oligomer compound comprising a second modified oligonucleotide, the second modified oligonucleotide consisting of 14 to 50 linked nucleosides, wherein the nucleobase sequence comprises the sequence of SEQ ID NO: at least 14 consecutive nucleotide sequences of at least 80% identical to each of SEQ ID NO: 830 to 1540 and 3096 to 3101, wherein all except 0, 1 or 2 nucleotides are identical to the nucleotide sequences of SEQ ID NO: 830 to 1540 or 3096 to 3101, and wherein each of the second modified oligonucleotides comprises a modified glycosyl motif selected from yyyyyyfyfffyyyyyyyyyy and eeyyyyyyyyffyyyyyyyyee, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents a 2'-OMe sugar motif, and each 'f' represents a 2'-F sugar motif.

[0134] 46. ​​The oligoduplex according to Example 45, wherein the sequence of the second modified oligonucleotide comprises at least 15 or at least 16 consecutive nucleobases of any one of the sequences of SEQ ID NO: 2365 to 3075 and 3084 to 3089; and optionally, wherein the sequence of the first modified oligonucleotide comprises at least 18, at least 19, or at least 20 consecutive nucleobases of any one of the sequences of SEQ ID NO: 1541 to 2364 and 3090 to 3095.

[0135] 47. The oligoduplex according to Example 46, wherein the sequence of the first modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 1541 to 2364 and 3090 to 3095; and optionally, wherein the sequence of the second modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 2365 to 3075 and 3084 to 3089.

[0136] 48. The oligoduplex according to Example 46, wherein the sequence of the first modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 1541 to 2364 and 3090 to 3095; and optionally, wherein the sequence of the second modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 2365 to 3075 and 3084 to 3089.

[0137] 49. The oligomeric duplex according to Example 46, wherein the agent is a duplex compound consisting of any of the following pairs of antisense and sense compounds: .

[0138] 50. A group of oligomeric duplexes according to any one of Examples 1 to 49, wherein the group is enriched with modified oligonucleotides comprising at least one specific thiophosphate nucleoside bond having a specific stereochemical configuration.

[0139] 51. The group according to embodiment 50, wherein the group is enriched with having (Sp) or (Rp)A modified oligonucleotide with at least one specific thiophosphate nucleoside bond in its configuration.

[0140] 52. A pharmaceutical composition comprising an oligomeric double strand according to any one of Examples 1 to 49 or a group according to any one of Examples 50 to 51, and a pharmaceutically acceptable diluent or carrier.

[0141] 53. The pharmaceutical composition according to Example 52, wherein the pharmaceutically acceptable diluent is water or phosphate-buffered saline.

[0142] 54. The pharmaceutical composition according to Example 52, wherein the pharmaceutical composition is substantially composed of the oligomeric duplex and water or phosphate-buffered saline.

[0143] 55. A method for reducing the amount of LPA RNA or lipoprotein(a) protein in cells, tissues, organs or subjects, the method comprising contacting the cells, tissues, organs or subjects with an oligomeric duplex according to any one of Examples 1 to 49, a group according to any one of Examples 50 to 51, or a pharmaceutical composition according to any one of Examples 52 to 54.

[0144] 56. The method according to Example 55, wherein the cell is a hepatocyte.

[0145] 57. A method comprising administering to a subject an oligomeric double strand according to any one of Examples 1 to 49, a group according to any one of Examples 50 to 51, or a pharmaceutical composition according to any one of Examples 52 to 54; wherein the subject has or is at risk of developing cardiovascular disease (CVD), coronary artery disease (CAD), hypercholesterolemia, myocardial infarction (MI), peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, or stroke.

[0146] 58. A method for preventing or treating a subject’s cardiovascular disease, disorder, condition, metabolic disease, disorder, or condition, and / or inflammatory disease, disorder, or condition, said method comprising administering to a subject who has or is at risk of having a cardiovascular, metabolic, and / or inflammatory disease, disorder, or condition the oligomeric duplex of any one of Examples 1 to 49, the group of any one of Examples 50 to 51, or the pharmaceutical composition of any one of Examples 52 to 54; wherein said disease, disorder, condition, or injury is hypertriglyceridemia, lipemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic calcification, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina pectoris, cerebrovascular atherosclerosis, cerebrovascular disease, or venous thrombosis.

[0147] 59. A method for reducing the amount of LPA RNA and / or lipoprotein(a) protein in the liver of a subject who has or is at risk of developing and having elevated Lp(a)-related diseases, disorders, or conditions, the method comprising administering to a subject who has or is at risk of having a disease, disorder, or condition associated with lipoprotein(a) metabolic disorders an oligomeric duplex according to any one of Examples 1 to 49, a group according to any one of Examples 50 to 51, or a pharmaceutical composition according to any one of Examples 52 to 54; wherein the disease, disorder, condition, or injury is a cardiovascular disease, disorder, condition, metabolic disease, or condition, and / or an inflammatory disease, disorder, or condition.

[0148] 60. The method according to any one of Examples 55 to 59, wherein the amount of LPA RNA and / or lipoprotein(a) protein in the liver and / or plasma of the subject is reduced.

[0149] 61. The method according to any one of Examples 55 to 59, wherein the disease, ailment, or condition is hypertriglyceridemia or atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

[0150] 62. The method according to Example 61, wherein at least one symptom of a disease, ailment or condition associated with elevated lipoprotein(a) is an episode of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, xanthoma rash, and hepatosplenomegaly or a combination thereof.

[0151] 63. The method according to any one of Examples 55 to 59, wherein the method prevents or protects against the progression of atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

[0152] 64. The method according to any one of Examples 55 to 59, wherein the administration of the oligomeric double strand according to any one of Examples 1 to 49, the group according to any one of Examples 50 to 51, or the pharmaceutical composition according to any one of Examples 52 to 54 improves the subject's hypertriglyceridemia, hyperlipidemia, dyslipidemia, hyperlipoproteinemia, abdominal pain, physical fatigue, mental confusion, diarrhea, acute pancreatitis, exanthematous xanthomas, lipemic retinopathy, or hepatosplenomegaly, or a combination of two or more of the foregoing.

[0153] 65. The method according to any one of Examples 55 to 59, wherein the administration of the oligomeric double strand according to any one of Examples 1 to 49, the group according to any one of Examples 50 to 51, or the pharmaceutical composition according to any one of Examples 52 to 54 is parenteral.

[0154] 66. The method according to any one of Examples 55 to 59, wherein the application of the oligomeric double strand according to any one of Examples 1 to 49, the group according to any one of Examples 50 to 51, or the pharmaceutical composition according to any one of Examples 52 to 54 is subcutaneous.

[0155] 67. The method according to any one of Examples 55 to 59, wherein the application of the oligomeric double strand according to any one of Examples 1 to 49, the group according to any one of Examples 50 to 51, or the pharmaceutical composition according to any one of Examples 52 to 54 is co-administered with the second agent.

[0156] 68. The method according to any one of Examples 55 to 59, wherein the application of the oligomeric double strand according to any one of Examples 1 to 29, the group according to any one of Examples 30 to 31, or the pharmaceutical composition according to any one of Examples 32 to 34 is administered simultaneously with the pharmaceutical agent.

[0157] 69. The use of the oligomeric duplex according to any one of Examples 1 to 49, the group according to any one of Examples 50 to 51, or the pharmaceutical composition according to any one of Examples 52 to 54 for the treatment or prevention of diseases, disorders, or conditions associated with lipoprotein metabolism disorders or for delaying the symptoms of diseases, disorders, or conditions associated with elevated lipoprotein(a).

[0158] 70. Use of the oligomeric double strand according to any one of Examples 1 to 49, the group according to any one of Examples 50 to 51, or the pharmaceutical composition according to any one of Examples 52 to 54 in the manufacture of a medicament for the treatment or prevention of cardiovascular diseases, disorders, conditions, metabolic diseases, or conditions, or inflammatory diseases, disorders, or conditions.

[0159] I. Oligonucleotides This document provides oligoduplexes and oligomers comprising modified antisense oligonucleotides (e.g., antisense oligomers) and modified sense oligonucleotides (e.g., sense oligomers), wherein the modified antisense oligonucleotide is complementary to LPA RNA and the modified sense oligonucleotide is complementary to the antisense oligomer. The modified antisense and / or sense oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified nucleotide-to-nucleotide bond. Examples suitable for certain modified nucleosides and modified nucleotide-to-nucleotide bonds in the modified antisense and / or sense oligonucleotides are described herein.

[0160] A. Modified nucleosides The modified nucleoside comprises a modified sugar moiety, a modified nucleobase, or a combination thereof. In some embodiments, a modified nucleoside comprising the following modified sugar moiety and / or the following modified nucleobase may be incorporated into the modified antisense oligonucleotides and / or sense oligonucleotides described herein.

[0161] 1. Modified sugar fraction The modified sugar moiety includes modified furanyl sugar moieties, cyclic sugar substitutes, acyclic sugar substitutes, and sugar analogs. In some embodiments, the modified sugar moiety is a non-bicyclic modified furanyl sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic furanyl sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. The sugar substitute may contain one or more substitutions corresponding to those of other types of modified sugar moieties.

[0162] In some embodiments, the modified sugar moiety is a non-bicyclic modified furanyl sugar moiety containing one or more substituent groups (including, but not limited to, substituents based on ribose numbering at positions 2', 3', 4' and / or 5'). In some embodiments, the modified furanyl sugar moiety is not the unmodified sugar moiety ( Right nowThe ribosyl sugar moiety of the unmodified RNA or unmodified DNA portion. In some embodiments, the modified furanosyl sugar moiety is a xylose, lythose, or arabinose sugar moiety.

[0163] In some embodiments, the non-bicyclic modified sugar moiety is a 2'-substituted sugar moiety and includes a substituent at the 2' position. In some embodiments, one or more non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable substituents for the 2' position of the modified sugar moiety include, but are not limited to: 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”). In some embodiments, the 2'-substituted group is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, C1-C 10 Alkoxy, C1-C 10 Substituted alkoxy groups, C1-C 10 Alkyl, C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylene-O-alkyl, Alkyne, Alkylaryl, Arylalkyl, O-Alkylaryl, O-Arylalkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and R n Independently, it is H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 Alkyl groups, O(CH2)2ON(CH3)2 (“DMAOE”), or 2'-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”). Some of these 2'-substituent groups can be synthesized using methods that... For example Cook was found in the following: wait people US 6,531,584; Cook et al. US 5,859,221; and Cook et al. This was found in US 6,005,087. Some embodiments of these 2'-substituents may be further substituted with one or more substituents, which are independently selected from: halogens, cyano groups, OR... a2 NO2, NH2, NHRa2 、N(R a2 2. C1-C6 alkyl, C1-C6 haloalkyl, C2-C6 alkenyl, C2-C6 ynyl, C3-C 10 cycloalkyl, C6-C 10 Aryl, heteroaryl, heterocyclic, C1-C6 alkylene-NH2, C1-C6 alkylene-NHR a2 C1-C6 alkylene-N(R) a2 2. C(O)R a3 C(O)OR a3 C(O)NHR a3 C(O)N(C1-C4 alkyl)R a3 SR a3 S(O) )2 R a3 S(O)R a3 ,NHC(O)R a3 N(C1-C4 alkyl)C(O)R a3 NHS(O)R a3 N(C1-C4 alkyl)S(O)R a3 NHS(O)2R a3 and N(C1-C4 alkyl)S(O)2R a3 ; Each R a2 Independently selected from C2-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C 10 cycloalkyl, C6-C 10 Aryl, heteroaryl, and heterocyclic; each R a3 Independently, it is hydrogen, OH, C1-C6 alkyl, C1-C6 haloalkyl, C3-C 10 cycloalkyl, C6-C 10 Aryl, heteroaryl, or heterocyclic groups. In some embodiments, the sugar moiety contains two of the above-described substituents at the 2' position. In some embodiments, the sugar moiety contains a 2'-fluorine and a second 2'-substituent.

[0164] In some embodiments, the 2'-substituted sugar moiety comprises a non-bridged 2'-substituted group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n ), where each R mand R n Independently, it is H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 alkyl.

[0165] In some embodiments, the 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”) and OCH2C(=O)-N(H)CH3 (“NMA”).

[0166] In some embodiments, the 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and OCH2C(=O)-N(H)CH3 (“NMA”).

[0167] In some embodiments, the 2'-substituted sugar moiety comprises a 2'-substituent selected from the following: F, OCH3, and OCH2CH2OCH3.

[0168] In some embodiments, the modified furanyl sugar moiety and the nucleotide incorporated into such modified furanyl sugar moiety are further defined by stereochemical configuration. For example, the 2'-deoxyfuranyl sugar moiety ( Right now The 2'-(H)H furanylose moiety can exist in seven isomer configurations in addition to the naturally occurring β-D-deoxyribosyl configuration. These modified sugar moieties are described in... For example This document is incorporated herein by reference in WO 2020 / 072991. The 2'-modified sugar moiety has an additional stereocenter at the 2' position relative to the 2'-deoxyfuranosyl sugar moiety; thus, such sugar moieties have a total of sixteen possible stereochemical configurations. Unless otherwise stated, the modified furanosyl sugar moieties described herein are in the β-D-ribosyl stereochemical configuration.

[0169] In some embodiments, the non-bicyclic modified sugar moiety includes a substituent at the 4' position. Examples of suitable substituent groups at the 4' position of the modified sugar moiety include, but are not limited to, alkoxy groups. For example , methoxy), alkyl and in Manoharan et al. Those described in WO 2015 / 106128 are incorporated herein by reference.

[0170] In some embodiments, the non-bicyclic modified sugar moiety includes a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy groups. For example , methoxy), alkyl ( For example (methyl, ethyl).

[0171] In some embodiments, the non-bicyclic modified sugar moiety includes a substituent at the 5' position. Examples of suitable substituents at the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy ( For example , methoxy), alkynyl, allyl and alkyl ( For example ,methyl( R or S ), ethyl ( R or S )).

[0172] In some embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as a 2'-F-5'-methyl sugar moiety, as in Migawa. et al. As described in US 2010 / 0190837, which is incorporated herein by reference; or as Rajeev... et al. The alternatives to the 2'- and 5'-modified sugar portions described in US 2013 / 0203836 are incorporated herein by reference.

[0173] Some modified sugar moieties are bicyclic sugar moieties and contain substituents that bridge the two atoms of the furanyl ring to form a second ring. In some embodiments, the bicyclic sugar moieties contain a bridge between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (in... S In configurations referred to as "restricted ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") and their analogues, 4'-C(CH3)(CH3)-O-2' and their analogues, 4'-CH2-N(OCH3)-2' and their analogues, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and their analogues, 4'-C(R) a Rb )-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b Independently, it is H, a protecting group, or C1-C. 12 Alkyl groups. Representative U.S. patents teaching the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al. US 7,427,672; Swayze et al. US 7,741,457; Swayze et al. US 8,022,193; Seth et al. US 8,278,283; Prakash et al. US 8,278,425; and Seth et al. , US 8,278,426, each incorporated herein by reference.

[0174] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups, which are independently selected from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、C(R a )=C(R b )-、C(R a )=N-、C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and N(R) a )-; in: x is 0, 1, or 2; n is 1, 2, 3 or 4; Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxide (S(=O)-J1); and Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl groups or protecting groups.

[0175] In some embodiments, the bicyclic sugar moiety comprises a bridge between the 5' and 3' furanose ring atoms. Examples of such 5' to 3' bridging sugar substituents include, but are not limited to, 5'-(CH2)2-3' (bcDNA), 5'-(CH2)3-3' (bc... 4,3 DNA), 5'-C(F)=CH-CH2-3' and 5'-CH2-CHQ-3', where Q is the attachment to the nucleoside internucleotide bond.

[0176] The additional bicyclic sugar moiety is known in the art; see, for example, Wan. et al., J. Medicinal Chemistry 2016, 59, 9645-9667; Wengel et al., US 8,080,644; Ramasamy et al. US6,525,191; Seth et al. US 7,547,684; and Seth et al. , US 7,666,854, each incorporated herein by reference.

[0177] In some embodiments, the bicyclic sugar moiety and the nucleoside incorporated into such a bicyclic sugar moiety are further defined by stereochemical configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been introduced into oligonucleotides exhibiting antisense activity (Frieden Nucleic Acids Res et al. 2003, 21 (6365-6372). Adding locked nucleic acids to siRNA has been shown to improve the stability of siRNA in serum and reduce off-target effects (Elmén, J). et al. Nucleic Acids Res. 2005, 33 (1), 439-447; Mook, OR et al. Mol.Canc.Ther 2007, 6 (3), 833-843; Grunweller, A. Nucleic Acids Res et al. 2003, 31 (12), 3185-3193). In this document, the general description of bicyclic nucleosides includes two stereochemical configurations. Unless otherwise stated, when identifying a particular bicyclic nucleoside (…) in the exemplary embodiments described herein… For example When the LNA or cEt is in the position, they exhibit a β-D stereochemical configuration.

[0178] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents. For example (5'-substituted sugars and 4'-2'-bridged sugars).

[0179] In some embodiments, the modified sugar moiety is a sugar substitute selected from cyclic sugar substitutes and acyclic sugar substitutes.

[0180] Cyclic sugar substitutes are represented by formula Ia: Formula Ia in: J is H, C1-C6 alkyl, or C2-C6 alkenyl; X is O, S, C(R1R2), N(R3), C(R1)=C(R2), C(R1R2)-C(R1R2), OC(R1R2), C(R1R2)-O, SC(R1R2), C(R1R2)-S, N(R3)-C(R1R2) or C(R1R2)-N(R3); Y is C(R1R2), C(R1)=C(R2) or C(R1R2)-C(R1R2); Z is C(G1G2), C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), C(R1R2)-C(G1G2), C(G1G2)-C(R1R2)-C(R1R2) or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; Each R1 and R2 is independently H, OH, C1-C6 alkyl, or N (R4); wherein if R1 is OH, then R2 is not OH; Each R3 and R4 is independently H, C1-C6 alkyl or C(=O)R5, wherein R5 is C1-C6 alkyl; Each G1 and G2 is independently H, OH, halogen, or O-[C(R6)(R7)] q -[(C=O) s -X G ] j -R8; where if G1 is OH, then G2 is not OH; Each R6 and R7 is independently H, halogen, C1-C6 alkyl, or substituted C1-C6 alkyl; Each X G It is O, S, or N (E1); R8 is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl or N(E2)(E3). E1, E2 and E3 are each independently H, C1-C6 alkyl or substituted C1-C6 alkyl; m is 0 or 1; p is 0 or 1; q is 1 to 6; s is 0 or 1; j is 0 or 1; and The condition is that if X is O, Z is C(G1G2), and Q is CH, then m is 1.

[0181] In some embodiments, the oxygen atoms of the sugar moiety are... For example Sulfur, carbon, or nitrogen atom substitution (X is S, C(R1R2), or N(R3)). In some such embodiments, such modified sugar moieties also contain bridging substituents and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2' and / or 5' positions.

[0182] In some embodiments, the sugar substitute comprises a ring having atoms other than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”), where X is OC(R1R2), p is 1, Z is C(G1G2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids (“HNA”), atroitol nucleic acids (G1=OH; G2=H; “ANA”), and fluoroHNA. (G1=F; G2=H; "FHNA", see also) For example Egli, M. J. Am. Chem. Soc. et al. 2011, 133 (41), 16642-16649; Swayze et al. US 8,088,904; and Swayze people, (US 8,440,803); FHNA may also be referred to as F-THP or 3'-fluorotetrahydropyran or 3'-FHNA), each of which is incorporated herein by reference.

[0183] In some embodiments, the sugar substitute comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides comprising a morpholine sugar moiety and their use in oligonucleotides have been reported. As used herein, the term "morpholino" means a sugar substitute having the above formula Ia, where X is O, Y and Z are each CH2, and Q is N. In some embodiments, the morpholino is modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar substitutes are referred to herein as "modified morpholino".

[0184] In some embodiments, the sugar substitute is an acyclic sugar substitute and has formula IIa or IIIa: Formula IIa Formula IIIa in: X is O, S, C(R4R5), N(E1), N(E1)-C (=O); Each J1 and J2 is independently H or C1-C6 alkyl; n is 0, 1, or 2; m is 0, 1, or 2; o is 0 or 1; s is 0 or 1; R1 can be H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, or (CH2). q R7 R2 and R3 are each independently H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2). q R7; E1 is H, C1-C6 alkyl, or substituted C1-C6 alkyl; R4 and R5 are independently H, OH, C1-C6 alkyl or N(R6); wherein if R4 is OH, then R5 is not OH; R6 is H, C1-C6 alkyl, or C(=O)R8, wherein R8 is C1-C6 alkyl; R7 is OH, halogen, methoxy, ethoxy, azide, and C2-C6 alkenyl or C2-C6 alkynyl, and q is 1, 2, or 3.

[0185] In some embodiments, the acyclic sugar substitute is the “unlocked” sugar structure of the UNA (unlocked nucleic acid) nucleotide. Representative U.S. publications teaching the preparation of UNA include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0186] In some embodiments, the acyclic sugar substitute is glycerol, as found in GNA (ethylene glycol nucleic acid) nucleosides, having formula IIa, where n is 1, m and o are 0, s is 1, and J2, R2, and R3 are each H; or butyl, as found in acyclic butyl nucleic acids, having formula IIa, where n is 2, m and o are 0, s is 1, and J2, R2, and R3 are each H. In some embodiments, the acyclic sugar substitute is also referred to as a “C3 spacer” and has formula IIa, where n and o are 1; m and s are 0, and J1, J2, R1, and R3 are each H.

[0187] Other acyclic sugar alternatives include Manoharan et al. Those described in US 10,913,767; US Patent Publication US2021 / 0238595; and PCT Publication WO 2023 / 109940.

[0188] In some embodiments, the modified oligonucleotide comprises one or more glycomimetic compounds, wherein a group other than the "furanosyl sugar moiety" or "sugar substitute" forms the nucleoside moiety corresponding to the β-D-ribosyl sugar in RNA. In some embodiments, the glycomimetic compound is part of the backbone of the peptide nucleic acid, while the remainder of the backbone is a nucleoside internucleotide bond. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262.

[0189] 2. Modified nucleobases In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more debased nucleosides. In some embodiments, the modified oligonucleotide contains only nucleosides containing nucleosides. In some embodiments, the modified oligonucleotide comprises one or more inosine nucleosides (…). Right now (A nucleoside containing a hypoxanthine nucleobase). In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing 5-methylcytosine.

[0190] Unless otherwise stated, modified adenine has structure (I): Where: R 2A It is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl or substituted C1-C6 thioalkyl, C1-C6 alkoxy or substituted C1-C6 alkoxy; R 6A It is H, N(R) a (R) b ), oxo, acetyl, formyl, or O-phenyl; Y 7A It is N and R 7A It is either absent or a C1-C6 alkyl group; or Y 7A It is C and R 7A It is H, C1-C6 alkyl or N(R) a (R) b );Y 8A It is N and R 8A Does not exist, or Y 8A It is C and R 8A It is H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R bEach of these components independently consists of H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, or formyl, or together they form a 5-7 membered heterocycle; excluding Y. 7A It is N and R 7A Does not exist; Y 8A It is C, R 8A It is H, R 2A It is H, and R 6A It is NH2 (unmodified adenine).

[0191] Unless otherwise stated, modified guanine has structure (II): Where: R 2G It is N(R) a (R) b ); R 6G It is oxygenated and R 1G Is it H, or R? 6G It is an O-C1-C6 alkyl or an S-C1-C6 alkyl and R 1G Does not exist; Y 7G It is N and R 7G It is either absent or a C1-C6 alkyl group; or Y 7G It is C and R 7G It is H, C1-C6 alkyl or N(R) a (R) b );Y 8G It is N and R 8G Does not exist, or Y 8G It is C and R 8G It is H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b Independently, it is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl or formyl, or together they form a 5-7 membered heterocycle; excluding Y. 7G It is N and R 7G Does not exist; Y 8G It is C, R 8G It is H, R 2G It is NH2, and R 6G =O (unmodified guanine).

[0192] Unless otherwise stated, modified thymine or modified uracil has structure (III): Where: X is O or S and R 5U It is H, OH, halogen, O-Cl-C 20Alkyl, substituted O-C1-C 12 Alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, C1-C 12 Alkyne or substituted C1-C 12 Alkyne group; where if each X is O, then R 5U It is neither H nor CH3 (which are unmodified uracil and unmodified thymine, respectively).

[0193] Unless otherwise stated, the modified cytosine has structure (IV): Where: X is O or S; R 4C It is N(R) a (R) b ); R 5C It is H, OH, halogen, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 alkenyl or substituted C1-C 12 alkenyl; R a and R b Independently, it is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C 12 Alkyne group, substituted C1-C 12 Alkyne, acetyl, or formyl groups, or together forming a 5-7 membered heterocycle; excluding cases where X is O and R is... 4C It is NH2 and R 5C It is H (unmodified cytosine).

[0194] In some embodiments, the modified nucleobases of the modified oligonucleotide are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobases are selected from: 5-methylcytosine, hypoxanthine, 1-methylpseudoruracil, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl (CºC-CH3)uracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azathymidine, 5-ribosyluracil (pseudoruracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza and other 8-substituted purines, 5-halogenated (especially 5-bromo), 5-trifluoromethyl, 5-halogenated uracil and 5-halogenated cytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deadenine, 7-deadenine, 3-deadenine, 3-deadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, heterojunction bases, size-enlarged bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those purine or pyrimidine bases whose purine or pyrimidine bases are replaced by other heterocyclic rings, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone. Additional nucleobases include those disclosed in Englisch, U. et al. , Angew.Chem.Int. Ed. 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST. and Lebleu, B. (eds.), CRC Press, 1993, pp. 273-288; and those published in Chapters 6 and 15. Antisense Drug Technology , Crooke S.T., ed., CRC Press, 2008, pp. 163-166 and 442-443.

[0195] The preparation of certain of the above-mentioned modified nucleobases and other modified nucleobases is known in the art and can be readily identified in publications, including but not limited to Rogers. et al. US 5,134,066; Benner et al. US 5,432,272; Matteucci et al. US 5,502,177; Froehler et al. US5,594,121; and Cook et al. US 5,681,941.

[0196] In some embodiments, each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and m C. In some embodiments, each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, m C or hypoxanthine.

[0197] 3. Modified nucleoside internucleotide bonds In some embodiments, the oligomers comprising modified antisense oligonucleotides (e.g., antisense oligomers) and / or modified sense oligonucleotides (e.g., sense oligomers) provided herein contain or are composed of modified oligonucleotides, the modified oligonucleotides containing at least one modified nucleotide-to-nucleotide bond. Naturally occurring RNA and DNA nucleotide-to-nucleotide bonds are 3' to 5' phosphodiester bonds. In this document, unless otherwise stated, all nucleotide-to-nucleotide bonds between furanyl sugar moieties are 3' to 5' nucleotide-to-nucleotide bonds. In some embodiments, the nucleotides of the modified oligonucleotides may be linked together using one or more modified nucleotide-to-nucleotide bonds. Two main classes of nucleotide-to-nucleotide bonds are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing nucleotide-to-nucleotide bonds include, but are not limited to, phosphate esters, phosphate triesters, methylphosphonates, aminophosphate esters, thiophosphate esters ("P=S"), and dithiophosphate esters ("HS-P=S") containing phosphodiester bonds ("P=O") (also known as unmodified bonds). Representative phosphorus-free nucleoside bonds include, but are not limited to, methylene methyl imino (-CH2-N(CH3)-O-CH2-), thiodiester, thiocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to naturally occurring phosphodiester bonds, modified nucleoside bonds can be used to alter, and generally increase, the nuclease resistance of oligonucleotides.

[0198] In some embodiments, the modified nucleoside interbond is any of those described in WO 2021 / 030778, which is incorporated herein by reference. In some embodiments, the modified nucleoside interbond has the following formula: Each nucleotide bond in the modified oligonucleotide is independent: X is selected from O and S; R1 is selected from H, C1-C6 alkyl groups, and substituted C1-C6 alkyl groups; and T is selected from SO2R2, C(=O)R3 and P(=O)R4R5, where: R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and conjugate groups; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and conjugate groups; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and conjugate groups; and R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0199] In some embodiments, the modified oligonucleotide comprises a methanesulfonylaminophosphate bond having the following formula: .

[0200] Certain nucleoside interbonds with reduced charge (referred to as “neutral nucleoside interbonds”) have been described. Such neutral nucleoside interbonds include, but are not limited to: phosphate triesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formaldehyde (3'-O-CH2-O-5'), methoxypropyl (MOP) (see US 9,926,556), and thioformaldehyde (3'-S-CH2-O-5'). Other neutral nucleoside interbonds include nonionic bonds, including siloxanes (dialkylsiloxanes), carboxylic esters, formamides, sulfides, sulfonates, and amides (see, for example: Carbohydrate Modifications in Antisense Research(YSSanghvi and PDCook, editors, ACS Symposium Series 580; Chapters 3 and 4, 40–65). Other neutral nucleoside internucleotide bonds include nonionic bonds, comprising a mixture of N, O, S, and CH2 components.

[0201] In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide bond containing a triazole, alkyne, or cyclic guanidine moiety. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide bond having the following formula: It can be stereoironic or enriched with Rp or Sp configurations.

[0202] In some embodiments, the internucleotide bond is not a 3' to 5' internucleotide bond.

[0203] In some embodiments, the modified oligonucleotide comprises one or more inverted nucleosides, wherein the sugar moiety is linked via 3' to 3' and / or 5' to 5', as follows: , Each Bx represents any nucleobase independently.

[0204] In some embodiments, the reverse nucleoside is at the terminal ( Right now The last nucleoside at one end of the oligonucleotide, therefore only one of the aforementioned internucleotide bonds will exist. In some embodiments, additional features ( For example (A conjugation group) is attached to a reverse nucleoside. Such terminal reverse nucleosides can be attached to either end or both ends of an oligonucleotide.

[0205] In some embodiments, the inverted nucleoside lacks a nucleobase (it is a debaseted nucleoside). In some such embodiments, additional features ( For example (The conjugation group) is attached to the reverse debasement nucleoside. The terminal reverse nucleoside can be attached to either end or both ends of the oligonucleotide.

[0206] In some embodiments, the nucleosides are linked at 2' to 5' instead of 3' to 5'. Such bonding is illustrated below.

[0207] , Each Bx represents any nucleobase.

[0208] In some embodiments, the bicyclic sugar moiety can be linked by atoms on a non-furanosyl ring. In some such embodiments, the bicyclic sugar moiety is 7' to 5' linked, as shown below: In some embodiments, the internucleotide bond has at least one chiral center. In such embodiments, the chiral atom may be prepared as a racemic mixture or as separate enantiomers. Representative internucleotide bonds with chiral centers include, but are not limited to, alkylphosphonates, methanesulfonylaminophosphates, and thiophosphates.

[0209] The methanesulfonylaminophosphate nucleoside internucleotide bond contains a chiral center. In some embodiments, it contains ( R p) and / or ( S p) Modified oligonucleotides of methanesulfonyl aminophosphate each contain one or more of the following formulas, where “Bx” indicates a nucleobase: .

[0210] The thiophosphate nucleoside internucleotide bond contains a chiral center. In some embodiments, it includes ( R p) and / or ( S p) The modified oligonucleotides of thiophosphates each contain one or more of the following formulas, where "Bx" represents a nucleobase: Modified oligonucleotides containing nucleotide interseptal bonds with chiral centers can be prepared as groups of modified oligonucleotides containing stereorandom nucleotide interseptal bonds, or as groups of modified oligonucleotides containing nucleotide interseptal bonds with chiral centers exhibiting specific stereochemical configurations. In some embodiments, the group of modified oligonucleotides contains one or more thiophosphate nucleotide interseptal bonds, wherein all of the thiophosphate nucleotide interseptal bonds are stereorandom. In some embodiments, the group of modified oligonucleotides contains one or more methanesulfonylaminophosphate nucleotide interseptal bonds, wherein all of the methanesulfonylaminophosphate nucleotide interseptal bonds are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that results in a randomly selected stereochemical configuration of each thiophosphate and / or methanesulfonylaminophosphate bond. Nevertheless, each individual thiophosphate and / or methanesulfonylaminophosphate of each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing one or more specific, independently selected stereochemical configurations of specific thiophosphate and / or methanesulfonyl phosphate nucleoside bonds. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 65% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 70% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 80% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 90% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 99% of the molecules in the population. Such populations of chiral-enriched modified oligonucleotides can be produced using synthetic methods known in the art. For example The methods described in the following literature: Oka, N., et al., J. Am. Chem. Soc. 2003, 125 , 8307-8317; Wan, WB, Nucleic Acids Res et al. 2014, 42 , 13456 and WO 2017 / 015555.

[0211] As used herein, "chiral enrichment" of a group means a plurality of molecules having the same molecular formula, wherein if a particular chiral center is stereorandom as defined herein, the number or percentage of molecules within the group containing a particular stereochemical configuration at that particular chiral center is greater than the number or percentage of molecules within the group expected to contain the same particular stereochemical configuration at the same particular chiral center. A group of molecules having multiple chiral centers per molecule may contain one or more stereorandom chiral centers. In some embodiments, the molecules are modified oligonucleotides. In some embodiments, the chiral center is located at the phosphorus atom of the thiophosphate nucleoside internucleotide bond. In some embodiments, the chiral center is located at the phosphorus atom of the methanesulfonylaminophosphate nucleoside internucleotide bond. In some embodiments, the group of modified oligonucleotides is enriched with at least one of the following (… S Modified oligonucleotides of thiophosphates and / or methanesulfonyl phosphates with a p) configuration. In some embodiments, the group of modified oligonucleotides is enriched with at least one p) configuration. R p) Modified oligonucleotides of thiophosphate and / or methanesulfonyl phosphate configurations. Unless otherwise stated, the chiral internucleotide bonds of the modified oligonucleotides described herein may be stereorandom or have a specific stereochemical configuration. In some embodiments, the chiral center is located at positions 1', 2', 3', and / or 4' of the furanyl sugar moiety. In some embodiments, each chiral center of each furanyl sugar moiety is enriched such that the sugar moiety has a β-D ribosyl stereochemical configuration. In some embodiments, the modified oligonucleotides of the population are enriched with β-D ribosyl sugar moieties, and all thiophosphate internucleotide bonds are stereorandom, and all methanesulfonyl phosphate internucleotide bonds are stereorandom. In some embodiments, the modified oligonucleotides of the population are enriched with β-D ribosyl sugar moieties, enriched with at least one specific thiophosphate internucleotide bond having a specific stereochemical configuration, and all methanesulfonyl phosphate internucleotide bonds are stereorandom. In some embodiments, the modified oligonucleotides of the group are enriched with the β-D-ribosyl sugar moiety, enriched with at least one specific methanesulfonylaminophosphate nucleoside internucleotide bond having a specific stereochemical configuration, and all thiophosphate nucleoside internucleotide bonds are stereorandom. In some embodiments, the modified oligonucleotides of the group are enriched with the β-D-ribosyl sugar moiety and at least one specific thiophosphate nucleoside internucleotide bond having a specific stereochemical configuration, and enriched with at least one specific methanesulfonylaminophosphate nucleoside internucleotide bond having a specific stereochemical configuration.

[0212] B. Motif In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified nucleotide interbonds. In some such embodiments, the modified, unmodified, and differently modified sugar moiety, nucleotide, and / or nucleotide interbond of the modified oligonucleotide defines a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and nucleotide interbond are each independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or nucleotide interbond motif (as used herein, the nucleotide motif describes modifications to the nucleotide sequence independent of the nucleotide sequence).

[0213] 1. Glycosylation In some embodiments, the oligonucleotide comprises one or more types of modified and / or unmodified sugar moieties arranged along the oligonucleotide or its regions in a defined pattern or glycomolecular motif. In some cases, such glycomolecular motifs include, but are not limited to, any of the sugar modifications discussed herein. In some embodiments, the sugar moieties of at least one nucleoside of the antisense oligomer are modified sugar moieties. In some embodiments, the sugar moieties of at least one nucleoside of the sense oligomer are modified sugar moieties.

[0214] In some embodiments, the modified oligonucleotide comprises or is composed of a region having a fully modified glycomolecular motif. In such embodiments, each nucleotide of the fully modified region of the modified oligonucleotide comprises a modified sugar motif. In some embodiments, each nucleotide of the entire modified oligonucleotide comprises a modified sugar motif. In some embodiments, the modified oligonucleotide comprises or is composed of a region having a fully modified glycomolecular motif, wherein each nucleotide within the fully modified region comprises the same modified sugar motif, referred herein as a uniformly modified glycomolecular motif. In some embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In some embodiments, each nucleotide of the uniformly modified oligonucleotide comprises the same 2'-modification. In some embodiments, every other nucleotide of the uniformly modified oligonucleotide comprises the same 2'-modification, thereby causing alternating 2'-modification. In some embodiments, adjacent nucleotides comprise different 2'-modifications, and every other nucleotide of the uniformly modified oligonucleotide comprises the same 2'-modification, thereby causing uniform, alternating 2'-modified motifs.

[0215] In some embodiments, at least one nucleotide of the modified oligonucleotide contains a 2'-OMe sugar moiety. In some embodiments, at least eight nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least ten nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least twelve nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least thirteen nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least fourteen nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least fifteen nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least sixteen nucleotides contain a 2'-OMe sugar moiety. In some embodiments, at least seventeen nucleotides contain a 2'-OMe sugar moiety. In some such embodiments, at least eighteen nucleotides contain a 2'-OMe sugar moiety. In some such embodiments, at least twenty nucleotides contain a 2'-OMe sugar moiety.

[0216] In some embodiments, at least one nucleoside of the modified oligonucleotide comprises a 2'-F sugar moiety (i.e., a 2'-F modified nucleoside). In some embodiments, at least two nucleosides comprise a 2'-F sugar moiety. In some embodiments, at least three nucleosides comprise a 2'-F sugar moiety. In some embodiments, four nucleosides comprise a 2'-F sugar moiety. In some embodiments, at least one, but no more than four, nucleosides comprise a 2'-F sugar moiety. In some embodiments, one or two nucleosides comprise a 2'-F sugar moiety. In some embodiments, one to three nucleosides comprise a 2'-F sugar moiety. In some embodiments, only one nucleoside comprises a 2'-F sugar moiety. In some embodiments, the antisense oligonucleotide comprises two to four discontinuous 2'-F modified nucleosides. In some embodiments, the four nucleosides of the antisense oligonucleotide are 2'-F modified nucleosides, and none of those 2'-F modified nucleosides are consecutive. In some embodiments, one, two, three, or four nucleosides of the antisense oligomer are 2'-F modified nucleosides, and each of those 2'-F modified nucleosides is discontinuous. In some such embodiments, at least fifteen of the remaining nucleosides are 2'-OMe modified nucleosides. In some embodiments, one nucleoside of the antisense oligomer is a 2'-F modified nucleoside, and at least fifteen of the remaining nucleosides are 2'-OMe modified nucleosides.

[0217] In some embodiments, at least one nucleoside of the modified oligonucleotide comprises a 2'-deoxyribosyl sugar moiety, which is not further modified. In some embodiments, at least one nucleoside comprises a 2'-deoxyribosyl sugar moiety. In some embodiments, at least two nucleosides comprise a 2'-deoxyribosyl sugar moiety. In some embodiments, at least three nucleosides comprise a 2'-deoxyribosyl sugar moiety. In some embodiments, at least four nucleosides comprise a 2'-deoxyribosyl sugar moiety. In some embodiments, one nucleoside comprises a 2'-deoxyribosyl sugar moiety. In some embodiments, one or three nucleosides comprise a 2'-deoxyribosyl sugar moiety. In some embodiments, one to three nucleosides comprise a 2'-deoxyribosyl sugar moiety. In some embodiments, three nucleosides comprise a 2'-deoxyribosyl sugar moiety. In some embodiments, one, two, three, or four nucleosides of the antisense oligomer are 2'-deoxyribosyl sugar-modified nucleosides, and each 2'-deoxyribosyl-modified nucleoside is discontinuous. In some embodiments, one or three nucleosides of the antisense oligomer are 2'-deoxyribosyl sugar-modified nucleosides, and each 2'-deoxyribosyl-modified nucleoside is discontinuous. In some embodiments, none of the nucleosides in the sense oligomer are 2'-deoxyribosyl sugar-modified nucleosides. In some embodiments, three nucleosides of the antisense oligomer are 2'-deoxyribosyl sugar-modified nucleosides, and zero nucleosides in the sense oligomer are 2'-deoxyribosyl-modified nucleosides. In some embodiments, one nucleoside of the antisense oligomer is a 2'-deoxyribosyl sugar-modified nucleoside, and zero nucleosides of the sense oligomer are 2'-deoxyribosyl sugar-modified nucleosides.

[0218] In some embodiments, at least one nucleoside of the modified oligonucleotide comprises a sugar substitute moiety. In some embodiments, at least one nucleoside of the modified oligonucleotide comprises a sugar substitute moiety containing FHNA. In some embodiments, at least one nucleoside comprises a sugar substitute. In some embodiments, at least two nucleosides comprise sugar substitutes. In some embodiments, only one nucleoside comprises a sugar substitute. In some embodiments, both nucleosides of the antisense oligonucleotide are sugar substitutes, and each of these substitutes is discontinuous. In some embodiments, at least one nucleoside comprises an FHNA sugar substitute. In some embodiments, at least two nucleosides comprise FHNA sugar substitutes. In some embodiments, only one nucleoside comprises an FHNA sugar substitute. In some embodiments, both nucleosides of the antisense oligonucleotide are FHNA sugar substitutes, and each of these substitutes is discontinuous. In some embodiments, one nucleoside of the antisense oligonucleotide in FHNA is located at position 2 from the 5' end of the antisense oligonucleotide.

[0219] In some embodiments, the sugar moiety of the antisense oligomer is modified, wherein the modified sugar and / or sugar substitute is selected from 2'-F, 3'-fluorohexetol, 2'-MOE, 2'-OMe, and 2'-deoxyribosyl. In some embodiments, the glycosyl sequence (from 5' to 3') of the antisense oligomer is selected from efyyyfyyyyyyyyfyfyyyyyy, yfyyyfyyyyyyyyfyfyyyyyy, efyyydyyeyyyydydyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyfyfyyyyyee, e [FHNA]yyyfyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyeyyyyfyfyyyyyee, wherein each 'e' represents a 2'-MOE sugar moiety, each 'y' represents a 2'-OMe sugar moiety, each 'f' represents a 2'-F sugar moiety, each '[FHNA]' represents a 3'-fluoro-hexitol sugar moiety, and each 'd' represents a 2'-deoxy sugar moiety. In some embodiments, the sugar moiety of the semantic oligomer is modified, wherein the modified sugar moiety is selected from 2'-F, 2'-MOE, and 2'-OMe. In some embodiments, the glycomolecular motif (from 5' to 3') of the semantic oligomer is selected from: yyyyyyfyfffyyyyyyyyyy and eeyyyyyyyyffyyyyyyyyee, wherein each 'e' represents the 2'-MOE glycomolecular motif, each 'y' represents the 2'-OMe glycomolecular motif, and each 'f' represents the 2'-F glycomolecular motif.

[0220] 2. Nucleobase sequence In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or its regions. In some embodiments, at least one nucleobase is modified. In some embodiments, none of the nucleobases are modified. In some embodiments, at least one purine and / or at least one pyrimidine is modified. In some embodiments, at least one adenine is modified. In some embodiments, at least one guanine is modified. In some embodiments, at least one thymine is modified. In some embodiments, at least one uracil is modified. In some embodiments, at least one cytosine nucleobase in the modified oligonucleotide is 5-methylcytosine. In some embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases. In some embodiments, one or both cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases. In some embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine. (This text is repeated four times in the original.) In some embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine.

[0221] 3. Nucleoside intergrowth motifs In some embodiments, the oligonucleotide comprises modified and unmodified internucleotide bonds arranged along the oligonucleotide or its regions in a defined pattern or motif. In some embodiments, each internucleotide bond is a phosphodiester internucleotide bond. In some embodiments, each internucleotide bond of the modified oligonucleotide is a thiophosphate internucleotide bond. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from thiophosphate internucleotide bonds, methanesulfonyl phosphate internucleotide bonds, and phosphodiester internucleotide bonds. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from thiophosphate internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from methanesulfonyl phosphate internucleotide bonds and thiophosphate internucleotide bonds. In some embodiments, each thiophosphate internucleotide bond is independently selected from stereorandom thiophosphate, (… S p) Thiophosphates and ( R p) Thiophosphates. In some embodiments, each methanesulfonyl phosphate nucleoside internucleotide bond is independently selected from stereorandom methanesulfonyl phosphates, ( S p) methanesulfonyl aminophosphate and ( R p) Methanesulfonylaminophosphate.

[0222] In some embodiments, the modified antisense oligonucleotide has a nucleoside internucleotide motif (5' to 3') independently selected from the following: ssoooooooooooooooooooooss, ssooosooooooooososoooooss, and ssooosoooooooooooooooss, wherein each "s" represents a phosphate thioester nucleoside internucleotide and each "o" represents a phosphate diester nucleoside internucleotide. In some embodiments, the modified sense oligonucleotide has a nucleoside internucleotide motif (5' to 3') independently selected from the following: ssoooooooooooooooooss and ssooooooosoooooooss, wherein each "s" represents a phosphate thioester nucleoside internucleotide and each "o" represents a phosphate diester nucleoside internucleotide.

[0223] The provided oligomeric compounds contain one or more modifications introduced into the modified oligonucleotides. For exampleModified oligonucleotides (including modified sugar motifs, modified nucleotide bases, modified nucleotide internucleotides) and / or combinations thereof. In some embodiments, modified oligonucleotides are characterized by modified motifs and total length. In some embodiments, such parameters are independent of each other. Therefore, unless otherwise stated, each nucleotide internucleotide of a modified oligonucleotide having one or more modified sugar motifs and / or glycomolecular motifs is independently modified or unmodified and may follow or not follow a sugar modification or glycomolecular motif modification pattern. For example, nucleotide internucleotides within a region of a modified oligonucleotide containing certain sugar modifications may be the same or different from each other, and may be the same or different from nucleotide internucleotides within a region of a modified oligonucleotide containing different sugar modifications. Similarly, such modified oligonucleotides may contain one or more modified nucleotide bases that are independent of the sugar modification or glycomolecular motif pattern and independent of nucleotide internucleotides or nucleotide internucleotide motifs. Unless specifically stated, all modifications are independent of the nucleotide sequence.

[0224] C. Length The length of oligonucleotides can be increased or decreased without eliminating their activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of oligonucleotides ranging from 13 to 25 nucleotides in length to induce target RNA cleavage in an oocyte injection model was tested. Oligonucleotides of 25 nucleotides in length with 8 or 11 mismatched bases near the end of the oligonucleotide were able to direct specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotide oligonucleotides, including those with 1 or 3 mismatches.

[0225] In some embodiments, the oligonucleotide (including modified oligonucleotides) may have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ≤ Y. For example, in some embodiments, the oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 Up to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-2918 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25 Composed of 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0226] In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 16 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 17 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 18 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 19 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 20 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 21 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 22 linked nucleosides having no more than 1 to 3 mismatches with the target sequence. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) comprises 23 linked nucleosides having no more than 1 to 3 mismatches with the target sequence.

[0227] In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 16 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 17 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 18 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 19 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 20 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 21 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 22 linked nucleosides. In some embodiments, the modified oligonucleotide (including antisense oligonucleotides) consists of 23 linked nucleosides.

[0228] In some embodiments, the antisense oligomer consists of 12 to 30 linked nucleosides. In some embodiments, the antisense oligomer consists of 17 to 25 linked nucleosides. In some embodiments, the antisense oligomer consists of 17 to 23 linked nucleosides. In some embodiments, the antisense oligomer consists of 17 to 21 linked nucleosides. In some embodiments, the antisense oligomer consists of 18 to 30 linked nucleosides. In some embodiments, the antisense oligomer consists of 20 to 30 linked nucleosides. In some embodiments, the antisense oligomer consists of 21 to 30 linked nucleosides. In some embodiments, the antisense oligomer consists of 23 to 30 linked nucleosides. In some embodiments, the antisense oligomer consists of 18 to 25 linked nucleosides. In some embodiments, the antisense oligomer consists of 20 to 22 linked nucleosides. In some embodiments, the antisense oligomer consists of 21 to 23 linked nucleosides. In some embodiments, the antisense oligomer consists of 23 to 24 linked nucleosides. In some embodiments, the antisense oligomer consists of 20 linked nucleosides. In some embodiments, the antisense oligomer consists of 21 linked nucleosides. In some embodiments, the antisense oligomer consists of 22 linked nucleosides. In some embodiments, the antisense oligomer consists of 23 linked nucleosides.

[0229] In some embodiments, the semantic oligomer consists of 12 to 30 linked nucleosides. In some embodiments, the semantic oligomer consists of 16 to 25 linked nucleosides. In some embodiments, the semantic oligomer consists of 16 to 23 linked nucleosides. In some embodiments, the semantic oligomer consists of 16 to 21 linked nucleosides. In some embodiments, the semantic oligomer consists of 16 to 30 linked nucleosides. In some embodiments, the semantic oligomer consists of 18 to 30 linked nucleosides. In some embodiments, the semantic oligomer consists of 19 to 30 linked nucleosides. In some embodiments, the semantic oligomer consists of 16 to 25 linked nucleosides. In some embodiments, the semantic oligomer consists of 18 to 25 linked nucleosides. In some embodiments, the semantic oligomer consists of 18 to 20 linked nucleosides. In some embodiments, the semantic oligomer consists of 19 to 21 linked nucleosides. In some embodiments, the sense oligomer consists of 18 linked nucleosides. In some embodiments, the sense oligomer consists of 19 linked nucleosides. In some embodiments, the sense oligomer consists of 20 linked nucleosides. In some embodiments, the sense oligomer consists of 21 linked nucleosides.

[0230] D. Nucleotide sequence In some embodiments, the modified oligonucleotide (e.g., oligomeric compound) is further described by its nucleotide sequence. In some embodiments, the oligonucleotide of the oligomeric compound has a nucleotide sequence complementary to a second oligonucleotide or a recognized reference nucleic acid (such as a target nucleic acid). In some such embodiments, the region of the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or a recognized reference nucleic acid (such as a target nucleic acid). In some embodiments, the nucleotide sequence of the region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid (such as a target nucleic acid). In some embodiments, the first oligomeric compound comprises a modified oligonucleotide consisting of 18 to 50 linked nucleosides, wherein the nucleobase sequence of the first oligomeric compound comprises at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleosides of any of SEQ ID NOs: 6 to 829 and 3078 to 3083. In some embodiments, the second oligomeric compound comprises a modified oligonucleotide consisting of 18 to 50 linked nucleosides, wherein the nucleobase sequence of the second oligomeric compound comprises at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleosides of any of SEQ ID NOs: 830 to 1540 and 3096 to 3101.

[0231] II. Conjugates In some embodiments, this document provides oligomeric compounds comprising one or more modified oligonucleotides and one or more conjugation groups. In some embodiments, the oligomeric compound optionally further comprises one or more terminal groups. The conjugation group comprises or consists of a conjugation moiety and a conjugation linker. The conjugation group may be attached at the 3' end and / or 5' end of the oligonucleotide and / or at any internal location. In some embodiments, the conjugation group is attached via a modified sugar moiety or a modified nucleoside internucleotide bond. In some embodiments, the oligomeric compound comprises a modified oligonucleotide, a cell-targeting moiety, and a conjugation linker.

[0232] A. Conjugate group In some embodiments, the conjugate group comprises a conjugate moiety and a conjugate linker.

[0233] Conjugate portion In some embodiments, the conjugate portion modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the conjugate portion imparts novel properties to the attached oligonucleotide.

[0234] In some embodiments, the conjugate portion comprises or is composed of a cell-targeting portion. In some embodiments, the cell-targeting portion is capable of binding to a cell surface receptor or cell surface portion. In some embodiments, an agent comprising a cell-targeting portion is internalized upon interaction with or binding to a cell surface receptor or cell surface portion. In some embodiments, the cell-targeting portion comprises a hepatocyte-targeting portion or a hepatocyte ligand. In some embodiments, the hepatocyte-targeting portion comprises a cell-targeting portion having an affinity for the hepatic desialyl glycoprotein receptor (ASGP-R). In some embodiments, the cell-targeting portion comprises more than one ligand, and each ligand has an affinity for ASGP-R. In some embodiments, each ligand is a carbohydrate. In some embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucosamine, and fucose.

[0235] In some embodiments, each ligand of the cell-targeting portion is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In some such embodiments, the conjugate group comprises a carbohydrate cluster ( See , for example, Maier et al., “Synthesis of AntisenseOligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry , 2003, 14 , 18-29 or Rensen et al., “Design and Synthesis of Novel” N -Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med.Chem. 2004, 47(5798-5808). In some such embodiments, each ligand is an amino sugar or a thioglycolate. For example, the amino sugar may be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di- O methyl-D-mannylpyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N -sulfonyl-D-glucosamine, and N β-hydroxyacetylneuraminic acid. For example, thioglycolates can be selected from 5-thio-β-D-glucopyranose, methyl 2,3,4-tri- O -Acetyl-1-thio-6- O -Triphenylmethyl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose and ethyl 3,4,6,7-tetra- O -Acetyl-2-deoxy-1,5-dithio-α-D- glucose - Heptapyranose.

[0236] In some embodiments, each ligand is N-acetylgalactosamine (GalNAc). In some embodiments, the cell-targeting portion comprises one GalNAc ligand. In some embodiments, the cell-targeting portion comprises two GalNAc ligands. In some embodiments, the cell-targeting portion comprises three GalNAc ligands. In some embodiments, the cell-targeting portion comprises a cluster of GalNAc ligands. In some embodiments, the cell-targeting portion comprises three clusters of GalNAc ligands. In some embodiments, the cell-targeting portion is any of those described in US 9,127,276, the entire contents of which are incorporated herein by reference. In some embodiments, the conjugate group comprises a cell-targeting portion selected from any of the formulas listed in Table A: Conjugate joint In some embodiments, the oligomeric compound comprises an oligonucleotide and a conjugation group, wherein the conjugation group comprises a conjugation moiety and a conjugation linker. In some embodiments, the conjugation linker links the conjugation moiety to the oligonucleotide. In some embodiments, the conjugation linker is a single chemical bond (i.e., the conjugation moiety is directly attached to the oligonucleotide via a single bond). In some embodiments, the conjugation linker comprises one or more atoms. In some embodiments, the conjugation linker comprises a chemical group. In some embodiments, the conjugation linker comprises an oligomer with a chain structure, such as a hydrocarbon chain, or a repeating unit, such as ethylene glycol, nucleoside, or amino acid unit. In some embodiments, the oligonucleotide is a modified oligonucleotide.

[0237] In some embodiments, the conjugation connector comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some such embodiments, the conjugation connector comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In some embodiments, the conjugation connector comprises one or more groups selected from alkyl and amide groups. In some embodiments, the conjugation connector comprises one or more groups selected from alkyl and ether groups. In some embodiments, the conjugation connector comprises at least one phosphorus moiety. In some embodiments, the conjugation connector comprises at least one phosphate group. In some embodiments, the conjugation connector comprises at least one neutral linker group.

[0238] In some embodiments, the conjugate connector (including the conjugate connector described herein) is a bifunctional connection portion. For example Bifunctional linkers are known in the art for attaching conjugate moieties to parent compounds, such as the oligonucleotides provided herein. Generally, a bifunctional linker comprises at least two functional groups. One functional group is selected to react with a specific site on the parent compound, and the other is selected to react with a peptide elongator. Examples of functional groups used in bifunctional linkers include, but are not limited to, electrophilic reagents for reacting with nucleophilic groups and nucleophilic reagents for reacting with electrophilic groups. In some embodiments, the bifunctional linker comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0239] In some embodiments, the conjugate linker comprises a chemical group formed during the reaction of the first functional group with the second functional group. In some embodiments, the modified oligonucleotide is attached to the first functional group during synthesis, and the conjugate portion is attached to the second functional group during synthesis. The two compounds are then mixed under specific conditions to produce the final oligomer. Such reactions, compatible with both oligonucleotide and peptide chemistry, have been previously described and are commonly referred to as “bioconjugation” reactions. These reactions include strain-promoted azide-alkyne cycloaddition (SPAAC), copper-catalyzed click reactions (CuAAC), active ester conjugation with amino-modified oligonucleotides, maleimide-thiol Michael addition, ketol / hydroxylamine linkage, Staudinger linkage, reductive amination, thioether formation, disulfide formation, reductive alkylation, catalyst-free N-arylation, sulfur-fluorine exchange click reactions (SuFEx), and anti-electron-demand Diels-Alder reactions. The following describes some such reactions, for example, Jbara et al., “Oligonucleotide Bioconjugation with Bifunctional Palladium Reagents”. Angew.Chem.Int. Ed. 2021 , 60(21)12109-12115; Dong et al., "Sulfur(VI) Fluoride Exchange (SuFEx): Another Good Reaction for ClickChemistry," Angew.Chem.Int. Ed. 2014, 53(36):9430-9448.4; Zhang et al., "ArylationChemistry for Bioconjugation," Angew. Chem. Int. Ed. Engl. 2019; 58(15): 4810–4839; Walsh et al., “Site-selective modification strategies in antibody-drugconjugates” Chem.Soc.Rev., 2021, 50: 1305-1353; Tiefenbrunn et al., "Chemoselective ligation techniques: modern applications of time-honoredchemistry", Biopolymers 2010, 94(1):95-106; Drake et al., Bioconjug.Chem. 2014, 25(7):1331-1341;Bode, Acc. Chem.Res.,2017, 50, 9, 2104–2115; J. Magano, B. Bock et al. Org.Proc.Res.Dev. 2014, 18:142-151; Craig S. McKay and MGFinn, "Click Chemistry in Complex Mixtures: Bioorthogonal Bioconjugation", Chemistry & Biology 2014; Mitchell P. Christy et al., Org.Lett. 2020, 22: 2365; Ren et al., Angew.Chem.Int. Ed.Engl. 2009, 48, 9658–9662; Rohrbacher, F. et al. Helv.Chim.Acta. 2018, 101; Baalmaan et al., “A Bioorthogonal Click ChemistryToolbox for Targeted Synthesis of Branched and Well-Defined Protein–ProteinConjugates”, Angew.Chem.Int. Ed. 2020 (59): 12885-12893; Lang et al., "Biorthogonal Reactions for Labeling Proteins", J. Am. Chem.Soc, 2014, 9(1):16-20; Nair et al., "The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry", Chem.Mater. 2013 26(1):724-744; Kalia and Raines, “Hydrolytic Stability of Hydrazones and Oximes”, Angew.Chem.Int. Ed., 2008, 47:7523-7526.

[0240] Examples of conjugation linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid succinimide (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C1-C... 10 Alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0241] In some embodiments, the conjugate linker comprises 1 to 5 linker-nucleosides. In some embodiments, the conjugate linker comprises 2 to 5 linker-nucleosides. In some embodiments, the conjugate linker comprises exactly 3 linker-nucleosides. In some embodiments, the conjugate linker comprises a TCA motif. In some embodiments, such linker-nucleosides are modified nucleosides. In some embodiments, such linker-nucleosides comprise a modified sugar moiety. In some embodiments, the linker-nucleosides are unmodified. In some embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker nucleoside needs to be cleaved from the oligomer after it reaches the target tissue. Therefore, linker nucleosides are usually linked to each other by cleavable bonds and to the remainder of the oligomer. In some embodiments, such cleavable bonds are phosphodiester bonds.

[0242] In this document, linker-nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percentage complementarity to a reference nucleic acid, and where the oligomer compound also comprises a conjugate linker including linker-nucleosides, those linker-nucleosides are not included in the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, the oligomer compound may comprise (1) an oligonucleotide and (2) a conjugate linker, the oligonucleotide consisting of 18 to 30 nucleosides, the conjugate linker comprising 1 to 10 linker-nucleosides that are sequential with the nucleoside of the oligonucleotide. The total number of sequentially linked nucleosides in such an oligomer compound exceeds 30. Alternatively, the oligomer compound may comprise an oligonucleotide consisting of 18 to 30 nucleosides and without a conjugate linker. The total number of sequentially linked nucleosides in such an oligomer compound does not exceed 30. Unless otherwise stated, the conjugate linker comprises no more than 10 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 5 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 3 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 2 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 1 linker-nucleoside.

[0243] In some embodiments, it is necessary to cleave the conjugated moiety from the oligonucleotide. For example, in certain cases, oligomeric compounds containing a specific conjugated moiety are better absorbed by a particular cell type, but once the oligomeric compound has been absorbed, the conjugated moiety needs to be cleaved to release the unconjugated or parental oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moiety is a cleavable bond. In some embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moiety contains a group of atoms having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moiety is selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (such as a nuclease).

[0244] In some embodiments, the cleavable bond is selected from one or two esters of amides, esters, ethers, phosphate diesters, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of phosphate diesters. In some embodiments, the cleavable portion comprises a phosphate ester or a phosphate diester. In some embodiments, the cleavable portion is a phosphate diester bond between an oligonucleotide and a conjugate portion.

[0245] In some embodiments, the cleavable portion comprises or consists of one or more linker-nucleosides. In some such embodiments, the one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via cleavable bonds. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside attached to the 3' or 5'-terminal nucleoside of the oligonucleotide via a phosphate ester nucleoside internucleotide bond and covalently attached to the conjugate linker or the remainder of the conjugate portion via a phosphate ester or thiophosphate bond. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0246] In some embodiments, the oligomeric compounds described herein comprise oligonucleotides linked to the conjugate moiety via a conjugate linker, wherein the oligomeric compounds are prepared using click chemistry known in the art. The compounds have been prepared using click chemistry, wherein the alkynylphosphonate nucleoside internucleotide bonds on the oligomeric compounds attached to a solid support are converted to 1,2,3-triazolylphosphonate nucleoside internucleotide bonds, and then cleaved from the solid support (Krishna...). et al., J. Am. Chem.Soc. 2012, 134(28)References 11618-11631 (which are incorporated herein by reference in their entirety). Additional conjugate connectors suitable for use in several examples were prepared by click chemistry as described in "Click Chemistry for Biotechnology and Materials Science," edited by Joerg Laham, Wiley 2009 (which is incorporated herein by reference in its entirety).

[0247] In some embodiments, the compound comprises an oligonucleotide, a cell-targeting moiety, and a conjugation linker. In some embodiments, the oligomeric compound comprises an oligonucleotide, a liver desialylate glycoprotein receptor (ASGP-R) ligand, and a conjugation linker. In some embodiments, the oligomeric compound comprises an oligonucleotide, an N-acetylgalactosamine (GalNAc) ligand, and a conjugation linker. In some embodiments, the oligomeric compound comprises an oligonucleotide, a GalNAc trimer, a branching group, a conjugation linker, and optional modifications to the GalNAc ligand. In some embodiments, the oligomeric compound comprises an oligonucleotide, two or more GalNAc ligands, a branching group, a conjugation linker, and optional modifications to the GalNAc ligand. In some embodiments, the conjugation linker links the GalNAc ligand to the oligonucleotide.

[0248] In some embodiments, two or more GalNAc ligands are covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 3' end of the oligonucleotide. In some embodiments, three GalNAc clusters are covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 3' end of the oligonucleotide. In some embodiments, two or more GalNAc ligands are covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 5' end of the oligonucleotide. In some embodiments, three GalNAc clusters are covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 5' end of the oligonucleotide. In some embodiments, two or more GalNAc ligands are covalently linked to a conjugate linker, and the conjugate linker is covalently linked to an internal position of the oligonucleotide. In some embodiments, three GalNAc clusters are covalently linked to a conjugate linker, and the conjugate linker is covalently linked to an internal position of the oligonucleotide. In some embodiments, the internal position of the oligonucleotide is the 2'-position of the modified sugar moiety of the nucleoside within the internal region of the oligonucleotide, and the nucleoside is neither a 5'-terminal nor a 3'-terminal nucleoside. In some embodiments, the internal position of the oligonucleotide is the modified nucleoside internucleotide bond of the oligonucleotide.

[0249] In some embodiments, the semantic oligomer is conjugated to the THA-GalNAc conjugate group attached to the 5'-OH of the oligonucleotide. The structure of THA-GalNAc is: THA-GalNAc In some embodiments, the semantic oligomer is conjugated to the HPPO-GalNAc conjugate group attached to the 3'-OH of the oligonucleotide. The structure of HPPO-GalNAc is: HPPO-GalNAc B. Certain terminal groups Examples of terminal groups include, but are not limited to, conjugation groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides, wherein one or more groups are attached to either or both ends of the oligonucleotide. In some embodiments, one or more terminal groups are attached to either or both ends of the oligonucleotide. In some embodiments, one or more terminal groups are attached to the 3' and / or 5' ends of the oligonucleotide. In some embodiments, one or more terminal groups are attached to the 3' end of the oligonucleotide. In some embodiments, one or more terminal groups are attached to the 5' end of the oligonucleotide. In some embodiments, one or more terminal groups are attached to the 3' end of the oligonucleotide and one or more terminal groups are attached to the 5' end of the oligonucleotide. In some embodiments, terminal groups are attached to the 3' and / or 5' ends of the oligonucleotide. In some embodiments, terminal groups are attached to the 3' end of the oligonucleotide. In some embodiments, terminal groups are attached near the 3' end of the oligonucleotide. In some embodiments, terminal groups are attached to the 5' end of the oligonucleotide. In some embodiments, the terminal group is attached near the 5' end of the oligonucleotide. In some embodiments, the terminal group is attached at the 3' end of the oligonucleotide and at the 5' end of the oligonucleotide.

[0250] In some embodiments, the oligomeric compound comprises one or more terminal groups. In some embodiments, the oligomeric compound comprises a terminal group comprising a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates and 5'-methylphosphonates. In some embodiments, the terminal group comprises one or more debased sugar moieties. In some embodiments, the terminal group comprises one or more reverse sugar moieties and / or reverse nucleosides. In some embodiments, the terminal group comprises one or more 2'-linked nucleoside or sugar moieties. In some embodiments, the 2'-linked terminal group is a debased sugar moiety. In some embodiments, the antisense oligomeric compound comprises a vinylphosphonate. In some embodiments, each antisense oligomeric compound has a vinylphosphonate moiety (5'-VP) at its 5' end.

[0251] III. Target Nucleic Acids A. LPA In some embodiments, the oligomeric compound comprises or is composed of a modified oligonucleotide containing a target region complementary to an isolength target region of a target nucleic acid, wherein the target nucleic acid is LPA. In some embodiments, the LPA nucleic acid has the nucleobase sequence shown in SEQ ID NO: 1 (a complement of GENBANK accession number NC_000006.12, truncated from nucleoside 160528001 to nucleoside 160669000) or SEQ ID NO: 2 (GENBANK accession number NM_005577.2) or both. In some embodiments, contacting cells with an oligoduplex containing the oligomeric compound inhibits LPA RNA in the cells, and in some embodiments inhibits the production of apo(a) protein or Lp(a) in the cells, the oligomeric compound comprising a modified oligonucleotide complementary to an isolength target region of SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the oligomeric compound comprises a modified oligonucleotide. In some embodiments, the oligomeric compound comprises a modified oligonucleotide and a conjugation group. In some embodiments, the oligomeric compound comprises a modified oligonucleotide and one or more terminal groups. In some embodiments, the oligomeric compound comprises a modified oligonucleotide, a conjugation group, and one or more terminal groups.

[0252] In some embodiments, the oligomeric compound comprises an antisense oligonucleotide containing a targeting region complementary to the target region of the LPA nucleic acid. In some embodiments, the oligomeric compound comprises an antisense oligonucleotide containing a targeting region complementary to the region of SEQ ID NO: 2.

[0253] In some embodiments, the target nucleic acid is an endogenous LPA RNA molecule. In some embodiments, the LPA nucleic acid encodes the apo(a) protein. In some embodiments, the LPA nucleic acid is a precursor of a nucleic acid encoding the apo(a) protein or Lp(a). In some such embodiments, the LPA nucleic acid is selected from mature mRNA and premRNA, including intron regions, exon regions, and untranslated regions. In some embodiments, the LPA RNA is mature mRNA. In some embodiments, the LPA nucleic acid is premRNA.

[0254] In some embodiments, the antisense oligonucleotides provided herein are complementary to the target region of the LPA nucleic acid along the entire length of the modified oligonucleotide. In some embodiments, the antisense oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an isolength portion of the LPA nucleic acid. In some embodiments, the antisense oligonucleotide is at least 80% complementary to the target region of the LPA nucleic acid along the entire length of the antisense oligonucleotide and includes a target region that is 100% or completely complementary to the target region of the LPA nucleic acid.

[0255] In some embodiments, the length of the target region is 6 to 20, 10 to 18, 14 to 18, 16 to 20, or 18 to 20 nucleotides. In some embodiments, the target region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides. In some embodiments, the target region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleotides. In some embodiments, the target region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleoside of the antisense oligonucleotide. In some embodiments, the target region constitutes all the nucleosides of the antisense oligonucleotide. In some embodiments, the target region of the antisense oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to the target region of the LPA nucleic acid. In some embodiments, the target region of the antisense oligonucleotide is 100% complementary to the target region of the LPA nucleic acid.

[0256] In some embodiments, the antisense oligonucleotide contains one or more mismatches relative to the target region of the LPA nucleic acid. In some embodiments, antisense activity against the target is reduced due to this mismatch, and activity against non-targets is also reduced. In some embodiments, the reduction in activity against non-targets is greater than the reduction in activity against the target. Therefore, in some embodiments, the selectivity of the antisense oligonucleotide is improved. In some embodiments, the antisense oligonucleotide is at least 80% complementary to the target region of the LPA nucleic acid over its entire length and contains no more than one to three mismatches with the LPA nucleic acid. In some embodiments, the antisense oligonucleotide contains a target region that is at least 80% complementary to the target region of the LPA nucleic acid over its entire length, and the target region contains no more than one to three mismatches with the target region. In some embodiments, the antisense oligonucleotide contains a target region that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the target region of the LPA nucleic acid over its entire length. In some embodiments, additional mismatches may be present at one or both ends of the antisense oligonucleotide outside the target region. In some embodiments, the mismatch is specifically located within the antisense oligonucleotide. In some embodiments, the mismatch is located 5 [units] away from the antisense oligonucleotide. ' The mismatch is located at positions 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. In some embodiments, the mismatch is located at a distance of 3 from the antisense oligonucleotide. ' The ends are located at positions 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2. In some embodiments, the mismatch is located 5 units away from the antisense oligonucleotide. ' The mismatch is located at position 1, 2, 3, or 4 of the end. In some embodiments, the mismatch is located at a distance of 3 from the antisense oligonucleotide. ' The end is located at position 4, 3, 2, or 1.

[0257] B. Target nucleic acids in certain tissues In some embodiments, the oligomeric compound comprises or is composed of a modified oligonucleotide containing a targeting region complementary to a target region in the LPA nucleic acid, wherein the LPA nucleic acid is expressed in a pharmacologically relevant tissue. In some embodiments, the LPA nucleic acid is expressed in the liver.

[0258] C. Oligonucleotide sequence This document provides oligomeric compounds comprising modified oligonucleotides complementary to a target region in LPA nucleic acids (such as, for example, human LPA nucleic acids), such as the complement of SEQ ID NO: 1 (GENBANK Registry No. NC_000006.12, truncated from nucleoside 160528001 to nucleoside 160669000) or SEQ ID NO: 2 (GENBANK Registry No. NM_005577.2) or both, and compositions comprising such oligomeric compounds. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising or consisting of a target region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to one region of SEQ ID NO: 1 and / or 2. In some embodiments, the modified oligonucleotide has a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to the target region of SEQ ID NO: 1 and / or 2. In some embodiments, the modified oligonucleotide has a target region that is 100% complementary to the target region of SEQ ID NO: 1 and / or 2. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising or consisting of a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to the target region of SEQ ID NO: 1 and / or 2. In some embodiments, the modified antisense oligonucleotide has a nucleobase sequence comprising or consisting of any one of SEQ ID NO: 6 to 829 and 3078 to 3083. In some embodiments, the second modified sense oligonucleotide has a nucleobase sequence comprising or consisting of a complementary region, the complementary region being at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to the first modified antisense oligonucleotide, or the complementary region being 100% complementary to the first modified antisense oligonucleotide. In some embodiments, the modified sense oligonucleotide has a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 830 to 1540 and 3096 to 3101.

[0259] IV. Oligomeric distrands In some embodiments, the oligomeric compounds provided herein comprise modified oligonucleotides having a nucleobase sequence complementary to a sequence in an LPA target nucleic acid, which pairs with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound and a second oligomeric compound, the first oligomeric compound comprising a modified oligonucleotide having a portion complementary to a sequence in an LPA target nucleic acid, and the second oligomeric compound comprising a modified oligonucleotide having a portion complementary to the first oligomeric compound. In some embodiments, the first oligomeric compound of the oligomeric duplex comprises (1) a first modified oligonucleotide, and optionally a conjugation group and / or a terminal group, or thereof; and the second oligomeric compound of the oligomeric duplex comprises (2) a second modified oligonucleotide, and optionally a terminal group and / or a conjugation group, or thereof. Either or both oligomeric compounds of the oligomeric duplex may contain a conjugation group. Either or both oligomeric compounds of the oligomeric duplex may contain a terminal group. Each oligonucleotide in the oligoduplex may comprise a non-complementary or unpaired dangling nucleotide. In some embodiments, the non-complementary or unpaired dangling nucleotide is adenosine or thymine. In some embodiments, the non-complementary or unpaired dangling nucleotide includes inosine. In some embodiments, the two oligonucleotides have at least one mispairing relative to each other. In some embodiments, the oligoduplex is an antisense agent.

[0260] In some embodiments, the oligoduplex comprises: a first oligomer compound comprising a first modified oligonucleotide composed of 18 to 28 linked nucleosides, wherein the nucleotide sequence of the first modified oligonucleotide comprises at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleosides of any one of SEQ ID NO: 6 to 829 and 3078 to 3083; and a second oligomer compound comprising a second modified oligonucleotide composed of 15 to 25 linked nucleosides, wherein the nucleotide sequence of the second modified oligonucleotide comprises SEQ ID NO: The sequence comprises at least 16, 17, 18, 19, 20, or 21 consecutive nucleobases in any of the sequences 830 to 1540 and 3096 to 3101; and each of the nucleosides of the first modified oligonucleotide comprises a modified sugar moiety or sugar substitute, and wherein no more than 22%, 20%, 18%, 15%, 10%, or 5% of the modified nucleosides in the first modified oligonucleotide comprises 2'-F modification; and each of the nucleosides of the second modified oligonucleotide comprises a modified sugar moiety or sugar substitute, and wherein no more than 25%, 20%, 18%, 16%, 14%, 12%, or 10% of the modified nucleosides in the second modified oligonucleotide comprises 2'-F modification. In some embodiments, the oligoduplex is an antisense agent. In some embodiments, the first oligomeric compound of the oligoduplex is an antisense agent, wherein the first modified oligonucleotide is an antisense oligomeric compound. In some embodiments, the second oligomeric compound of the oligoduplex is a sense agent, wherein the second modified oligonucleotide is a sense oligomeric compound. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, wherein no more than 22%, no more than 20%, no more than 18%, no more than 16%, no more than 14%, no more than 12%, no more than 10%, or no more than 7% of the modified nucleoside in the oligoduplex comprises a modified sugar moiety containing a 2'-F modification. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleotide sequence of the second modified oligonucleotide is at least 90%, 95%, or 100% complementary to the nucleotide sequence of an isoplethora portion of the first modified oligonucleotide.

[0261] In some embodiments, the oligoduplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 28 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleosides of any one of SEQ ID NOs: 6 to 829 and 3078 to 3083; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 25 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises SEQ ID NOs: 6 to 829 and 3078 to 3083. The first modified oligonucleotide contains at least 16, 17, 18, 19, 20, or 21 consecutive nucleobases in any of the sequences NO: 830 to 1540 and 3096 to 3101, and each of the nucleosides of the first modified oligonucleotide comprises a modified sugar moiety or sugar substitute, and the first modified oligonucleotide comprises at least one modified nucleoside and no more than four modified nucleosides containing 2'-F modification; and each of the nucleosides of the second modified oligonucleotide comprises a modified sugar moiety or sugar substitute, and at least one modified nucleoside and no more than four modified nucleosides of the second modified oligonucleotide contain 2'-F modification. In some embodiments, the first oligomeric compound is an antisense agent, wherein the first modified oligonucleotide is an antisense oligomeric compound. In some embodiments, the second oligomeric compound is a sense agent, wherein the second modified oligonucleotide is a sense oligomeric compound. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleotide sequence of the second modified oligonucleotide comprises a complementary region of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleotides that are 100% complementary to the nucleotide sequence of the equivalent portion of the first modified oligonucleotide. In some embodiments, the nucleotide sequence of the second modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleotide sequence of the equivalent portion of the first modified oligonucleotide. In some embodiments, the oligoduplex is an antisense agent.In some embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that are 100% complementary to the nucleobase sequence of the equivalent portion of the first modified oligonucleotide; and the nucleobase sequence of the second modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleobase sequence of the equivalent portion of the first modified oligonucleotide. In some embodiments, the oligodichain is an antisense agent, wherein the oligodichain contains no more than three, four, five, six, seven, or eight nucleosides comprising a modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute.

[0262] In some embodiments, the oligoduplex comprises: a first oligomer compound comprising a first modified oligonucleotide composed of 18 to 28 linked nucleosides, wherein the nucleotide sequence of the first modified oligonucleotide comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleosides of any of SEQ ID NO: 6 to 829 and 3078 to 3083; and a second oligomer compound comprising a second modified oligonucleotide composed of 15 to 25 linked nucleosides, wherein the nucleotide sequence of the second modified oligonucleotide comprises SEQ ID NO: The sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases in any of the sequences 830 to 1540 and 3096 to 3101; wherein each of the nucleosides of the first modified oligonucleotide and each of the nucleosides of the second modified oligonucleotide independently comprises a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute being independently selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluorohexetol, wherein at least one modified nucleoside and no more than four modified nucleosides of the first modified oligonucleotide comprise 2'-F modification, and at least one modified nucleoside and no more than four modified nucleosides of the second modified oligonucleotide comprise 2'-F modification. In some embodiments, the first oligomeric compound is an antisense agent, wherein the first modified oligonucleotide is an antisense oligomeric compound. In some embodiments, the second oligomeric compound is a sense agent, wherein the second modified oligonucleotide is a sense oligomeric compound. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleotide sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleotide sequence of an equal-length portion of the first modified oligonucleotide. In some embodiments, the oligoduplex is an antisense agent, wherein the oligoduplex contains no more than three, four, five, six, seven, or eight nucleotides comprising a modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute.

[0263] In some embodiments, the oligoduplex comprises: a first oligomer compound comprising a first modified oligonucleotide composed of 18 to 28 linked nucleosides, wherein the nucleotide sequence of the first modified oligonucleotide comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleosides of any of SEQ ID NO: 6 to 829 and 3078 to 3083; and a second oligomer compound comprising a second modified oligonucleotide composed of 15 to 25 linked nucleosides, wherein the nucleotide sequence of the second modified oligonucleotide comprises SEQ ID NO: The nucleotide sequence of any one of 830 to 1540 and 3096 to 3101 contains at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides; wherein each of the nucleotides of the first modified oligonucleotide and each of the nucleotides of the second modified oligonucleotide independently comprises a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute being... The oligonucleotide is independently selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluorohexetol, wherein only one or only three nucleosides in the first modified oligonucleotide are 2'-deoxyribosyl, and none of the nucleosides in the second modified oligonucleotide are 2'-deoxyribosyl; wherein one or three of the modified sugar moieties and / or sugar substitutes in the first modified oligonucleotide contain 2'-F modification, and both modified nucleosides in the second modified oligonucleotide contain 2'-F modification. In some embodiments, the first oligonucleotide is an antisense agent, wherein the first modified oligonucleotide is an antisense oligonucleotide containing a 5' terminal group. In some embodiments, the second oligonucleotide is a sense agent, wherein the second modified oligonucleotide is a sense oligonucleotide optionally conjugated to a cell-targeting moiety. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal-length portion of the first modified oligonucleotide. In some embodiments, the oligoduplex is an antisense agent, wherein no more than three, four, or five nucleosides in the oligoduplex contain modified sugar moieties or sugar substitutes, the modified sugar moieties or sugar substitutes containing 2'-F sugar moieties and / or FHNA sugar substitutes.

[0264] In some embodiments, the oligoduplex comprises: a first oligomer compound comprising a first modified oligonucleotide composed of 18 to 28 linked nucleosides, wherein the nucleotide sequence of the first modified oligonucleotide comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleosides of any of SEQ ID NO: 6 to 829 and 3078 to 3083; and a second oligomer compound comprising a second modified oligonucleotide composed of 15 to 25 linked nucleosides, wherein the nucleotide sequence of the second modified oligonucleotide comprises SEQ ID NO: The nucleotide sequence of any one of 830 to 1540 and 3096 to 3101 contains at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides; wherein each of the nucleotides of the first modified oligonucleotide and each of the nucleotides of the second modified oligonucleotide independently comprises a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute being... The substitutes are independently selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluorohexetol, wherein only one nucleoside in the first modified oligonucleotide contains 3'-fluorohexetol and none of the nucleosides in the second modified oligonucleotide contains 3'-fluorohexetol; wherein three of the modified sugar moieties and / or sugar substitutes in the first modified oligonucleotide contain 2'-F and two or four of the modified nucleosides in the second modified oligonucleotide contain 2'-F modification. In some embodiments, the first oligomeric compound is an antisense agent, wherein the first modified oligonucleotide is an antisense oligomeric compound containing a 5' terminal group. In some embodiments, the second oligomeric compound is a sense agent, wherein the second modified oligonucleotide is a sense oligomeric compound optionally conjugated to a cell-targeting moiety. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal-length portion of the first modified oligonucleotide. In some embodiments, the oligoduplex is an antisense agent, wherein no more than five, six, seven, or eight nucleosides in the oligoduplex contain modified sugar moieties or sugar substitutes, the modified sugar moieties or sugar substitutes containing 2'-F sugar moieties and / or FHNA sugar substitutes.

[0265] In some embodiments, the oligoduplex comprises a first oligomer compound comprising a first modified oligonucleotide, wherein the first modified oligonucleotide consists of 21 to 23 linked nucleosides and has a nucleobase sequence comprising at least 19-bp of a nucleobase sequence comprising any one of SEQ ID NO: 6 to 829 and 3078 to 3083, having 0, 1, 2, or 3 nucleobases different from the corresponding nucleotides in any one of SEQ ID NO: 6 to 829 or 3078 to 3083; and a second oligomer compound comprising a second modified oligonucleotide, wherein the second modified oligonucleotide consists of 19 to 21 linked nucleosides and has a nucleobase sequence comprising at least 17-bp of a nucleobase sequence comprising any one of SEQ ID NO: 830 to 1540 and 3096 to 3101, having a nucleobase sequence ...830 to 1540 or 3096 to 3101, having 0, 1, 2, or 3 nucleobases different from the corresponding nucleotides in any one of SEQ ID NO: 830 to 1540 or 3096 to 3101, having a nucleobase sequence different from the corresponding nucleotides in any one of SEQ ID NO: 830 to 1540 or 3096 to 3 NO:830 to 1540 or 3096 to 3101, each of the corresponding nucleotides having 0, 1, 2 or 3 nucleobases different, wherein each of the nucleosides of the first modified oligonucleotide and the second modified oligonucleotide independently contains a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute being independently selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl and 3'-fluoro-hexitol, wherein three or none of the nucleosides in the first modified oligonucleotide are 2'-deoxynucleosides, and none of the nucleosides in the second modified oligonucleotide are 2'-deoxynucleosides; wherein one or two of the first modified oligonucleotides or three or four of the modified sugar moiety and / or sugar substitute contain 2'-F modification, and two or four of the modified nucleosides in the second modified oligonucleotide contain 2'-F modification. In some embodiments, the first oligomeric compound is an antisense agent, wherein the first modified oligonucleotide is an antisense oligomeric compound containing a 5' terminal group. In some embodiments, the second oligomeric compound is a sense agent, wherein the second modified oligonucleotide is a sense oligomeric compound optionally conjugated to a cell-targeting moiety. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleotide sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleotide sequence of an isoplethora portion of the first modified oligonucleotide. In some embodiments, the oligoduplex is an antisense agent, wherein at least one modified nucleoside and no more than five, six, seven, or eight nucleosides in the oligoduplex contain a modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute.In some embodiments, one or both of the modified sugar moiety and / or sugar substitute in the first modified oligonucleotide contain a 2'-F modification, and two modified nucleosides in the second modified oligonucleotide contain a 2'-F modification, and no more than three nucleosides in the oligoduplex contain a modified sugar moiety or sugar substitute containing a 2'-F sugar moiety and / or an FHNA sugar substitute. In some embodiments, three or four of the modified sugar moiety and / or sugar substitute in the first modified oligonucleotide contain a 2'-F modification, and two or four modified nucleosides in the second modified oligonucleotide contain a 2'-F modification. In some embodiments, the oligoduplex contains one or two unpaired nucleosides at either end or both ends, thereby forming one or two overhangs. In some embodiments, the overhang is one or two nucleosides of an antisense oligomer. In some embodiments, the overhang is one or two 3'-nucleosides of an antisense oligomer. In some embodiments, the last two 3'-nucleosides of the antisense oligomer are dangling nucleosides that are not paired with the sense oligomer. In some embodiments, the last or two unpaired 3'-dangling nucleosides comprise adenine nucleobases. In some embodiments, the last or two unpaired 3'-dangling nucleosides comprise thymine nucleobases. In some embodiments, the last or two unpaired 3'-dangling nucleosides comprise uracil nucleobases. In some embodiments, the last or two unpaired 3'-dangling nucleosides comprise inosine nucleobases. In some embodiments, the oligoduplex is an antisense agent, wherein no more than five, six, seven, or eight nucleosides in the oligoduplex comprise a modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute.

[0266] In some embodiments, the oligoduplex comprises a first oligomeric compound comprising a first modified oligonucleotide, wherein the first modified oligonucleotide consists of 21 to 23 linked nucleosides and has a nucleobase sequence comprising at least 19-bp of any one of SEQ ID NOs: 1541 to 2346 and 3090 to 3095, and having 0, 1, 2, or 3 mismatches with the sequence in the LPA target nucleic acid sequence; and a second oligomeric compound comprising a second modified oligonucleotide, wherein the second modified oligonucleotide consists of 19 to 21 linked nucleosides and has at least 19-bp of any one of SEQ ID NOs: 2365 to 3075 and 3084 to 3089, and having 0, 1, 2, or 3 mismatches with the first modified oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of an equal-length portion of the first modified oligonucleotide. In some embodiments, the oligoduplex is an antisense agent, wherein each of the nucleosides of the first modified oligonucleotide and each of the nucleosides of the second modified oligonucleotide independently comprises a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute being independently selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluorohexetol, and wherein at least one modified nucleoside and no more than four modified nucleosides of the first modified oligonucleotide comprise 2'-F modification, and at least one modified nucleoside and no more than four modified nucleosides of the second modified oligonucleotide comprise 2'-F modification. In some embodiments, the oligoduplex comprises one or two unpaired nucleosides at either end or both ends, thereby forming one or two overhanging ends. In some embodiments, the dangling end is one or both nucleosides of the antisense oligomer. In some embodiments, the dangling end is one or both 3'-nucleosides of the antisense oligomer. In some embodiments, the last two 3'-nucleosides of the antisense oligomer are dangling nucleosides that are not paired with the sense oligomer. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain adenine nucleobases. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain thymine nucleobases. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain uracil nucleobases. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain inosine nucleobases. In some embodiments, the last two 3'-unpaired dangling nucleosides contain both thymine and inosine nucleobases.In some embodiments, the last two 3'-unpaired pendant nucleosides comprise thymine and inosine nucleosides from 5' to 3'. In some embodiments, the last two 3'-unpaired pendant nucleosides comprise inosine and thymine nucleosides from 5' to 3'. In some embodiments, the last two 3'-unpaired pendant nucleosides comprise adenine and inosine nucleosides from 5' to 3'. In some embodiments, the last two 3'-unpaired pendant nucleosides comprise inosine and adenine nucleosides from 5' to 3'.

[0267] In some embodiments, the oligoduplex comprises a first oligomeric compound and a second oligomeric compound, the first oligomeric compound comprising a first modified oligonucleotide composed of 19 to 25 linked nucleosides, and the second oligomeric compound comprising a second modified oligonucleotide composed of 16 to 24 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide each comprise at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleosides selected from any of the following pairs of the first and second oligomeric compounds, wherein the first oligomeric compound is selected from SEQ ID NO: The first oligonucleotide is selected from any of SEQ ID NOs: 2365 to 3075 and 3084 to 3089. In some embodiments, the first oligonucleotide is an antisense agent. In some embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligonucleotide is a sense agent. In some embodiments, the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second oligonucleotide is a sense agent. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.

[0268] In some embodiments, the oligoduplex comprises a first oligomeric compound and a second oligomeric compound. The first oligomeric compound comprises a first modified oligonucleotide consisting of 21 or 23 linked nucleosides. The second oligomeric compound comprises a second modified oligonucleotide consisting of 19 or 21 linked nucleosides. The nucleobase sequences of the first and second modified oligonucleotides consist of any one of the following pairs selected from the first and second oligomeric compounds: the first oligomeric compound is selected from any one of SEQ ID NOs: 1541 to 2364 and 3090 to 3095; and the second oligomeric compound is selected from any one of SEQ ID NOs: 2365 to 3075 and 3084 to 3089. In some embodiments, the first oligomeric compound is an antisense agent. In some embodiments, the first modified oligonucleotide is an antisense oligomeric compound. In some embodiments, the second oligomeric compound is a sense agent. In some embodiments, the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second oligonucleotide is a sense agent. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the oligoduplex contains one or two unpaired nucleosides at either end or both ends, thereby forming one or two dangling ends. In some embodiments, the dangling ends are one or two 3'-nucleosides of the antisense oligonucleotide. In some embodiments, the last two 3'-nucleosides of the antisense oligonucleotide are dangling nucleosides that are not paired with the sense oligonucleotide. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain adenine nucleobases. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain thymine nucleobases. In some embodiments, the last or two 3'-unpaired dangling nucleosides contain uracil nucleobases. In some embodiments, the last one or two 3'-unpaired pendant nucleosides comprise inosine nucleobases. In some embodiments, the antisense oligomer comprises a 5'-terminal group. In some embodiments, the sense chain comprises a conjugation group attached at the 5' or 3' end of the sense oligomer.

[0269] In any of the oligodichains described herein, at least one nucleotide of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties, such as 2'-4' bridges selected from –O-CH2- and –O-CH(CH3)-, and non-bicyclic sugar moieties, such as 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-OMe sugar moieties, or 2'-NMA sugar moieties. In some embodiments, at least one nucleotide of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified 2'-deoxyribosyl sugar moiety. In some embodiments, at least one nucleotide of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified 3'-fluorohexetol glycosyl sugar moiety. In some embodiments, at least 80%, at least 90%, or 100% of the nucleosides in the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety independently selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluorohexetol. In some embodiments, at least 80%, at least 90%, or 100% of the nucleosides in both the first and second modified oligonucleotides comprise a modified sugar moiety independently selected from 2'-F, 2'-MOE, 2'-OMe, and 2'-deoxyribosyl.

[0270] In some embodiments, in the oligoduplexes provided herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety and / or a sugar substitute. In some embodiments, in the oligoduplexes provided herein, the sugar moiety of the first modified oligonucleotide is modified, wherein the modified sugar moiety and / or sugar substitute is selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluorohexetol. In some embodiments, in the oligomeric duplexes provided herein, the glycosylation motif (from 5' to 3') of the first modified oligonucleotide is selected from: efyyyfyyyyyyyyfyfyyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyydydyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyyyyyfy yyyyyee, e[FHNA]yyyfyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyeyyyyfyfyyyyyee, wherein each 'e' represents a 2'-MOE sugar moiety, each 'y' represents a 2'-OMe sugar moiety, each 'f' represents a 2'-F sugar moiety, each '[FHNA]' represents a 3'-fluoro-hexitol sugar moiety, and each 'd' represents a 2'-deoxy sugar moiety. In some embodiments, in the oligodichain provided herein, the sugar moiety of the second modified oligonucleotide is modified, wherein the modified sugar moiety is selected from 2'-F, 2'-MOE, 2'-OMe, 2'-deoxyribosyl, and 3'-fluoro-hexitol. In some embodiments, in the oligoduplex provided herein, the glycomolecular motif (from 5' to 3') of the second modified oligonucleotide is selected from: yyyyyyfyfffyyyyyyyyyy and eeyyyyyyyyffyyyyyyyyee, wherein each 'y' represents a 2'-OMe sugar motif, each 'f' represents a 2'-F sugar motif, and each 'e' represents a 2'-MOE sugar motif.

[0271] In some embodiments, in the oligomeric duplexes provided herein, the glycosyl motifs (from 5' to 3') of the first modified oligonucleotide and the second modified oligonucleotide are selected from: efyyyfyyyyyyyyfyfyyyyyyy and yyyyyyyfyfffyyyyyyyyyy; yfyyyyfyyyyyyyyfyfyyyyyyy and yyyyyyfyfffyyyyyyyyy; efyyydyyeyyyydydyyyyyee and eeyyyyyyyyffyyyyyyyee; efyyydyyyyyyyfyfyyyyyee and eeyyyyyyyyyffyyyyyyyee; efyyydyyeyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee; e[FHNA]yyyfyyeyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee; and e[FHNA]yyyfyyyyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee, where each 'e' represents the 2'-MOE sugar moiety, each 'y' represents the 2'-OMe sugar moiety, each 'f' represents the 2'-F sugar moiety, each '[FHNA]' represents the 3'-fluoro-hexitol sugar moiety, and each 'd' represents the 2'-deoxy sugar moiety.

[0272] In some embodiments, in the oligomeric duplexes provided herein, at least one nucleoside internucleotide bond of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified nucleoside internucleotide bond. In some embodiments, the modified nucleoside internucleotide bond is a phosphate thioester nucleoside internucleotide bond. In some embodiments, at least one of the first, second, or third nucleoside internucleotide bonds at the 5' and / or 3' ends of the first modified oligonucleotide comprises a phosphate thioester bond. In some embodiments, at least one of the first, second, or third nucleoside internucleotide bonds at the 5' and / or 3' ends of the second modified oligonucleotide comprises a phosphate thioester bond.

[0273] In some embodiments, in the oligomeric duplexes provided herein, each nucleoside bond of the first modified oligonucleotide is independently selected from phosphate diesters and thiophosphates, and each nucleoside bond of the second ...

[0274] In some embodiments, in the oligomeric duplexes provided herein, at least one bond of the antisense oligomer is a modified bond. In some embodiments, in the oligomeric duplexes provided herein, the internucleotide bonds of the first modified oligonucleotide are modified, wherein the most 5' internucleotide bond (i.e., the link between the first nucleotide counted from the 5' end and the second nucleotide counted from the 5' end) is modified. In some embodiments, in the oligomeric duplexes provided herein, the internucleotide bond motif (from 5' to 3') of the first modified oligonucleotide is selected from 5'-ssooooooooooooooooooooooss-3', 5'-ssooosooooooooososoooooss-3', and 5'-ssooosoooooooooooooooooss-3', where each "s" is a thiophosphate internucleotide bond and each "o" is a phosphodiester internucleotide bond. In some embodiments, in the oligoduplex provided herein, the internucleotide bonds of the second modified oligonucleotide are modified, wherein the most 5' internucleotide bond (i.e., the link between the first nucleotide counted from the 5' end and the second nucleotide counted from the 5' end) is modified. In some embodiments, in the oligoduplex provided herein, the internucleotide bond motif (from 5' to 3') of the second modified oligonucleotide is selected from (from 5' to 3'): 5'-ssoooooooooooooooooooss-3' and 5'-ssooooooooosoooooooooss-3', wherein each 'o' represents a phosphodiester internucleotide bond and each 's' represents a thiophosphate internucleotide bond. In some embodiments, both most 5' internucleotide bonds are modified. In some embodiments, the first or two internucleotide bonds counted from the 3' end are modified. In some embodiments, the modified internucleotide bond is a thiophosphate bond.

[0275] In some embodiments, in the oligomeric duplexes provided herein, at least one nucleobase of the first modified oligonucleotide and / or at least one nucleobase of the second modified oligonucleotide is a modified nucleobase. In some embodiments, the modified nucleobase is methylcytosine. In some embodiments, the modified nucleobase is inosine.

[0276] In some embodiments, in the oligomeric duplexes provided herein, the first oligomeric compound comprises a terminal group comprising a stabilized phosphate group attached to the 5' position of the most 5' nucleotide. In some embodiments, the stabilized phosphate group comprises a cyclopropylphosphonate or (E)- Vinylphosphonate. In some embodiments, the stabilized phosphate group is... (E)- Vinylphosphonate.

[0277] In some embodiments, in the oligomeric duplexes provided herein, a first modified oligonucleotide is optionally attached to a conjugation group. In some embodiments, the conjugation group comprises a conjugation linker and a conjugation moiety. In some embodiments, the conjugation group is attached to the first modified oligonucleotide at the 5' end. In some embodiments, the conjugation group is attached to the first modified oligonucleotide at the 3' end. In some embodiments, the conjugation group is attached to the first modified oligonucleotide at an internal position. In some embodiments, the conjugation group is attached to the first modified oligonucleotide via a 2'-modification of the furanyl sugar moiety. In some embodiments, the conjugation group is attached to the first modified oligonucleotide via a modified nucleoside internucleotide bond. In some embodiments, the conjugation group comprises N-acetylgalactosamine.

[0278] In any of the oligomeric duplexes described herein, a second modified oligonucleotide is optionally attached to a conjugation group. In some embodiments, the conjugation group comprises a conjugation linker and a conjugation moiety. In some embodiments, the conjugation group is attached to the second modified oligonucleotide at the 5' end. In some embodiments, the conjugation group is attached to the second modified oligonucleotide at the 3' end. In some embodiments, the conjugation group is attached to the second modified oligonucleotide at an internal position. In some embodiments, the conjugation group is attached to the second modified oligonucleotide via a 2'-modification of the furanyl sugar moiety. In some embodiments, the conjugation group is attached to the second modified oligonucleotide via a modified nucleoside internucleotide bond. In some embodiments, the conjugation group comprises N-acetylgalactosamine.

[0279] In some embodiments, the oligoduplex comprises an oligomeric compound that is the antisense agent described herein. In some embodiments, the antisense agent (which is the oligoduplex described herein) is an RNAi agent capable of reducing the amount of LPA RNA through RISC / Ago2 activation.

[0280] In some embodiments, the oligomer comprises at least two oligoduplexes linked together. In some embodiments, the oligomer comprises two oligoduplexes, wherein at least one oligoduplex targets LPA RNA as described herein. In some embodiments, the oligomer comprises two or more identical oligoduplexes, which are any of the oligoduplexes described herein. In some embodiments, the two or more oligoduplexes are covalently linked together. In some embodiments, a second modified oligonucleotide of the two or more oligoduplexes is covalently linked together. In some embodiments, the second modified oligonucleotides of the two or more oligoduplexes are covalently linked together at their 3' ends. In some embodiments, the second modified oligonucleotides of the two or more oligoduplexes are covalently linked at the 3' end of one to the 5' end of the other. In some embodiments, the two or more oligoduplexes are covalently linked together via a diol linker (such as a tetraethylene glycol linker). The structures of oligomeric duplexes covalently linked via diol linkers are described, for example, by Alterman et al. Nature Biotech. 37:844-894, 2019. In some embodiments, a first modified oligonucleotide of the first oligoduplex is covalently linked to a second modified oligonucleotide of the second oligoduplex, and the first modified oligonucleotide of the second oligoduplex is covalently linked to the second modified oligonucleotide of the first oligoduplex (see, for example, PCT International Patent Application Publication WO2020 / 065602 for a description of an example of the structure of the linked oligoduplex).

[0281] V. Methods and Uses A. Antisense activity In some embodiments, the oligoduplexes provided herein comprise oligomeric compounds capable of hybridizing with target nucleic acids to produce at least one antisense activity; such oligoduplexes and oligomeric compounds are antisense agents.

[0282] In some antisense activities, the hybridization of antisense oligomers with target nucleic acids induces the recruitment of proteins that cleave the target nucleic acids. For example, in some antisense activities, the antisense agent or a portion thereof is loaded into an RNA-induced silencing complex (RISC), ultimately causing cleavage of the target nucleic acid. For example, some antisense agents cause the target nucleic acid to be cleaved by the AGO protein (Argonaute). The antisense agent loaded into the RISC is an RNAi agent. The RNAi agent can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In some embodiments, the RNAi agent is capable of RISC-mediated regulation of target nucleic acids in cells. In some embodiments, such compounds are in standard in vitroThe assay reduces or inhibits the amount or activity of the target nucleic acid by 25% or more. In some embodiments, the RNAi agent selectively affects one or more target nucleic acids. Such RNAi agents contain nucleobase sequences that hybridize with one or more target nucleic acids, thereby eliciting one or more desired antisense activities. In some embodiments, the RNAi agent does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that elicites significant undesired antisense activity.

[0283] In some embodiments, hybridization of the antisense agent with the target nucleic acid results in inhibition of the target nucleic acid from binding to proteins or other nucleic acids. For example The binding interactions between antisense RNAs (miRNAs, lncRNAs, sncRNAs) are described. In some embodiments, hybridization of the antisense agent with the target nucleic acid leads to regulation of the target nucleic acid translation. In some embodiments, hybridization of the oligomeric compound with the target nucleic acid causes an increase in the amount or activity of the target nucleic acid. In some embodiments, hybridization of the antisense oligonucleotide with the target nucleic acid leads to an increase in the translation of the target nucleic acid. In some embodiments, hybridization of the antisense oligonucleotide with the target nucleic acid leads to a decrease in the translation of the target nucleic acid.

[0284] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves the observation or detection of changes in the amount of target nucleic acid or the protein encoded by such target nucleic acid, changes in the ratio of nucleic acid or protein, and / or changes in the phenotype of cells or animals.

[0285] Some embodiments provide compositions and methods for reducing LPA RNA levels. Some embodiments provide compositions and methods for reducing apo(a) and / or Lp(a) levels. In some embodiments, reducing apo(a) levels in tissues, organs, and / or subjects improves the LDL / HDL ratio or the TG / HDL ratio. In some embodiments, a method is provided for modulating apo(a) expression in subjects using an oligomeric antisense agent targeting apo(a) nucleic acid. In some embodiments, apo(a) expression is reduced.

[0286] In some embodiments, inhibition of apo(a) or Lp(a) expression occurs in cells, tissues, or organs. In some embodiments, inhibition of apo(a) or Lp(a) occurs in cells, tissues, or organs in a subject. In some embodiments, inhibition is a decrease in apo(a) mRNA levels. In some embodiments, inhibition is a decrease in apo(a) protein levels. In some embodiments, both apo(a) mRNA and protein levels are decreased. In some embodiments, inhibition is a decrease in Lp(a) levels. This decrease may occur in a time-dependent or dose-dependent manner.

[0287] In some embodiments, methods for regulating LPA expression in cells or regulating apo(a) protein or Lp(a) include contacting cells with an oligoduplex comprising or consisting of an oligomeric compound containing a modified oligonucleotide having a target region complementary to the target region of the LPA nucleic acid. In some embodiments, methods for inhibiting LPA expression in cells or inhibiting apo(a) protein or Lp(a) protein include contacting cells with an oligoduplex comprising or consisting of an oligomeric compound containing a modified oligonucleotide having a nucleobase sequence complementary to the target region of the LPA nucleic acid. In some embodiments, the cells are hepatocytes.

[0288] In some embodiments, this document provides a method for inhibiting or reducing LPA expression, LPA RNA levels, and / or apo(a) protein or Lp(a) levels and / or activity in subjects who have or are at risk of having a disease, disorder, condition, or injury associated with LPA and / or apo(a) protein or Lp(a), such as a disease, disorder, condition, or injury associated with inflammatory cardiovascular disease. The method comprises administering to the subject an oligoduplex comprising or consisting of an oligoantisense agent containing a modified oligonucleotide targeting LPA nucleic acid, thereby inhibiting the expression of LPA nucleic acid in the subject. In some embodiments, the expression of LPA nucleic acid is inhibited. In some embodiments, the administration of the oligoduplex inhibits LPA expression, LPA RNA levels, and / or apo(a) protein or Lp(a) levels and / or activity in plasma / serum. In some embodiments, the administration of the oligoduplex inhibits or reduces LPA expression, LPA RNA levels, and / or apo(a) protein or Lp(a) levels and / or activity in the liver. In some embodiments, administration of such oligoduplexes inhibits or reduces LPA expression, LPA RNA levels, and / or apo(a) protein or Lp(a) levels and / or activity in the plasma / serum and liver of a subject. In some embodiments, the detectable amount of LPA RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, when the compound is administered to cells, tissues, and / or a subject, the oligonucleotide comprising or composed of a modified oligonucleotide is capable of reducing or reducing the detectable amount of apo(a) protein or Lp(a) in the cells, organs, or tissues of a subject, such as the liver, wherein the modified oligonucleotide comprises a target region complementary to the target region of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the detectable amount of apo(a) protein or Lp(a) may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0289] In some embodiments, the oligomeric antisense agent or the oligomeric duplex comprising therefrom has LPA RNA and / or apo(a) protein or Lp(a) reducing activity, and in a specific embodiment, has liver LPA RNA and / or apo(a) protein or Lp(a) reducing activity, which is comparable to or stronger than the LPA RNA and / or apo(a) protein or Lp(a) reducing activity of the comparator. In some embodiments, the comparator is a pharmaceutical agent comprising a comparatively modified oligonucleotide having a target region complementary to the target region of LPA. In some embodiments, the comparatively modified oligonucleotide is complementary to the modified oligonucleotide of the oligomeric compound to the same or similar target regions. In some embodiments, the comparatively modified oligonucleotide is complementary to the modified oligonucleotide of the oligomeric compound to different target regions. In some embodiments, compared to a control (e.g., cells, organs, tissues, systems, or subjects that have not been exposed to or treated with oligoduplexes, or have been exposed to or treated with a control substance (e.g., PBS), the amount of LPA RNA is reduced by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%) in cells (e.g., hepatocytes), organs (e.g., liver), or subjects (e.g., animals) that have been exposed to or treated with oligoduplexes (or compositions containing such oligoduplexes) provided herein. In some embodiments, the percentage reduction or decrease of LPA RNA in cells (e.g., cardiomyocytes), organs (e.g., heart), tissues, systems, or subjects (e.g., animals) exposed to or treated with the same concentration or dose of a comparative agent is greater than or less than 0.1% to 30%, greater than or less than 0.1% to 25%, greater than or less than 0.1% to 20%, greater than or less than 0.1% to 15%, greater than or less than 0.1% to 10%, or greater than or less than 0.1% to 5%, greater than or less than 0.1% to 1%, greater than 5% to 40%, greater than 5% to 35%, greater than 10% to 40%, greater than at least 5%, greater than at least 10%, greater than at least 15%, greater than at least 20%, greater than at least 25%, or greater than at least 30%.

[0290] B. Therapeutic indications and methods Despite the widespread use of therapies that lower low-density lipoprotein (LDL), atherosclerotic cardiovascular disease is very common and remains the leading cause of death worldwide. Although LDL-lowering therapies reduce the risk of major cardiac events, residual cardiovascular risk experienced by some patients with low LDL levels suggests other mechanisms of cardiovascular pathology. Over the past decade, compelling evidence from epidemiological studies and meta-analyses, Mendelian randomization studies, and genome-wide association studies has shown that elevated serum Lp(a) concentrations are associated with a higher risk of coronary artery disease and atherosclerosis-related disorders (Clarke et al., N. Engl. J. Med., Vol. 361: 2518-2528, 2009; Kamstrup et al., JAMA, Vol. 301: 2331-2339, 2009; Nordestgaard et al., European Heart Journal, Vol. 31: 2844-2853, 2010; Helgadottir et al., J. Am. Coll. Cardiol., Vol. 60: 722-729, 2012; Thanassoulis et al., J. Am. Coll. Cardiol., Vol. 55: 2491-2498, 2010; Kamstrup et al., J. Am.). (Coll. Cardiol., Vol. 63: 470-477, 2014; Kral et al., Journal of Cardiology, Vol. 118: 656-661, 2016; Thanassoulis et al., J. Lipid Res., Vol. 57: 917-924, 2016; Tsimikas et al., J. Am. Coll. Cardiol., Vol. 69: 692-711, 2017). Notably, this risk relationship is continuous and becomes more influential with increasing Lp(a) levels, and persists after adjusting for other lipid parameters (Emerging Risk Factors Collaboration, JAMA, Vol. 302: 412-423, 2009). LPA gene mutations can increase LPA RNA levels, leading to abnormal apo(a) cleavage, resulting in increased or decreased degradation and clearance of apo(a) levels (and Lp(a) levels), and / or abnormal interactions between Lp(a) and other proteins or other endogenous or exogenous substances (such as plasminogen receptors), causing increased Lp(a) levels or decreased degradation. Conditions associated with high Lp(a) levels may be relatively insensitive to lifestyle changes and common statin medications, and therefore difficult to treat.

[0291] Subjects with high Lp(a) levels are at significant disease risk (Lippi et al., ClinicaChimica Acta, 2011, 412:797-801; Solfrizz et al.). For example, subjects with Lp(a) levels greater than ≥ 75 nmol / L or ≥ 30 mg / dL are considered to have an increased risk of various diseases. In many subjects with high Lp(a) levels, current treatments are unable to reduce Lp(a) levels to a safe level. Apo(a) plays an important role in the formation of Lp(a), therefore reducing apo(a) can reduce Lp(a) and prevent, treat, or improve Lp(a)-related diseases. In some embodiments, treatment using the oligodimers and methods provided herein is suitable for subjects with elevated apo(a) and / or Lp(a) levels. In some embodiments, the subject had an apo(a) level of ≥ 10 mg / dL, ≥ 20 mg / dL, ≥ 30 mg / dL, ≥ 40 mg / dL, ≥ 50 mg / dL, ≥ 60 mg / dL, ≥ 70 mg / dL, ≥ 80 mg / dL, ≥ 90 mg / dL, or ≥ 100 mg / dL. In some embodiments, subjects had Lp(a) levels of ≥ 10 mg / dL, ≥ 15 mg / dL, ≥ 20 mg / dL, ≥ 25 mg / dL, ≥ 30 mg / dL, ≥ 35 mg / dL, ≥ 40 mg / dL, ≥ 50 mg / dL, ≥ 60 mg / dL, ≥ 70 mg / dL, ≥ 80 mg / dL, ≥ 90 mg / dL, ≥ 100 mg / dL, ≥ 110 mg / dL, ≥ 120 mg / dL, ≥ 130 mg / dL, ≥ 140 mg / dL, ≥ 150 mg / dL, ≥ 160 mg / dL, ≥ 170 mg / dL, ≥ 175 mg / dL, ≥ 180 mg / dL, ≥ 190 mg / dL, and ≥ 200 mg / dL.In some embodiments, the subject has an apo(a) level higher than the upper limit of normal, for example, the subject has an apo(a) level ≥ 30 mg / dL, ≥ 35 mg / dL, ≥ 40 mg / dL, ≥ 50 mg / dL, ≥ 60 mg / dL, ≥ 70 mg / dL, ≥ 80 mg / dL, ≥ 90 mg / dL, ≥ 100 mg / dL, ≥ 110 mg / dL, ≥ 120 mg / dL, ≥ 130 mg / dL, ≥ 140 mg / dL, ≥ 150 mg / dL, ≥ 160 mg / dL, ≥ 170 mg / dL, ≥ 175 mg / dL, ≥ 180 mg / dL, ≥ 190 mg / dL, or ≥ 200 mg / dL.

[0292] In some embodiments, this document provides methods for preventing, treating, delaying, or preventing the development or progression of a disease, disorder, symptom, or injury associated with increased levels of LPA and / or apo(a) protein or Lp(a), wherein the method comprises administering to a subject the oligodistrands described herein ( For example The invention comprises a modified oligonucleotide or an antisense oligomer compound thereof, wherein the modified oligonucleotide contains a target region complementary to the target region of the LPA nucleic acid. It also provides a method for improving, preventing, or delaying the onset of one or more symptoms associated with or related to diseases, disorders, conditions, or injuries of LPA or apo(a) protein and / or Lp(a), wherein the method comprises administering to a subject a modified oligonucleotide or an oligomer compound thereof having a nucleobase sequence complementary to the nucleobase sequence in the LPA nucleic acid.

[0293] Lp(a)-related conditions can be, for example, cardiovascular conditions, metabolic conditions, or inflammatory conditions. In some embodiments, Lp(a)-related conditions are inflammatory, cardiovascular, or metabolic diseases or disorders. In some embodiments, Lp(a)-related conditions or lipoprotein metabolic disorders are cardiometabolic disorders. In some embodiments, an oligomeric antisense agent described herein or an oligomeric duplex thereof is used to treat a subject suffering from cardiovascular disease (CVD) such as hypertriglyceridemia and / or other conditions selected from: lipemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapolipoprotein Bemia, chronic heart disease (including coronary artery disease [CAD]), or any symptom or condition related to CVD (e.g., hypercholesterolemia, e.g., statins). Drug-resistant hypercholesterolemia, heterozygous or homozygous familial hypercholesterolemia, myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina pectoris, peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular arteriosclerosis, cerebrovascular disease or stroke.

[0294] Therefore, in some embodiments, the method includes administering to a subject an oligomeric antisense agent or an oligomeric duplex thereof comprising a target region complementary to the target region of the LPA nucleic acid. In some embodiments, the subject has or is at risk of developing cardiovascular, metabolic, and / or inflammatory damage, disease, condition, or disorder. In some embodiments, the subject has or is at risk of developing cardiovascular disease (CVD) such as hypertriglyceridemia and / or other conditions selected from: lipemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapolipoprotein Bemia, chronic heart disease (including coronary artery disease [CAD]), or any symptom or condition associated with CVD (e.g., hypercholesterolemia, e.g., statin-resistant hypercholesterolemia). (Heterozygous or homozygous familial hypercholesterolemia), myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina pectoris, peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular arteriosclerosis, cerebrovascular disease, or stroke. In some embodiments, at least one symptom of cardiovascular injury, disease, condition, or disorder is improved. In some embodiments, at least one symptom is selected from, but is not limited to, angina pectoris, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle cramps, abdominal distension, and fever. In some embodiments, administration to a subject of an oligomeric antisense agent or oligomeric double strand thereof provided herein reduces or delays the onset or progression of at least one symptom of aortic stenosis.

[0295] Some embodiments provide compositions and methods for preventing, delaying, or slowing the progression of apo(a)-related diseases, disorders, and conditions in subjects of need. Some embodiments provide compositions and methods for improving apo(a)-related diseases, disorders, and conditions in subjects of need. Some embodiments provide compositions and methods for preventing, delaying, or slowing the progression of Lp(a)-related diseases, disorders, and conditions in subjects of need. Some embodiments provide compositions and methods for improving Lp(a)-related diseases, disorders, and conditions in subjects of need. In some embodiments, such diseases, disorders, and conditions include inflammatory, cardiovascular, and / or metabolic diseases, disorders, and conditions.

[0296] In some embodiments, a method is provided for treating an individual suffering from an apo(a)-related disease, disorder, or condition, the method comprising administering a therapeutically effective amount of one or more pharmaceutical compositions as described herein. In some embodiments, the individual has elevated apo(a) levels. In some embodiments, a method is provided for treating an individual suffering from an Lp(a)-related disease, disorder, or condition, the method comprising administering a therapeutically effective amount of one or more pharmaceutical compositions as described herein. In some embodiments, the individual has elevated Lp(a) levels. In some embodiments, the individual suffers from an inflammatory, cardiovascular, and / or metabolic disease, disorder, or condition. In some embodiments, the administration of a therapeutically effective amount of the oligodimethylsiloxane is accompanied by monitoring of apo(a) or Lp(a) levels. In some embodiments, the administration of the oligodimethylsiloxane is accompanied by monitoring for markers of inflammatory, cardiovascular, and / or metabolic diseases or other disease processes associated with apo(a) expression to determine the individual's response to the oligodimethylsiloxane. Physicians can use the individual's response to the administration of the oligodimethylsiloxane to determine the amount and duration of a therapeutic intervention using the oligodimethylsiloxane.

[0297] In some embodiments, this document provides a method of treating a subject, the method comprising administering one or more pharmaceutical compositions described herein. In some embodiments, the treatment method comprises administering an oligoduplex to inhibit or reduce the expression of LPA nucleic acids, such as RNA, in a subject suffering from or at risk of LPA-related diseases, injuries, conditions, or disorders, including administering to the subject an oligoduplex comprising or composed of a modified oligonucleotide having a targeting region complementary to a target region of the LPA nucleic acid, thereby inhibiting or reducing the expression of LPA nucleic acid in the subject. In some embodiments, the individual suffers from an apo(a)-related disease. In some embodiments, the individual suffers from an Lp(a)-related disease. In some embodiments, the individual suffers from an inflammatory, cardiovascular, and / or metabolic disease, condition, or disorder.

[0298] In some embodiments, a method of treating a subject includes administering to the subject an oligomeric duplex comprising or composed of an oligomeric antisense agent, the oligomeric antisense agent comprising or composed of a modified oligonucleotide having a targeting region complementary to the target region of an LPA nucleic acid, thereby treating the subject. In some embodiments, the subject has or is at risk of developing a cardiovascular, metabolic, and / or inflammatory disease or disorder. In some embodiments, administration of a therapeutically effective amount of the oligomeric duplex improves one or more symptoms of the subject's cardiovascular, metabolic, and / or inflammatory disease or disorder. In some embodiments, at least one symptom of the cardiovascular, metabolic, and / or inflammatory disease or disorder is improved. In some embodiments, administration to the subject of a pharmaceutical composition comprising the oligomeric duplex reduces or delays the onset or progression of at least one or more symptoms.

[0299] In some embodiments, cardiovascular diseases, disorders, or conditions include, but are not limited to, aortic stenosis, aneurysm (e.g., abdominal aortic aneurysm), angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral artery disease, peripheral artery occlusive disease), retinal vascular occlusion, stroke, elevated Lp(a)-related CVD risk, recurrent cardiovascular events with elevated Lp(a), and calcified aortic stenosis associated with high Lp(a). Some embodiments provide compositions and methods for preventing, delaying, or slowing the progression of aortic stenosis. Some embodiments provide compositions and methods for improving aortic stenosis.

[0300] In some embodiments, oligodichains modulate physiological markers or phenotypes of cardiovascular disease, disorder, or condition. For example, administration of oligodichains to a person can reduce Lp(a), LDL, and cholesterol levels compared to untreated subjects. In some embodiments, the modulation of physiological markers or phenotypes may be associated with the inhibition of apo(a) by the oligodichains. In some embodiments, the physiological markers of cardiovascular disease, disorder, or condition may be quantifiable. For example, Lp(a), LDL, or cholesterol levels can be measured and quantified by, for example, a standard lipid assay. For such markers, in some embodiments, the markers may be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or a range defined by any two of these values.

[0301] This document provides methods for treating symptoms associated with cardiovascular disease, disorder, or condition in subjects of need. In some embodiments, the treatment reduces the incidence of symptoms associated with cardiovascular disease, disorder, or condition. In some embodiments, the treatment results in a reduction in the severity of symptoms associated with cardiovascular disease or condition. Cardiovascular disease, disorder, or condition can be characterized by a variety of physical symptoms. Any symptoms associated with cardiovascular disease, disorder, or condition known to those skilled in the art can be prevented, treated, improved, or otherwise modulated using the compounds and methods described herein. In some embodiments, symptoms can be any of, but not limited to: angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle spasms, abdominal distension, or fever.

[0302] In some embodiments, the method of treating a subject includes administering to the subject an oligomeric antisense agent or an oligomeric duplex thereof having a target region complementary to the target region of an LPA nucleic acid, thereby treating the subject. In some embodiments, the subject has or is at risk of developing cardiovascular disease, such as atherosclerotic cardiovascular disease, atherosclerotic cerebrovascular disease, or hyperlipidemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles. In some embodiments, the treatment is for the prevention and / or reduction of the risk of and / or treatment of: stroke, atherosclerosis, thrombotic calcific aortic stenosis (such as calcific aortic stenosis), ischemic stroke, coronary artery disease, peripheral artery disease, abdominal aortic aneurysm, heart failure secondary to ischemic cardiomyopathy, or familial hypercholesterolemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles.

[0303] In some embodiments, treatment using oligomeric duplexes is for the prevention and / or reduction of the risk of and / or treatment of cardiovascular diseases such as coronary heart disease and any other disease or pathology associated with elevated levels of Lp(a)-containing particles. In some embodiments, treatment is for the prevention and / or reduction of the risk of and / or treatment of cardiovascular diseases such as atherosclerotic cardiovascular disease, atherosclerotic cerebrovascular disease, and hyperlipidemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles. In some embodiments, treatment is for the prevention and / or reduction of the risk of and / or treatment of stroke, atherosclerosis, thrombotic calcific aortic stenosis (such as calcific aortic stenosis), ischemic stroke, coronary artery disease, peripheral artery disease, abdominal aortic aneurysm, heart failure secondary to ischemic cardiomyopathy, or familial hypercholesterolemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles.

[0304] In some embodiments, treatment with the oligomeric duplex results in a reduced risk of cardiovascular events in patients with atherosclerotic cardiovascular disease. In some embodiments, cardiovascular events are cardiovascular death, myocardial infarction, stroke, and / or coronary revascularization. In some embodiments, the subject has a history of coronary revascularization, coronary artery bypass grafting, a diagnosis of coronary artery disease, a diagnosis of atherosclerotic cerebrovascular disease, a diagnosis of peripheral artery disease, and / or a history of myocardial infarction. In some embodiments, administration to the subject of a pharmaceutical composition comprising the oligomeric duplex reduces or delays the onset or progression of at least one of stroke, atherosclerosis, thrombotic calcific aortic stenosis such as calcific aortic stenosis, ischemic stroke, coronary artery disease, peripheral artery disease, abdominal aortic aneurysm, heart failure secondary to ischemic cardiomyopathy, or familial hypercholesterolemia, wherein the oligomeric duplex comprises or is composed of an oligomeric antisense agent. In some embodiments, administration to a subject of a pharmaceutical composition comprising an oligomeric duplex reduces or delays the onset or progression of at least one of the following: angina pectoris, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle spasms, abdominal distension, and fever, or combinations thereof, wherein the oligomeric duplex comprises or is composed of an oligomeric antisense agent.

[0305] In some embodiments, treatment using oligomeric duplexes is intended to improve one or more symptoms of cardiovascular diseases such as coronary heart disease and / or other diseases or pathologies associated with elevated levels of Lp(a)-containing particles. In some embodiments, the treatment is intended to improve symptoms associated with cardiovascular diseases such as coronary artery disease, carotid artery disease, peripheral artery disease, myocardial infarction, cerebrovascular disease, stroke, aortic stenosis, stable or unstable angina, atrial fibrillation, heart failure, hyperlipidemia, heterozygous familial hypercholesterolemia, or homozygous familial hypercholesterolemia. In some embodiments, the subject is diagnosed with or at risk of having cardiovascular disease, a diagnosed myocardial infarction, or acute coronary syndrome. In some embodiments, symptoms include, but are not limited to, angina pectoris, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle cramps, abdominal distension, and fever. Some embodiments provide a method for alleviating at least one symptom of aortic stenosis.

[0306] In some embodiments, administration to a subject of a pharmaceutical composition comprising an oligomeric duplex improves or reduces the onset or progression of symptoms of at least one or more of the following: stroke, atherosclerosis, thrombotic calcific aortic stenosis such as calcific aortic stenosis, ischemic stroke, coronary artery disease, peripheral artery disease, abdominal aortic aneurysm, heart failure secondary to ischemic cardiomyopathy, or familial hypercholesterolemia, wherein the oligomeric duplex comprises or is composed of an oligomeric antisense agent. In some embodiments, administration to a subject of a pharmaceutical composition comprising an oligomeric duplex improves one or more of the following symptoms: angina pectoris, chest pain, tachypnea, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle cramps, abdominal distension, and fever, or combinations thereof, wherein the oligomeric duplex comprises or is composed of an oligomeric antisense agent.

[0307] In some embodiments, metabolic diseases, disorders, or conditions include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, metabolic syndrome, and diabetic dyslipidemia.

[0308] In some embodiments, the oligodichain modulates physiological markers or phenotypes of metabolic diseases, disorders, or conditions. For example, administration of an oligodichain to a person can reduce glucose and insulin resistance levels in these subjects compared to untreated subjects. In some embodiments, the modulation of physiological markers or phenotypes may be associated with the inhibition of apo(a) by the oligodichain. In some embodiments, the physiological markers of metabolic diseases, disorders, or conditions may be quantifiable. For example, glucose levels or insulin resistance can be measured and quantified by standard tests known in the art. For such markers, in some embodiments, the marker may be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or a range defined by any two of these values. In another example, insulin sensitivity can be measured and quantified by standard tests known in the art. For such markers, in some embodiments, the markers may be increased by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or a range defined by any two of these values.

[0309] This document provides methods for treating symptoms associated with metabolic diseases, disorders, or conditions in subjects of need. In some embodiments, the treatment reduces the incidence of symptoms associated with metabolic diseases, disorders, or conditions. In some embodiments, the treatment reduces the severity of symptoms associated with metabolic diseases, disorders, or conditions. Metabolic diseases, disorders, or conditions can be characterized by a variety of physical symptoms. Any symptoms associated with metabolic diseases, disorders, or conditions known to those skilled in the art can be prevented, treated, improved, or otherwise modulated using the compounds and methods described herein. In some embodiments, symptoms can be any of, but not limited to, excessive urination (polyuria), excessive thirst and increased fluid intake (polydipsia), blurred vision, unexplained weight loss, and somnolence.

[0310] In some embodiments, inflammatory diseases, disorders, or conditions may overlap with cardiometabolic disorders or conditions, and include, but are not limited to, elevated Lp(a)-related CVD risk, recurrent cardiovascular events with elevated Lp(a), aortic stenosis (e.g., calcified aortic stenosis associated with high Lp(a), coronary artery disease (CAD), Alzheimer's disease, and thromboembolic diseases, disorders, or conditions. Certain thromboembolic diseases, disorders, or conditions include, but are not limited to, stroke, thrombosis, myocardial infarction, and peripheral vascular disease.

[0311] In some embodiments, oligodistrands modulate physiological markers or phenotypes of inflammatory diseases, disorders, or conditions. For example, administration of oligodistrands to a human may reduce levels of inflammatory cytokines or other inflammatory markers compared to untreated subjects. In some embodiments, the modulation of physiological markers or phenotypes may be associated with the inhibition of apo(a) by the oligodistrands. In some embodiments, the physiological markers of inflammatory diseases, disorders, or conditions may be quantifiable. For example, cytokine levels may be measured and quantified by standard tests known in the art. For such markers, in some embodiments, the marker may be reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or a range defined by any two of these values.

[0312] This article provides methods for treating symptoms associated with an inflammatory disease, disorder, or condition in subjects of need. In some embodiments, the treatment results in a reduction in the incidence of symptoms associated with the inflammatory disease, disorder, or condition. In some embodiments, the treatment results in a reduction in the severity of symptoms associated with the inflammatory disease, disorder, or condition.

[0313] In some embodiments, the oligoduplex exhibits greater LPA RNA and / or protein reducing activity (i.e., greater specificity) in target cell / organ / tissue / system (e.g., hepatocytes, liver) LPA than in non-target (e.g., plasminogen) LPA. For example, in some embodiments, application of the oligoduplex provided herein reduces the amount or activity of LPA RNA and / or protein by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to a control, and has no effect or negligible effect on the amount or activity of plasminogen (e.g., reduction in amount or activity).

[0314] In some embodiments, the application of the oligomeric duplex results in a reduction of LPA expression by at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or a range defined by any two of these values. In some embodiments, apo(a) expression is reduced to at least ≤ 100 mg / dL, ≤ 90 mg / dL, ≤ 80 mg / dL, ≤ 70 mg / dL, ≤ 60 mg / dL, ≤ 50 mg / dL, ≤ 40 mg / dL, ≤ 30 mg / dL, ≤ 20 mg / dL, or ≤ 10 mg / dL. In some embodiments, the application of the oligomeric duplex results in a reduction of apo(a) by at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or a range defined by any two of these values. In some embodiments, the number of Lp(a)-containing particles in serum is reduced to at least ≤ 200 mg / dL, ≤ 190 mg / dL, ≤ 180 mg / dL, ≤ 175 mg / dL, ≤ 170 mg / dL, ≤ 160 mg / dL, ≤ 150 mg / dL, ≤ 140 mg / dL, ≤ 130 mg / dL, ≤ 120 mg / dL, ≤ 110 mg / dL, ≤ 100 mg / dL, ≤ 90 mg / dL, ≤ 80 mg / dL, ≤ 70 mg / dL, ≤ 60 mg / dL, ≤ 55 mg / dL, ≤ 50 mg / dL, ≤ 45 mg / dL, ≤ 40 mg / dL, ≤ 35 mg / dL, ≤ 30 mg / dL, ≤ 25 mg / dL, ≤ 20 mg / dL, ≤ 15 mg / dL or ≤ 10 mg / dL.

[0315] In some embodiments, methods for preparing a medicament using oligomeric duplexes are provided. In some embodiments, a pharmaceutical composition comprising oligomeric duplexes is used to prepare a medicament for treating a patient suffering from or susceptible to inflammatory, cardiovascular and / or metabolic diseases, disorders, or conditions. In some embodiments, the subject suffers from or is at risk of developing cardiovascular disease (CVD) such as hypertriglyceridemia and / or other conditions selected from: lipemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapolipoprotein B hyperlipidemia, chronic heart disease (including coronary artery disease [CAD]), or any symptom or condition associated with CVD (e.g., hypercholesterolemia, e.g., statin-resistant hypercholesterolemia). (Heterozygous or homozygous familial hypercholesterolemia), myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina pectoris, peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular arteriosclerosis, cerebrovascular disease, or stroke. In some embodiments, at least one symptom of cardiovascular injury, disease, condition, or disorder is improved. In some embodiments, at least one symptom is selected from, but is not limited to, angina pectoris, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle cramps, abdominal distension, and fever. In some embodiments, the oligomeric double strands provided herein are administered to the subject. For example (Containing oligomeric antisense agents or oligomeric double chains thereof) reduces or delays the onset or progression of at least one symptom of aortic stenosis.

[0316] Some embodiments relate to an oligomeric duplex comprising or consisting of an oligomeric antisense agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to the target region of an LPA nucleic acid. This oligomeric duplex is used to manufacture or prepare a medicament for improving, delaying, or preventing the development or progression of a disease, disorder, condition, or injury and / or for improving, preventing, or delaying the onset of one or more symptoms of a disease, disorder, condition, or injury, wherein the disease, disorder, condition, or injury is associated with cardiovascular disease (CVD) such as hypertriglyceridemia and / or other conditions selected from: hyperlipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, etc. Leukemia, hyperapolipoprotein B hyperlipoproteinemia, chronic heart disease (including coronary artery disease [CAD]) or any symptoms or conditions related to CVD (such as hypercholesterolemia (e.g., statin-resistant hypercholesterolemia, heterozygous or homozygous familial hypercholesterolemia)), myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina pectoris, peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular arteriosclerosis, cerebrovascular disease, or stroke. In some embodiments, the disease is aortic stenosis. In some embodiments, the oligomeric bichain is used to manufacture or prepare a medicament for improving one or more symptoms selected from angina pectoris, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle spasm, abdominal distension, and fever.

[0317] In some embodiments, prophylactic administration of the oligomeric duplexes or compositions provided herein to subjects at risk of cardiovascular, metabolic, and / or inflammatory diseases can prevent, improve, delay, or postpone the development or progression of symptoms and / or the development of cardiovascular, metabolic, and / or inflammatory diseases. In some embodiments, the oligomeric duplexes are used to manufacture or prepare medicaments for improving angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, lower extremity swelling, cyanosis, fatigue, syncope, facial paralysis, limb paralysis, claudication or muscle spasms, abdominal distension, and fever.

[0318] In any method or use described herein, the oligodichain is any oligodichain described herein (e.g., an oligodichain containing or composed of an oligoantisense agent).

[0319] In some embodiments, the oligodichain is administered parenterally. In some embodiments, the oligodichain is administered intravenously, subcutaneously, intramuscularly, or intrathecally.

[0320] In some embodiments, the oligomeric duplex or composition is administered co-administered with a second agent or therapy. In some embodiments, the oligomeric duplex or composition is administered simultaneously with a second agent. In some embodiments, the second agent is a hypoglycemic agent. In some embodiments, the second agent is an LDL, TG, or cholesterol-lowering agent. In some embodiments, the second agent is an anti-inflammatory agent. In some embodiments, the second agent may be, but is not limited to, nonsteroidal anti-inflammatory drugs (NSAIDs, such as aspirin), niacin (such as sustained-release niacin), nicotinic acid, ezetimibe, apoB inhibitors (such as mipomycin), CETP inhibitors (such as acetaminophen), apo(a) inhibitors, thyroid hormone analogs (such as ilottilo), HMG-CoA reductase inhibitors (such as statins), fibrates (such as gemfibrozil), microsomal triglyceride transfer protein inhibitors (such as lometabine), PCSK9 inhibitors (such as inclisiran), and therapies under development, such as ANGPTL3 inhibitors and LPA inhibitors. In some embodiments, the therapy may be, but is not limited to, Lp(a) plasmapheresis. In some embodiments, the second agent is an Alzheimer's disease drug. Agents or therapies may be administered co-administered or simultaneously. Agents or therapies may be administered sequentially or subsequently.

[0321] VI. Pharmaceutical Compositions In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomeric duplexes or oligomeric compounds, wherein each oligomeric duplex or compound comprises a modified oligonucleotide (e.g., an oligomeric compound). In some embodiments, each of the one or more oligomeric duplexes or oligomeric compounds comprises an antisense agent. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds or duplexes or thereof. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more compounds or duplexes and sterile water or thereof. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more compounds or duplexes and phosphate-buffered saline (PBS) or thereof. In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pH of the solution is adjusted to a range of about 7.1 to 7.3 or to about 7.2 using a suitable pH adjuster (e.g., an acid, such as hydrochloric acid, and a base, such as sodium hydroxide).

[0322] In some embodiments, the pharmaceutical composition comprises an oligomeric duplex and sterile saline, the oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound. In some such embodiments, the pharmaceutical composition consists of the oligomeric duplex and sterile saline. In some embodiments, the pharmaceutical composition consists essentially of the oligomeric duplex and sterile saline. In some embodiments, the sterile saline is sterile PBS. In some embodiments, the sterile saline is pharmaceutical grade. In some embodiments, the pH of the solution is adjusted to a range of about 7.1 to 7.3 or to about 7.2 using a suitable pH adjuster (e.g., an acid, such as hydrochloric acid, and a base, such as sodium hydroxide).

[0323] In some embodiments, the pharmaceutical composition comprises one or more oligomeric duplexes and one or more excipients. In some embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0324] In some embodiments, the oligomeric duplex may be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and formulation of pharmaceutical compositions depend on many criteria, including but not limited to route of administration, disease severity, or dosage.

[0325] In some embodiments, a pharmaceutical composition comprising an oligomeric duplex comprises any pharmaceutically acceptable salt, compound, or ester of the duplex, or a salt of such a compound or ester. In some embodiments, upon administration to a subject (including a human), the pharmaceutical composition comprising an oligomeric compound or oligomeric duplex containing one or more oligomeric compounds is capable of providing (directly or indirectly) its biologically active metabolites or residues. Therefore, this disclosure also relates, for example, to pharmaceutically acceptable salts of oligomeric compounds or oligomeric duplexes, and other bioequivalents. In some embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.

[0326] In some embodiments, the oligomeric compound or oligomeric duplex is lyophilized and separated, for example, as a sodium salt. In some embodiments, the pharmaceutical preparation or sodium salt of the duplex is mixed with a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, or PBS. In some embodiments, the oligomeric compound or sodium salt of the oligomeric duplex is mixed with PBS.

[0327] Lipid moieties have been used in nucleic acid therapy in various ways. In some methods, nucleic acids (such as oligomeric compounds or oligomeric duplexes containing oligomeric compounds) are introduced into pre-formed liposomes or lipid complexes made from a mixture of cationic and neutral lipids. In some methods, nucleic acid complexes having mono- or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, the lipid moieties are selected to increase the distribution of drug compounds to specific cells or tissues. In some embodiments, the lipid moieties are selected to increase the distribution of drug compounds to adipose tissue. In some embodiments, the lipid moieties are selected to increase the distribution of drug compounds to muscle tissue.

[0328] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0329] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more compounds to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0330] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some of these cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is an absolute ethanol solution comprising 3% w / v benzyl alcohol, 8% w / v the nonpolar surfactant polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the cosolvent components can be varied: for example, other surfactants can be used instead of Polysorbate 80™; the fractional size of the polyethylene glycol can be varied; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace glucose.

[0331] In some embodiments, the pharmaceutical composition is prepared for administration of the oligomeric duplex to a subject. Suitable routes of administration include, but are not limited to, oral, rectal, mucosal, intestinal, enteric, topical, suppository, inhalation, intrathecal, intraventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intrathecal, intramedullary, and subcutaneous). In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some such embodiments, the pharmaceutical composition comprises a carrier or diluent and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or saline buffer. In some embodiments, other components are included (e.g., components that contribute to solubility or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, diluent, suspending agent, etc. Some injectable pharmaceutical compositions are present in a single dosage form, such as an ampoule or a multi-dose container. Some injectable pharmaceutical compositions are oily or aqueous media containing suspensions, solutions, or emulsions, and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Suitable solvents for injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0332] Under certain conditions, some of the compounds disclosed herein act as acids. Although such compounds may be drawn or described as protonated (free acid) or ionized and associated with cations (salts), aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphodiester bonds of oligonucleotides in aqueous solutions exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise stated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have multiple such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in multiple forms at multiple locations, all in equilibrium. The term "oligonucleotide" as used herein is intended to include all such forms. The drawn structures necessarily depict a single form. However, unless otherwise stated, such figures are also intended to include corresponding forms. In this document, the description of a compound's free acid structure followed by the term "or a pharmaceutically acceptable salt thereof" explicitly includes all such forms that can be fully or partially protonated / deprotonated / associated with cations or combinations of cations. In some embodiments, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In some embodiments, the description of the structure of the free acid of the compound and the subsequent term "or a pharmaceutically acceptable salt thereof" explicitly includes all such forms that can be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0333] In some embodiments, the oligomeric compound or oligodichain is present in an aqueous solution containing sodium. In some embodiments, the oligomeric compound or oligodichain is present in an aqueous solution containing potassium. In some embodiments, the oligomeric compound or oligodichain is present in PBS. In some embodiments, the oligomeric compound or oligodichain is present in water. In some such embodiments, the pH of the solution is adjusted to the desired pH using NaOH and / or HCl.

[0334] In this document, dosage may be in the form of dosage units. For clarity, the dosage (or dosage unit) of an agent (e.g., oligomer, oligodimer, antisense agent) in milligrams indicates the mass of the free acid form of the compound. As described herein, in aqueous solutions, the free acid is in equilibrium with its anionic and salt forms. However, for the purpose of dosage calculation, it is assumed that the compound (e.g., oligomer, oligodimer, antisense agent) exists as a solvent-free, sodium acetate-free, anhydrous free acid. In some embodiments, when the agent (e.g., oligomer, oligodimer, antisense agent) is present in a solution containing sodium (e.g., saline solution), the compound may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons is still included in the weight of the dosage, and the mass of the sodium ions is not included in the weight of the dosage. When the agent contains a conjugate group, the mass of the conjugate group is included in the dosage calculation of such compounds. If the conjugate group also has an acid component, it is also assumed that the conjugate group is fully protonated for the purpose of dosage calculation.

[0335] Unrestricted disclosure and incorporation by reference The chapter titles used in this article are for organizational purposes only and should not be construed as limiting the topics described herein.

[0336] All documents, websites, URLs, or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby expressly incorporated herein by reference in whole or in part.

[0337] While certain compounds, compositions, and methods described herein have been specifically described with reference to some embodiments, the following examples are for illustrative purposes only and are not intended to limit the scope of the compounds described herein. Each of the references, GenBank accession numbers, ENSEMBL identifiers, etc., listed in this application is incorporated herein by reference in its entirety.

[0338] Although the sequence listing accompanying this application identifies each sequence as “RNA” or “DNA” as needed, in practice, these sequences can be modified by any combination of chemical modifications. Those skilled in the art will readily understand that such nomenclature, such as “RNA” or “DNA,” used to describe modified oligonucleotides, is arbitrary in some cases. For example, an oligonucleotide containing a nucleoside (which contains a 2'-OH sugar moiety and a thymine base) can be described as DNA having a modified sugar (2'-OH replacing one 2'-H of DNA) or as RNA having a modified base (thymine replacing uracil in RNA (methylated uracil)). Therefore, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of native or modified RNA and / or DNA, including but not limited to such nucleic acids having modified nucleobases. As a further example and without limitation, oligonucleotides having the nucleobase sequence “ATCGATCG” encompass any oligonucleotide having such a nucleobase sequence, whether modified or unmodified, including but not limited to compounds containing RNA bases, such as compounds having the sequence “AUCGAUCG” and compounds having some DNA bases and some RNA bases (such as “AUCGATCG”); and compounds having other modified nucleobases (such as “AT”). m "CGAUCG", among which m C represents an oligonucleotide containing a cytosine base with a methyl group at the 5-position.

[0339] Some of the compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, and thus produce enantiomers, diastereomers, and compounds that can be defined in absolute stereochemistry as ( R )or( S Other stereoisomers, such as (α) or (β) (as for sugar telomere isomers) or (D) or (L) (as for amino acids), are included. The compounds presented herein drawn or described having certain stereoisomers include only those shown. Unless otherwise stated, the compounds presented herein drawn or described in undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Similarly, unless otherwise stated, tautomer forms of the compounds are also included. Unless otherwise stated, the compounds described herein are intended to include their corresponding salt forms.

[0340] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the element shown. For example, compounds containing hydrogen atoms are covered herein. 1All possible deuterium substitutions of the H hydrogen atom. Isotopic substitutions covered in the compounds described herein include, but are not limited to: 2 H or 3 H replaces 1 H, 13 C or 14 C replaces 12 C, 15 N replaces 14 N, 17 O or 18 O replaces 16 O, and 33 S, 34 S, 35 S or 36 S replaces 32 S. In some embodiments, non-radioactive isotope substitution can endow oligomeric compounds with new properties beneficial for use as therapeutic or research tools. In some embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging.

[0341] example The following examples illustrate certain embodiments of this disclosure and are not limiting. Furthermore, in providing specific embodiments, the inventors have considered the general application of those specific embodiments. For example, the disclosure of oligonucleotides having a specific motif provides reasonable support for additional oligonucleotides having the same or similar motifs, and, for example, in the case where a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are considered appropriate, unless otherwise stated.

[0342] Example 1: Design of Oligomeric Compounds The oligomer design includes an antisense oligomer complementary to human LPA nucleic acid and a sense oligomer complementary to the antisense oligomer, as follows.

[0343] Design of antisense oligomers The antisense oligomers were prepared as described in Table 1. Each antisense oligomer has a glycosidic motif (from 5' to 3') as indicated, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents a 2'-OMe sugar motif, each 'f' represents a 2'-F sugar motif, each '[FHNA]' represents a 3'-fluoro-hexitol sugar motif, and each 'd' represents a 2'-deoxy sugar motif; and each antisense oligomer has a nucleoside internucleotide motif (from 5' to 3') as indicated, wherein each 'o' represents a phosphodiester nucleoside internucleotide bond, and each 's' represents a thiophosphate nucleoside internucleotide bond. Each antisense oligomer has a vinylphosphonate (VP-) motif at its 5' end. Each antisense oligomer is complementary to SEQ ID NO: 1 (GenBank accession number NC_000006.12, truncated from nucleosides 160528001 to 160669000) or SEQ ID NO: 2 (GenBank accession number NM_005577.2) or both. Due to the nature of the target LPA sequence, the oligonucleotide can bind to multiple sites within SEQ ID NO: 1 and / or SEQ ID NO: 2. The CPD SID indicates the SEQ ID NO: of the relevant compound, including annotations such as glycosylation and internucleotide motifs; and the nb SID indicates the SEQ ID NO: of the nucleobase sequence of the relevant compound.

[0344] Table 1: Antisense oligomers targeting human LPA Design of meaningful oligomers The modified sense oligomers were prepared as described in Table 2. Each sense oligomer has a glycosyl motif (from 5' to 3') as indicated, wherein each 'y' represents a 2'-OMe glycosyl motif, each 'e' represents a 2'-MOE glycosyl motif, and each 'f' represents a 2'-F glycosyl motif; and an internucleotide motif (from 5' to 3') as indicated, wherein each "o" represents a phosphodiester internucleotide bond, and each "s" represents a thiophosphate internucleotide bond. Each sense oligomer is complementary to the antisense oligomers in Table 1. The CPD SID indicates the SEQ ID NO: of the relevant compound, including annotations such as the glycosyl motif and the internucleotide motif; and the nb SID indicates the SEQ ID NO: of the nucleobase sequence of the relevant compound.

[0345] As indicated in the conjugate list in Table 2, certain sense oligomers contain sense-modified oligonucleotides partially conjugated to GalNAc. In some compounds, the HPPO-GalNAc phosphoryl conjugate group is attached to the 3'-OH of the oligonucleotide (designated as 3' GalNAc in Table 2); and in other compounds, the THA-GalNAc phosphoryl conjugate group is attached to the 5'-OH of the oligonucleotide (designated as 5' GalNAc in Table 2).

[0346] The structure of the HPPO-GalNAc phosphoryl conjugate group is: HPPO-GalNAc phosphoryl conjugate.

[0347] The structure of the THA-GalNAc phosphoryl conjugate group is: THA-GalNAc phosphoryl conjugate.

[0348] Table 2: Significant Oligomeric Compounds Example 2: Design of oligomeric duplexes targeting human LPA The oligomeric duplexes prepared using the antisense oligomeric compound number and the corresponding sense oligomeric compound number are listed in Table 3.

[0349] Table 3: Oligomeric duplexes targeting human LPA Example 3: Effects of targeting the oligomeric duplex of human LPA in primary human hepatocytes In a series of experiments with the same culture conditions, in vitroThe single-dose effect of oligoduplex on LPA RNA was tested. Primary human hepatocytes (from BioIVT, M0095-P, batch ZFW) were treated with oligoduplex at concentrations of 100 nM or 5,000 nM via free uptake at a density of 20,000 cells per well. After a 72-hour treatment period, total RNA was isolated from the cells and LPA RNA levels were measured by quantitative real-time RT-PCR using the human primer-probe set hAPO(a)12kB (forward sequence CCACAGTGGCCCCGGT, designated SEQ ID NO: 3; reverse sequence ACAGGGCTTTTCTCAGGTGGT, designated SEQ ID NO: 4; probe sequence CCAAGCACAGAGGCTCCTTCTGAACAAG, designated SEQ ID NO: 5). LPA RNA levels were normalized relative to total RNA levels as measured by RIBOGREEN®. The reduction in LPA RNA is presented in the table below as a percentage of LPA RNA (% UTC) relative to the amount of LPA RNA in untreated control cells. Values ​​marked with "†" indicate the amplicon region of the oligoduplex-targeting primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region. Each individual experiment described in this example is presented in separate subtables 4A through 4K.

[0350] Table 4: Effects of oligoduplexes on human LPA RNA in primary human hepatocytes Example 4: Effects of oligomeric duplexes in transgenic primary mouse hepatocytes In a series of experiments with the same culture conditions, in vitro The single-dose effect of oligoduplexes on LPA RNA was tested. Each individual experiment is presented in a separate column in Table 5 below. (From a previous description by Frazer K...) et al. , Theapolipoprotein (a) gene is regulated by sex hormones and acute-phase inducersin YAC transgenic mice; Nature Genetics , 1995, 9Primary hepatocytes were isolated from transgenic mice in 424-431. Transgenic primary mouse hepatocytes were treated with oligoduplexes at a concentration of 500 nM (Tables 5A and 5B) or 5000 nM (Table 5C) at a density of 15,000 cells per well via free uptake. After a 24-hour treatment period, total RNA was isolated from the cells, and LPA RNA levels were measured by quantitative real-time RTPCR using the human primer-probe set hAPO(a)12kB (described above herein). LPA RNA levels were normalized relative to total RNA content as measured by RIBOGREEN®. The reduction in LPA RNA is presented as a percentage of LPA RNA (% UTC) relative to the amount of LPA RNA in untreated control cells in the table below. Values ​​marked with “†” indicate the amplicon region of the oligoduplex-targeted primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region. Each individual experiment described in this example is presented in a separate column in Table 5 below. Example 5: Dose-dependent inhibition of human LPA in primary human hepatocytes The oligodistrands selected from Example 4 were tested in primary human hepatocytes at various doses. The oligodistrands were tested in a series of experiments under the same culture conditions, and the results are described in Table 6, with different experiments in each of subtables 6A to 6I.

[0351] Primary human hepatocytes (from BioIVT, M0095-P, batch ZFW) seeded at a density of 20,000 cells per well were treated with modified oligonucleotides at various concentrations specified in Table 6 using free uptake. After treatment periods of 48 or 72 hours, total RNA was isolated from the cells, and LPA RNA levels were measured by quantitative real-time RT-PCR. RNA levels as described above were measured using the human LPA primer-probe set hAPO(a)12kB (described above herein). LPA RNA levels were normalized relative to total RNA content as measured by RIBOGREEN®. The reduction in LPA RNA is presented in Table 6 as a percentage of LPA RNA (% UTC) relative to the amount of LPA RNA in untreated control cells. “NC” represents IC50 that could not be reliably calculated. 50Value. Half-maximum inhibitory concentration (IC50) of each modified oligonucleotide. 50 The linear regression of the log / linear graph of the data was used for calculation and is also presented in Table 6.

[0352] Table 6: Dose-dependent decrease in human LPA RNA in primary human hepatocytes Example 6: Dose-dependent inhibition of human LPA in transgenic primary mouse hepatocytes The oligomeric duplexes selected from Example 5 were tested at various doses in transgenic primary mouse hepatocytes. (From a previous description in Frazer K...) et al. , The apolipoprotein (a) gene is regulated by sex hormones and acute-phase inducers in YAC transgenic mice; Nature Genetics , 1995, 9 Primary hepatocytes were isolated from transgenic mice in :424-431. Oligomeric duplexes were tested in a series of experiments under the same culture conditions (presented in separate sub-tables 7A to 7B).

[0353] Transgenic primary hepatocytes seeded at a density of 20,000 cells per well were treated with modified oligonucleotides at various concentrations specified in the table below, allowing free uptake. After a 24-hour treatment period, total RNA was isolated from the cells, and LPA RNA levels were measured by quantitative real-time RT-PCR. RNA levels as described above were measured using the human LPA primer-probe set hAPO(a)12kB (described above in this document). LPA RNA levels were normalized relative to total RNA content as measured by RIBOGREEN®. The reduction in LPA RNA is presented in the table below as a percentage of LPA RNA (% UTC) relative to the amount of LPA RNA in untreated control cells. The half-maximum inhibitory concentration (IC50) of each modified oligonucleotide is also shown. 50 The linear regression of the log / linear graph of the data was used for calculation and is also presented in Table 7.

[0354] Table 7: Dose-dependent reduction of human LPA RNA in transgenic primary mouse hepatocytes Example 7: Activity of LPA-targeting oligomeric duplexes in LPA transgenic mice The oligomeric duplexes selected from the above studies were analyzed together with comparative compounds to determine their effects on LPA mRNA and Lp(a) protein in human LPA transgenic mice.

[0355] The previously described LPA transgenic mouse (described in Frazer K) et al. , The apolipoprotein (a)gene is regulated by sex hormones and acute-phase inducers in YAC transgenicmice; Nature Genetics , 1995, 9 (424-431) was obtained by Taconic Biosciences and treated with selected oligodimers, and its activity was evaluated.

[0356] The double-stranded compound prepared as a comparative compound, number 1787751, includes antisense compound number 1758680 and sense compound number 1758681. Antisense compound number 1758680 (SEQ ID NO: 3076) has the nucleobase sequence UCGUAUAACAAUAAGGGGCUG (from 5' to 3'); the glycosyl motif yfyfyfyyyyfyfyfyfyfy (from 5' to 3'); and the nucleotide internucleotide motif ssoooooooooooooooooooss (from 5' to 3'); and sense compound number 1758681 (SEQ ID NO: 3077) has the nucleobase sequence CAGCCCCUUAUUGUUAUACGA (from 5' to 3'); the glycosyl motif yyyyyyyyyyyyyyyy (from 5' to 3') and the nucleotide internucleotide motif sooooooooooooooooooos (from 5' to 3'); wherein each "y" represents a 2'-OMe sugar motif, and each "f" represents a 2'-F sugar motif, and wherein each "s" represents a thiophosphate nucleotide internucleotide bond, and each "o" represents a phosphodiester nucleotide internucleotide bond. The semantic oligonucleotide compound number 1758681 has... via Phosphophosphate esters are conjugated to the 5' end of the oligonucleotide, forming the THA-GalNAc moiety. THA-GalNAc thiophosphate.

[0357] Double-stranded compound 1787751 is similar to compound AD03851 (a double-stranded compound targeting LPA, previously disclosed in international patent application WO 2017 / 059223), but differs from AD03851 in two ways: first, 1787751 contains a THA-GalNAc conjugate (as described herein) at the 5' end of its semantic oligonucleotide, while AD03851 contains a NAG25 conjugate; and second, 1787751 contains a 2'-OMe sugar moiety at the 3' end of its semantic oligonucleotide, while AD03851 contains a reverse 2'-deoxyribosyl sugar moiety modification at the 3' end of its semantic oligonucleotide. As previously described. via The NAG25 phosphate thioester moiety, which is conjugated to the 5' end of the oligonucleotide, is shown below: NAG25 thiophosphate.

[0358] Two groups of female LPA transgenic mice each received a single subcutaneous injection of the oligodistranded compound at a dose of 2 mg / kg. A group of three female LPA transgenic mice received a single subcutaneous injection of PBS. Seven days post-injection, the mice were sacrificed and RNA was extracted from liver tissue for quantitative real-time RT-PCR analysis of LPA RNA using the human primer and probe set hAPO(a)12kBTS (as described in Example 3). LPA RNA levels were normalized relative to total RNA content as measured by RIBOGREEN®. The reduction in LPA RNA was expressed as a percentage of LPA RNA relative to the amount of LPA in tissues from PBS control animals (%control).

[0359] To assess the effect of the oligodimethylsiloxane compound on apo(a) protein levels, plasma was collected from mice euthanized on days 1 and 7 before treatment and analyzed using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Apo(a) protein levels were analyzed using an Lp(a) assay kit from Randox (catalog number LP2757). Results for each group of mice were averaged and presented in the table below as a percentage of apo(a) present relative to baseline (%baseline).

[0360] Table 8: Decreased LPA levels in LPA transgenic mice Table 9: Decreased LPA levels in LPA transgenic mice Table 10: Decreased LPA levels in LPA transgenic mice Table 11: Decreased LPA levels in LPA transgenic mice

Claims

1. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound, wherein: The first oligomer compound comprises a first modified oligonucleotide consisting of 18 to 50 linked nucleosides, wherein the nucleobase sequence comprises at least 80% identical nucleobase sequences of at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleosides to any of SEQ ID NO: 6 to 829 and 3078 to 3083, wherein at least 22%, no more than 20%, no more than 18%, no more than 15%, no more than 10%, or no more than 5% of the modified nucleosides in the first modified oligonucleotide comprises a 2'-F sugar moiety and / or an FHNA sugar substitute, and The second oligomer compound comprises a second modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence comprises at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleosides that are at least 80% identical to the nucleobase sequence of any one of SEQ ID NO: 830 to 1540 and 3096 to 3101, wherein at least one, but not more than 25%, not more than 20%, not more than 18%, not more than 16%, not more than 14%, not more than 12%, or not more than 10% of the modified nucleosides in the second modified oligonucleotide comprises a 2'-F sugar moiety and / or an FHNA sugar substitute; The first modified oligonucleotide and the second modified oligonucleotide are complementary to each other; and Each of the first modified oligonucleotide and the nucleoside of the second modified oligonucleotide independently comprises a modified sugar moiety or a sugar substitute.

2. The oligomeric duplex according to claim 1, 1) wherein the first modified oligonucleotide comprises at least one and no more than four modified nucleosides, the modified nucleosides comprising a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute, and / or wherein the second modified oligonucleotide comprises at least one and no more than four modified nucleosides, the modified nucleosides comprising a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute; and / or wherein the oligodistrand comprises at least one and no more than eight modified nucleosides, the modified nucleosides comprising a modified sugar moiety or sugar substitute, the modified sugar moiety or sugar substitute comprising a 2'-F sugar moiety and / or an FHNA sugar substitute; and / or 2) wherein at least 18 nucleotides of the first modified oligonucleotide and at least 16 nucleotides of the second modified oligonucleotide each independently comprise a modified sugar moiety or sugar substitute selected from the 2'-F sugar moiety, the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, the DNA sugar moiety, and the FHNA sugar substitute; and / or 3) wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of SEQ ID NO: 6 to 829 and 3078 to 3083, and wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of any of SEQ ID NO: 830 to 1540 and 3096 to 3101.

3. The oligoduplex according to claim 1 or claim 2, wherein the first modified oligonucleotide comprising a modified sugar moiety or sugar substitute containing a 2'-F sugar moiety or an FHNA sugar substitute is independently selected from one of the following: i. The second nucleotide, counted from the 5' end. ii. The second and fourteenth nucleotides counted from the 5' end, or iii. The second and sixteenth nucleotides counted from the 5' end, or iv. Nucleosides numbered from the 5' end, specifically the second, fourteenth, and sixteenth nucleotides, or v. The second, sixth, fourteenth, and sixteenth nucleotides, counted from the 5' end.

4. The oligoduplex according to any one of claims 1 to 3, wherein the second modified oligonucleotide comprising a modified sugar moiety or sugar substitute containing a 2'-F sugar moiety and / or an FHNA sugar substitute is independently selected from one of the following: i. The ninth and tenth nucleotides counted from the 5' end, or ii. The tenth and eleventh nucleotides counted from the 5' end, or iii. The ninth, tenth, and eleventh nucleotides counted from the 5' end, or iv. The seventh, ninth, tenth, and eleventh nucleotides counted from the 5' end, or v. The seventh, ninth, and eleventh nucleotides counted from the 5' end.

5. The oligoduplex according to any one of claims 1 to 4, wherein one of the modified nucleosides of the first modified oligonucleotide containing a 2'-F sugar moiety and / or an FHNA sugar substitute comprises a 3'-fluoro-hexitol sugar moiety sugar substitute.

6. The oligoduplex according to any one of claims 1 to 4, wherein one or more nucleosides of the first modified oligonucleotide are 2'-deoxynucleosides.

7. The oligoduplex of claim 6, wherein the one or more 2'-deoxynucleosides are one or more nucleosides in the sequence of the first modified oligonucleotide, between the fifth to the sixteenth nucleosides counted from the 5' end of the first modified oligonucleotide, and including the region of the fifth to the sixteenth nucleosides.

8. The oligoduplex of claim 7, wherein the one or more 2'-deoxynucleosides are any one of the sixth, fourteenth and / or sixteenth nucleosides counted from the 5' end of the first modified oligonucleotide.

9. The oligoduplex according to any one of claims 1 to 8, wherein two of the 3' terminal nucleosides of the first modified oligonucleotide comprise two nucleoside overhangs.

10. The oligomeric duplex according to claim 9, wherein the pendant nucleoside comprises two modified adenosine (AA), two modified uridine (UU) nucleosides, two modified inosine (II) nucleosides, or two modified nucleosides, one of which is inosine and the other is adenosine (AI or IA).

11. The oligoduplex according to any one of claims 1 to 10, wherein one or more nucleosides of the first modified oligonucleotide comprise a 2'-OMe sugar moiety, and wherein one or more nucleosides of the second modified oligonucleotide comprise a 2'-OMe sugar moiety.

12. The oligodichain of claim 11, wherein at least thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen nucleotides of the first modified oligonucleotide comprise a 2'-OMe sugar moiety; and The first modified oligonucleotide contains at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen nucleotides containing a 2'-OMe sugar moiety.

13. The oligoduplex according to any one of claims 1 to 12, wherein one or more of the nucleosides of the first modified oligonucleotide comprise a 2'-MOE sugar moiety; and Optionally, one or more of the nucleosides in the second modified oligonucleotide contain a 2'-MOE sugar moiety.

14. The oligoduplex of claim 13, wherein the 5'- and / or 3'-terminal nucleoside of the first modified oligonucleotide comprises a 2'-MOE sugar moiety; and optionally, the 5'- and / or 3'-terminal nucleoside of the second modified oligonucleotide comprises a 2'-MOE sugar moiety.

15. The oligoduplex of claim 14, wherein two of the 5'-terminal nucleotides and / or two of the 3'-terminal nucleotides of the first modified oligonucleotide comprise a 2'-MOE sugar moiety; and optionally, two of the 5'-terminal nucleotides and / or two of the 3'-terminal nucleotides of the second modified oligonucleotide comprise a 2'-MOE sugar moiety.

16. The oligoduplex of claim 13, wherein at least one nucleotide of the first modified oligonucleotide comprising the 2'-MOE sugar moiety is an internal nucleotide in the region of the sequence of the first modified oligonucleotide, in any of the ninth and / or tenth nucleotides counted from the 5' end of the first modified oligonucleotide.

17. The oligomeric duplex according to any one of claims 1 to 16, wherein the first oligomeric compound comprises a stabilized phosphate group attached to the 5'-terminal nucleoside.

18. The oligomeric duplex of claim 17, wherein the stabilized phosphate group comprises methylene phosphonate, cyclopropyl phosphonate, or vinyl phosphonate.

19. The oligoduplex according to any one of claims 1 to 18, wherein the first modified oligonucleotide and / or the second modified oligonucleotide comprises at least one modified nucleoside interstrand.

20. The oligomeric duplex according to claim 19, wherein at least one modified nucleoside interchain is a thiophosphate nucleoside interchain.

21. The oligomeric duplex according to claim 20, wherein each nucleoside interchain is independently selected from phosphate diester nucleoside interchains and thiophosphate nucleoside interchains.

22. The oligomeric duplex of claim 21, wherein the internucleotide bonds between the first and second nucleosides, counted from the 5' end of the first modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds, and / or wherein the internucleotide bonds between the first and second nucleosides, counted from the 3' end of the first modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds; and Optionally, the internucleotide bonds between the first and second nucleosides, counted from the 5' end of the second modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds, and / or the internucleotide bonds between the first and second nucleosides, counted from the 3' end of the second modified oligonucleotide, and between the second and third nucleosides, are modified internucleotide bonds.

23. The oligomeric duplex of claim 1, wherein the first modified oligonucleotide comprises a modified glycosyl motif independently selected from one of efyyyfyyyyyyyyyfyfyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyyee, e[FHNA]yyyfyyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyyyyfyfyyyyyee, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents the 2'-OMe sugar moiety, each 'f' represents the 2'-F sugar moiety, each '[FHNA]' represents the 3'-fluoro-hexitol sugar moiety, and each 'd' represents the 2'-deoxy sugar moiety, and all of them are identical to the glycomolecular motif except for 0, 1, or 2 modifications; and / or the second modified oligonucleotide contains a modified glycomolecular motif independently selected from yyyyyyfyfffyyyyyyyyy and eeyyyyyyyffyyyyyyyee, wherein each 'e' represents the 2'-MOE sugar moiety, each 'y' represents the 2'-OMe sugar moiety, and each 'f' represents the 2'-F sugar moiety, and all of them are identical to the glycomolecular motif except for 0, 1, or 2 modifications.

24. The oligomeric duplex of claim 1, wherein the first modified oligonucleotide comprises a modified sugar independently selected from one of efyyyfyyyyyyyyyfyfyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyyydydyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyyfyfyyyyyee, e[FHNA]yyyfyyyyyyyfyfyyyyyee and e[FHNA]yyyfyyyyfyfyyyyyee The motif, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents a 2'-OMe sugar motif, each 'f' represents a 2'-F sugar motif, each '[FHNA]' represents a 3'-fluoro-hexitol sugar motif, and each 'd' represents a 2'-deoxy sugar motif; and / or the second modified oligonucleotide comprises a modified sugar motif independently selected from one of yyyyyyfyfffyyyyyyyyy and eeyyyyyyyyffyyyyyyyee, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents a 2'-OMe sugar motif, and each 'f' represents a 2'-F sugar motif.

25. The oligomeric duplex of claim 24, wherein the first modified oligonucleotide comprises a modified glycosyl motif and pairs with a second modified oligonucleotide comprising a glycosyl motif selected from: efyyyfyyyyyyyyfyfyyyyyyy and yyyyyyyfyfffyyyyyyyyyy; yfyyyyfyyyyyyyyfyfyyyyyyy and yyyyyyfyfffyyyyyyyy; efyyydyyeyyyydydyyyyee and eeyyyyyyyyffyyy yyyyyee;efyyydyyyyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee;efyyydyyeyyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyyee;e[ FHNA]yyyfyyeyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee; and e[FHNA]yyyfyyyyyyyyfyfyyyyyee and eeyyyyyyyyffyyyyyyyyee.

26. The oligomeric duplex according to any one of claims 1 to 25, wherein the agent comprises a conjugate group, said conjugate group comprising a conjugate portion and a conjugate linker.

27. The oligomeric duplex of claim 26, wherein the conjugation group comprises a cell-targeting portion.

28. The oligomeric duplex of claim 27, wherein the conjugation group comprises a hepatocyte-targeting portion.

29. The oligomeric duplex of claim 28, wherein the agent comprises a conjugate portion that binds to the desialyl glycoprotein receptor (ASGPR).

30. The oligomeric duplex according to claim 29, wherein the conjugate portion is selected from the GalNAc portion.

31. The oligomeric duplex according to claim 30, wherein the GalNAc conjugate portion is selected from Table A.

32. The oligomeric duplex according to claim 30, wherein the conjugate group comprises a GalNAc ligand and a conjugate linker.

33. The oligomeric duplex according to claim 30, wherein the GalNAc ligand has the following structure: 。 34. The oligomeric duplex according to claim 15, wherein the conjugation group has the following structure: Or its ions or salts, wherein the conjugate linker is covalently linked to the oligonucleotide.

35. The oligomeric duplex according to claim 30, wherein the conjugating group has the following structure: Or its ions or salts, wherein the conjugate linker is covalently linked to the oligonucleotide.

36. The oligomeric duplex according to any one of claims 26 to 35, wherein the conjugation group is directly conjugated to the modified oligonucleotide.

37. The oligomeric duplex of claim 36, wherein the conjugation group is conjugated to the 5' or 3' end of the modified oligonucleotide.

38. The oligomeric duplex of claim 37, wherein the conjugation group is attached to the 5'-terminal nucleoside of the modified oligonucleotide.

39. The oligomeric duplex of claim 37, wherein the conjugation group is attached to the 3'-terminal nucleoside of the modified oligonucleotide.

40. The oligomeric duplex according to claim 36, wherein the conjugate linker of the conjugate group is composed of a single bond.

41. The oligomeric duplex according to claim 36, wherein the conjugate linker of the conjugate group is cleavable.

42. The oligomeric duplex according to claim 36, wherein the conjugate linker comprises 1 to 3 linker-nucleosides.

43. The oligomeric duplex according to claim 38, wherein the conjugate group has the following structure: Alternatively, its ions or salts may be attached to the 5'-terminal nucleoside of the modified oligonucleotide.

44. The oligomeric duplex according to claim 39, wherein the conjugate group has the following structure: Alternatively, its ions or salts may be attached to the 3'-terminal nucleoside of the modified oligonucleotide.

45. An oligomeric duplex comprising: i) a first oligomeric compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence comprises at least 80% identical to at least 16 consecutive nucleosides of any one of SEQ ID NO: 6 to 829 and 3078 to 3083, wherein all nucleosides except 0, 1, or 2 are identical to those in SEQ ID NO: The nucleobase sequences of 6 to 829 or 3078 to 3083 are identical, and each of the first modified oligonucleotides contains a modified sugar moiety selected from the following: efyyyfyyyyyyyyfyfyyyyyyy, yfyyyfyyyyyyyyyfyfyyyyyy, efyyydyyeyyyydydyyyyyee, efyyydyyyyyyyfyfyyyyyee, efyyydyyeyyyyfyfyyyyyee, e[FHNA]yyyfyyyyyyyfyfyyy yyee and e[FHNA]yyyfyyeyyyyfyfyyyyyee, wherein each 'e' represents the 2'-MOE sugar moiety, each 'y' represents the 2'-OMe sugar moiety, each 'f' represents the 2'-F sugar moiety, each '[FHNA]' represents the 3'-fluoro-hexitol sugar moiety, and each 'd' represents the 2'-deoxy sugar moiety; and ii) a second oligomer compound comprising a second modified oligonucleotide, the second modified oligonucleotide consisting of 14 to 50 linked nucleosides, wherein the nucleobase sequence comprises the sequence of SEQ ID NO: at least 14 consecutive nucleotide sequences of at least 80% identical to each of SEQ ID NO: 830 to 1540 and 3096 to 3101, wherein all except 0, 1 or 2 nucleotides are identical to the nucleotide sequences of SEQ ID NO: 830 to 1540 or 3096 to 3101, and wherein each of the second modified oligonucleotides comprises a modified glycosyl motif selected from yyyyyyfyfffyyyyyyyyyy and eeyyyyyyyyffyyyyyyyyee, wherein each 'e' represents a 2'-MOE sugar motif, each 'y' represents a 2'-OMe sugar motif, and each 'f' represents a 2'-F sugar motif.

46. ​​The oligoduplex of claim 45, wherein the sequence of the second modified oligonucleotide comprises at least 15 or at least 16 consecutive nucleobases of any one of the sequences of SEQ ID NO: 2365 to 3075 and 3084 to 3089; and optionally, wherein the sequence of the first modified oligonucleotide comprises at least 18, at least 19, or at least 20 consecutive nucleobases of any one of the sequences of SEQ ID NO: 1541 to 2364 and 3090 to 3095.

47. The oligoduplex of claim 46, wherein the sequence of the first modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 1541 to 2364 and 3090 to 3095; and optionally, wherein the sequence of the second modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 2365 to 3075 and 3084 to 3089.

48. The oligoduplex of claim 46, wherein the sequence of the first modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 1541 to 2364 and 3090 to 3095; and optionally, wherein the sequence of the second modified oligonucleotide comprises the sequence of any one of SEQ ID NO: 2365 to 3075 and 3084 to 3089.

49. The oligomeric duplex according to claim 46, wherein the agent is a duplex compound consisting of any one of the following pairs of antisense and sense compounds: 。 50. A group of oligomeric duplexes according to any one of claims 1 to 49, wherein the group is enriched with modified oligonucleotides comprising at least one specific thiophosphate nucleoside bond having a specific stereochemical configuration.

51. The group of claim 50, wherein the group is enriched with having (Sp) or (Rp) A modified oligonucleotide with at least one specific thiophosphate nucleoside bond in its configuration.

52. A pharmaceutical composition comprising an oligomeric double strand according to any one of claims 1 to 49 or a group according to any one of claims 50 to 51, and a pharmaceutically acceptable diluent or carrier.

53. The pharmaceutical composition of claim 52, wherein the pharmaceutically acceptable diluent is water or phosphate-buffered saline.

54. The pharmaceutical composition of claim 52, wherein the pharmaceutical composition is substantially composed of the oligomeric duplex and water or phosphate-buffered saline.

55. A method for reducing the amount of LPA RNA or lipoprotein(a) protein in cells, tissues, organs, or subjects, the method comprising contacting the cells, tissues, organs, or subjects with an oligomeric duplex according to any one of claims 1 to 49, a group according to any one of claims 50 to 51, or a pharmaceutical composition according to any one of claims 52 to 54.

56. The method of claim 55, wherein the cell is a hepatocyte.

57. A method comprising administering to a subject an oligomeric double strand according to any one of claims 1 to 49, a group according to any one of claims 50 to 51, or a pharmaceutical composition according to any one of claims 52 to 54; wherein the subject has or is at risk of developing cardiovascular disease (CVD), coronary artery disease (CAD), hypercholesterolemia, myocardial infarction (MI), peripheral artery disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, or stroke.

58. A method for preventing or treating a subject’s cardiovascular disease, disorder, condition, metabolic disease, disorder, or condition, and / or inflammatory disease, disorder, or condition, said method comprising administering to a subject who has or is at risk of having a cardiovascular, metabolic, and / or inflammatory disease, disorder, or condition an oligomeric duplex according to any one of claims 1 to 49, a group according to any one of claims 50 to 51, or a pharmaceutical composition according to any one of claims 52 to 54; wherein said disease, disorder, condition, or injury is hypertriglyceridemia, lipemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic calcification, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina pectoris, cerebrovascular arteriosclerosis, cerebrovascular disease, or venous thrombosis.

59. A method for reducing the amount of LPA RNA and / or lipoprotein(a) protein in the liver of a subject who has or is at risk of developing and having elevated Lp(a)-related diseases, disorders, or conditions, the method comprising administering to a subject who has or is at risk of having a disease, disorder, or condition associated with lipoprotein(a) metabolic disorders an oligodimer according to any one of claims 1 to 49, a group according to any one of claims 50 to 51, or a pharmaceutical composition according to any one of claims 52 to 54; wherein the disease, disorder, condition, or injury is a cardiovascular disease, disorder, condition, metabolic disease, or condition, and / or an inflammatory disease, disorder, or condition.

60. The method according to any one of claims 55 to 59, wherein the amount of LPA RNA and / or lipoprotein(a) protein in the liver and / or plasma of the subject is reduced.

61. The method according to any one of claims 55 to 59, wherein the disease, ailment, or condition is hypertriglyceridemia, atherosclerotic cardiovascular disease (ASCVD), or coronary artery disease (CAD).

62. The method of claim 61, wherein at least one symptom of the disease, ailment, or condition associated with elevated lipoprotein(a) is an episode of abdominal pain, physical fatigue, mental difficulty, diarrhea, recurrent acute pancreatitis, xanthoma rash, and hepatosplenomegaly or a combination thereof.

63. The method according to any one of claims 55 to 59, wherein the method prevents or protects against the progression of atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

64. The method according to any one of claims 55 to 59, wherein the administration of the oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54 improves the subject's hypertriglyceridemia, hyperlipidemia, dyslipidemia, hyperlipoproteinemia, abdominal pain, physical fatigue, mental difficulty, diarrhea, acute pancreatitis, exanthematous xanthomas, lipemic retinopathy, or hepatosplenomegaly, or a combination of two or more of the foregoing.

65. The method according to any one of claims 55 to 59, wherein the administration of the oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54 is parenteral.

66. The method according to any one of claims 55 to 59, wherein the application of the oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54 is subcutaneous.

67. The method according to any one of claims 55 to 59, wherein the application of the oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54 is co-administered with the second pharmaceutical agent.

68. The method according to any one of claims 55 to 59, wherein the application of the oligomeric double strand according to any one of claims 1 to 29, the group according to any one of claims 30 to 31, or the pharmaceutical composition according to any one of claims 32 to 34 is administered simultaneously with the pharmaceutical agent.

69. The use of the oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54 for the treatment or prevention of diseases, disorders, or conditions associated with lipoprotein metabolism disorders or for the delay of symptoms of diseases, disorders, or conditions associated with elevated lipoprotein(a).

70. Use of the oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54 in the manufacture of a medicament for the treatment or prevention of cardiovascular diseases, disorders, conditions, metabolic diseases, or conditions, or inflammatory diseases, disorders, or conditions.

71. The oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54, for the treatment or prevention of diseases, disorders, or conditions associated with lipoprotein metabolism disorders or for delaying the symptoms of diseases, disorders, or conditions associated with elevated lipoprotein(a).

72. The oligomeric double strand according to any one of claims 1 to 49, the group according to any one of claims 50 to 51, or the pharmaceutical composition according to any one of claims 52 to 54, for the treatment or prevention of cardiovascular diseases, disorders, symptoms, metabolic diseases, disorders or symptoms, or inflammatory diseases, disorders or symptoms.

Images