A method for recombinantly expressing feline serum albumin

Abstract

The application discloses a method for recombinantly expressing feline serum albumin. The method comprises co-expressing feline serum albumin, protein disulfide isomerase, and regulating factors HAC1 and Vitreoscilla hemoglobin in a recipient yeast strain, and the obtained strain is an engineering strain capable of expressing recombinant feline serum albumin. The engineering strain can efficiently express rFSA, and the expression amount of rFSA in the co-expression strain is significantly improved compared with direct single expression of rFSA, and can reach about 16 g / L at the highest. The method lays a foundation for large-scale industrial production of rFSA.

Description

A method for recombinantly expressing feline serum albumin Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for recombinantly expressing feline serum albumin. Background Art

[0002] Feline serum albumin (FSA) is the most abundant protein in cat serum and has numerous physiological functions, such as maintaining osmotic pressure and transporting endogenous and exogenous substances. Clinically, serum albumin is required to treat conditions such as shock caused by hemorrhagic or burn injuries, hypoproteinemia, and edema caused by cirrhosis and kidney disease. Serum albumin is primarily obtained through blood extraction, but feline serum itself is in short supply and carries the risk of blood-borne viruses, making it difficult to meet market demand for FSA. Some veterinary hospitals use bovine or human serum albumin as an alternative to FSA, but these treatments are expensive and can cause allergic reactions. Therefore, new FSA production methods are needed to meet the growing market demand.

[0003] Pichia pastoris is a commonly used genetic engineering expression system. It enables high-density fermentation, rapid growth, and post-translational modification and processing of proteins, making it widely used for the expression of exogenous proteins. While research on the expression of human serum albumin using Pichia pastoris is relatively mature, reports on the recombinant expression of FSA are rare. Chinese Patent CN111118018B discloses a method for expressing FSA in Pichia pastoris, but the yield is only 2g / L, which is insufficient for industrial FSA production. New methods are needed to develop higher-yield production strains.

[0004] FSA is a single-chain protein consisting of 584 amino acids with 17 disulfide bonds and three helical domains, resulting in a complex structure. When FSA is expressed in Pichia pastoris, a large amount of improperly folded nascent protein accumulates in the endoplasmic reticulum due to potential mispairing of disulfide bonds, inducing an unfolded protein response (UPR) and reducing FSA production.

[0005] Invention Disclosure

[0006] The object of the present invention is to provide a method for recombinantly expressing feline serum albumin.

[0007] The present invention claims a method for constructing an engineered strain capable of recombinantly expressing feline serum albumin.

[0008] The method for constructing an engineered strain capable of recombinantly expressing feline serum albumin claimed in the present invention may be any of the following:

[0009] Method I: may include the following steps (A):

[0010] (A) Feline serum albumin (FSA), protein disulfide isomerase (PDI) and regulatory factor HAC1 were co-expressed in a recipient yeast, and the resulting strain was named Engineered Strain 1; the Engineered Strain 1 is an engineered strain capable of recombinantly expressing feline serum albumin.

[0011] Method II may include the following step (B):

[0012] (B) Feline serum albumin (FSA), protein disulfide isomerase (PDI), and Vitreoscilla hemoglobin (VHb) were co-expressed in a recipient yeast strain, and the resulting strain was named Engineered Strain 2; Engineered Strain 2 is an engineered strain capable of recombinantly expressing feline serum albumin.

[0013] Method III may include the following step (C):

[0014] (C) Feline serum albumin (FSA), protein disulfide isomerase (PDI), regulatory factor HAC1, and Vitreoscilla hemoglobin (VHb) were co-expressed in a recipient yeast strain, and the resulting strain was named Engineered Strain 3; Engineered Strain 3 is an engineered strain capable of recombinantly expressing feline serum albumin.

[0015] Furthermore, the step (A) may be: introducing the gene encoding the serum albumin (FSA), the gene encoding the protein disulfide isomerase (PDI) and the gene encoding the regulatory factor HAC1 into the recipient yeast, and the resulting strain is the engineered strain 1.

[0016] Furthermore, the step (B) may be: introducing the gene encoding the serum albumin (FSA), the gene encoding the protein disulfide isomerase (PDI) and the gene encoding the Vitreoscilla hemoglobin (VHb) into the recipient yeast, and the resulting strain is the engineered bacteria 2.

[0017] Furthermore, the step (C) may be: introducing the gene encoding the serum albumin (FSA), the gene encoding the protein disulfide isomerase (PDI), the gene encoding the regulatory factor HAC1 and the gene encoding the Vitreoscilla hemoglobin (VHb) into the recipient yeast, and the resulting strain is the engineered bacteria 3.

[0018] Furthermore, each coding gene introduced into the recipient yeast in steps (A), (B), and (C) is introduced via a recombinant yeast expression vector. Following introduction, the resulting recombinant bacteria may be enriched (e.g., a secondary enrichment, with the second antibiotic concentration being higher than the first) using the antibiotic corresponding to the resistance gene carried by the recombinant yeast expression vector. This step aims to obtain a multi-copy integrated strain. Theoretically, a higher antibiotic concentration will result in a higher number of integrated copies (for details, see the Pichia pastoris expression manual, which provides relevant information).

[0019] Specifically, the above step (A) may include: (A1) using the yeast expression vector pPIC9K to introduce the gene encoding the serum albumin (FSA) into the recipient yeast, and using G418 to enrich the resulting recombinant bacteria (such as secondary enrichment, the first G418 concentration is 2 mg / ml, and the second G418 concentration is 4 mg / ml), thereby obtaining a multi-copy integrated rFSA expression strain GS115-FSA; (A2) using the yeast expression vector pPICZα to introduce the gene encoding the protein disulfide isomerase (PDI) into the GS115-FSA, and using bleomycin to enrich the resulting recombinant bacteria (such as secondary enrichment, the first bleomycin concentration is 2 mg / ml). l, the second blasticidin concentration is 4 mg / ml), thereby obtaining the rFSA expression strain GS115-FSA-PDI containing multiple copies of PDI; (A3) using the yeast expression vector pPIC6α to introduce the coding gene of the regulatory factor HAC1 into the GS115-FSA-PDI, and enriching the obtained recombinant bacteria with Blasticidin (such as secondary enrichment, the first Blasticidin concentration is 2 mg / ml, the second Blasticidin concentration is 4 mg / ml), thereby obtaining the rFSA expression strain GS115-FSA-PDI-HAC1 containing multiple copies of HAC1, which is the engineered bacteria 1.

[0020] Specifically, the above-mentioned step (B) may include: (B1) the same as step (A1); (B2) the same as step (A2); (B3) using the yeast expression vector pPIC6α to introduce the coding gene of the Vitreoscilla hemoglobin (VHb) into the GS115-FSA-PDI, and enriching the obtained recombinant bacteria using Blasticidin (such as secondary enrichment, the first Blasticidin concentration is 2 mg / ml, and the second Blasticidin concentration is 4 mg / ml), thereby obtaining the rFSA expression strain GS115-FSA-PDI-VHb containing multiple copies of VHb integration, which is the engineered bacteria 2.

[0021] Specifically, the above step (C) may include: (C1) the same as step (A1); (C2) the same as step (A2); (C3) using the yeast expression vector pPIC6α to introduce the coding gene of the regulatory factor HAC1 and the coding gene of the Vitreoscilla hemoglobin (VHb) into the GS115-FSA-PDI, and enriching the obtained recombinant bacteria using Blasticidin (such as secondary enrichment, the first Blasticidin concentration is 2 mg / ml, and the second Blasticidin concentration is 4 mg / ml), thereby obtaining the rFSA expression strain GS115-FSA-PDI-HAC1-VHb containing multiple copies of HAC1 and VHb, which is the engineered bacteria 3.

[0022] In the above method, the feline serum albumin (FSA) may be a protein having an amino acid sequence of SEQ ID No. 1, or a protein having the same function as SEQ ID No. 1 by substitution and / or deletion and / or addition of one or more amino acid residues, or a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with SEQ ID No. 1 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein having the amino acid sequence of SEQ ID No. 1.

[0023] In the above method, the protein disulfide isomerase (PDI) may be a protein having an amino acid sequence of SEQ ID No. 5, or a protein having the same function as SEQ ID No. 5 by substitution and / or deletion and / or addition of one or more amino acid residues, or a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with SEQ ID No. 5 and having the same function, or a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein having the amino acid sequence of SEQ ID No. 5.

[0024] In the above method, the regulatory factor HAC1 can be a protein whose amino acid sequence is SEQ ID No. 9, or a protein having the same function after one or more amino acid residues are substituted and / or deleted and / or added to SEQ ID No. 9, or a protein having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with SEQ ID No. 9 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein whose amino acid sequence is SEQ ID No. 9.

[0025] In the above method, the Vitreoscilla hemoglobin (VHb) may be a protein having an amino acid sequence of SEQ ID No. 13, or a protein having the same function as SEQ ID No. 13 by substitution and / or deletion and / or addition of one or more amino acid residues, or a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with SEQ ID No. 13 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein having the amino acid sequence of SEQ ID No. 13.

[0026] The substitution and / or deletion and / or addition of one or several amino acid residues refers to the substitution and / or deletion and / or addition of no more than ten amino acid residues.

[0027] In the above proteins, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0028] In the above-mentioned proteins, homology refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, you can calculate the identity of a pair of amino acid sequences by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM 62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be calculated.

[0029] In the above proteins, the 95% or greater homology may be at least 96%, 97%, or 98% identity. The 90% or greater homology may be at least 91%, 92%, 93%, or 94% identity. The 85% or greater homology may be at least 86%, 87%, 88%, or 89% identity. The 80% or greater homology may be at least 81%, 82%, 83%, or 84% identity.

[0030] In the above method, the gene encoding serum albumin (FSA) may be a DNA molecule having a nucleotide sequence of SEQ ID No. 2, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No. 2 under stringent conditions and encodes a protein having an amino acid sequence of SEQ ID No. 1, or a DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more homology with the DNA sequence defined by SEQ ID No. 2 and encodes a protein having an amino acid sequence of SEQ ID No. 1.

[0031] In the above method, the gene encoding protein disulfide isomerase (PDI) may be a DNA molecule having a nucleotide sequence of SEQ ID No. 6, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No. 6 under stringent conditions and encodes a protein having an amino acid sequence of SEQ ID No. 5, or a DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more homology with the DNA sequence defined by SEQ ID No. 6 and encodes a protein having an amino acid sequence of SEQ ID No. 5.

[0032] In the above method, the gene encoding the regulatory factor HAC1 can be a DNA molecule whose nucleotide sequence is SEQ ID No. 10, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No. 10 under stringent conditions and encodes a protein with an amino acid sequence of SEQ ID No. 9, or a DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more homology with the DNA sequence defined by SEQ ID No. 10 and encodes a protein with an amino acid sequence of SEQ ID No. 9.

[0033] In the above method, the gene encoding the Vitreoscilla hemoglobin (VHb) may be a DNA molecule having a nucleotide sequence of SEQ ID No. 14, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No. 14 under stringent conditions and encodes a protein having an amino acid sequence of SEQ ID No. 13, or a DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more homology with the DNA sequence defined by SEQ ID No. 14 and encodes a protein having an amino acid sequence of SEQ ID No. 13.

[0034] In the above-mentioned encoding gene, the stringent conditions may be as follows: hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA at 50°C, and washing in 2×SSC, 0.1% SDS at 50°C; hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA at 50°C, and washing in 1×SSC, 0.1% SDS at 50°C; hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA at 50°C, and washing in 0.5×SSC, 0.1% SDS at 50°C; hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA at 50°C, and washing in 0.1×SSC, 0.1% SDS at 50°C; and washing in 7% Hybridize in a mixed solution of SDS, 0.5M NaPO4 and 1mM EDTA, and rinse in 0.1×SSC, 0.1% SDS at 65°C; or hybridize in a solution of 6×SSC, 0.5% SDS at 65°C, and then wash the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0035] In the above-mentioned coding genes, homology refers to nucleotide sequence identity. Nucleotide sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM 62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of nucleotide sequences can be calculated and the identity value (%) can be obtained.

[0036] In the above-mentioned coding genes, the 95% or greater homology may be at least 96%, 97%, or 98% identity. The 90% or greater homology may be at least 91%, 92%, 93%, or 94% identity. The 85% or greater homology may be at least 86%, 87%, 88%, or 89% identity. The 80% or greater homology may be at least 81%, 82%, 83%, or 84% identity.

[0037] In the above method, the recipient yeast may be Pichia pastoris.

[0038] In one embodiment of the present invention, the Pichia pastoris is Pichia pastoris GS115.

[0039] The present invention also claims protection for the engineered strain constructed using the method described above.

[0040] The present invention also claims the use of the above-mentioned engineered strain in the preparation of feline serum albumin.

[0041] The present invention also claims a method for preparing feline serum albumin.

[0042] The method for preparing feline serum albumin claimed in the present invention may include the following steps: fermenting and expressing (fermenting and culturing) the engineered strain described above, and obtaining recombinant feline serum albumin from the fermentation broth.

[0043] Furthermore, the fermentation culture is carried out at a temperature of 28-30°C (such as 30°C).

[0044] Furthermore, the fermentation process includes the step of adding methanol to induce expression. Furthermore, methanol is added in batches (e.g., once every 12 hours) to induce expression (methanol content does not exceed 0.5% of the culture medium volume, e.g., 0.5%), and the expression is induced for 72-120 hours (e.g., 72 hours).

[0045] Furthermore, the fermentation culture process may also include all or part of the following: ventilation and stirring, with the upper and lower limits of the stirring speed controlled at 200 rpm and 1000 rpm, respectively; setting the temperature to 30° C.; setting the pH value to 6.0; adding glycerol to maintain the dissolved oxygen at 30%-40%, stopping the addition of glycerol when the bacteria grow to OD600=200, cooling the temperature to 28° C., and starting the flow addition of methanol while maintaining the dissolved oxygen at 20%-30%, and continuing the fermentation for 72 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 is a map of the pPIC9K vector.

[0047] Figure 2 is a map of the FSA Pichia pastoris expression vector.

[0048] FIG3 is the electrophoresis result of the shake flask expression of the FSA single expression strain.

[0049] Figure 4 is a map of the pPICZα vector.

[0050] Figure 5 is a map of the PDI Pichia pastoris expression vector.

[0051] Figure 6 shows the electrophoresis results of the shake flask expression of the FSA and PDI co-expression strain.

[0052] Figure 7 is a map of the pPIC6α vector.

[0053] FIG8 is a map of the HAC1 Pichia pastoris expression vector.

[0054] Figure 9 is a map of the HVb Pichia pastoris expression vector.

[0055] FIG10 is a map of the HAC1 and HVb co-expression vector.

[0056] FIG11 is the electrophoresis result of shake flask expression of FSA and auxiliary factor co-expression strain.

[0057] Figure 12 shows the electrophoresis results of the fermentation of VHb, HAC1, rFSA, and PDI co-expression strains. Best Mode for Carrying Out the Invention

[0058] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0059] Example 1: Highly efficient expression of recombinant feline serum albumin

[0060] 1. FSA gene synthesis and yeast expression vector construction

[0061] The amino acid sequence of feline serum albumin published in the Uniprot database is shown as SEQ ID No. 1. The feline serum albumin gene sequence (SEQ ID No. 2) was synthesized based on the optimal codons of Pichia pastoris. Gene synthesis was completed by Suzhou Jinweizhi Biotechnology Co., Ltd. The following primers were designed and the synthesized gene sequence was amplified by PCR using SEQ ID No. 2 as a template:

[0062] FSA-F: 5'-GAAGAAGGGGTATCTCTCGAGAAAAGAGAAGCTCATCAATCTG-3' (SEQ ID No. 3);

[0063] FSA-R: 5'-ATAAGAATGCGGCCGCTTAAGCCAAAGCAGCTTGAG-3' (SEQ ID No. 4).

[0064] The specific conditions were as follows: denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute and 30 seconds, for a total of 30 cycles; and then extension at 72°C for 5 minutes.

[0065] The Pichia pastoris expression vector pPIC9K (Figure 1) contains the yeast α-factor signal peptide, enabling secretory expression of the target protein. The vector was double-digested with EcoRI and NotI, and the FSA gene, obtained by PCR, was constructed using the BM Seamless Cloning Kit (Beijing Biomed Gene Technology Co., Ltd.) and sequenced correctly.

[0066] 2. Electroporation of Pichia pastoris using the pPIC9K-FSA expression vector

[0067] The present invention uses Pichia pastoris GS115 as the host strain. The preparation method of electroporation competent cells is based on the instructions for the pPICZα vector from Invitrogen. The SalⅠ-linearized pPIC9K-FSA vector was added to 150 μl of GS115 electroporation competent cells. Electroporation was performed using a Bio-Rad MicroPulser electroporator (2 mm cuvette, 2000 V, 5 ms). The transformation product was plated on MD solid medium (formula: 1.34% amino-free yeast nitrogen base, 4×10 -5 % biotin, 2% glucose, 2% agar powder; each % represents g / 100 ml), and cultured at 30°C.

[0068] 3. Obtaining rFSA expression strain

[0069] The recombinant strain grown on MD plates was transferred to YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 2% agar powder; each % represents g / 100 ml) containing 2 mg / ml geneticin (G418), grown at 30°C for 48 hours, and antibiotic enrichment screening was performed; the strain grown after the first antibiotic enrichment was transferred to YPD solid medium containing 4 mg / ml geneticin (G418), grown at 30°C for 48 hours, and a second antibiotic enrichment was performed to obtain the rFSA expression strain GS115-FSA containing multiple copies of integration.

[0070] A single colony of the GS115-FSA strain was inoculated into 10 ml of YPD liquid medium (formula: 2% peptone, 1% yeast extract, 2% glucose; all percentages represent g / 100 ml). Culture was performed at 30°C for 24 hours. The cells were harvested by centrifugation and transferred to 20 ml of YP liquid medium (formula: 2% peptone, 1% yeast extract, 0.5% methanol; peptone and yeast extract are weight-to-volume ratios (i.e., % represents g / 100 ml), and methanol is expressed as volume percentage). Expression was induced for 72 hours, with 0.5% (volume percentage) methanol added every 12 hours. After induction, the culture supernatant was analyzed by SDS-PAGE electrophoresis. The results are shown in Figure 3, indicating that a strain with high FSA expression was obtained.

[0071] 4. PDI gene synthesis and yeast expression vector construction

[0072] The amino acid sequence of Pichia pastoris disulfide isomerase (PDI) published in the Uniprot database is shown as SEQ ID No. 5. The PDI gene sequence (SEQ ID No. 6) was synthesized based on the optimal codons in Pichia pastoris. Gene synthesis was completed by Suzhou Jinweizhi Biotechnology Co., Ltd. The following primers were designed and the synthesized gene sequence was amplified by PCR using SEQ ID No. 6 as a template:

[0073] PDI-F: 5'-GAAGAAGGGGTATCTCTCGAGAAAAGATCTGACCAAGAAGCTAT-3' (SEQ ID No. 7);

[0074] PDI-R: 5'-GTTCTAGAAAGCTGGCGGCCGCTTACAATTCGTCGTGAGC-3' (SEQ ID No. 8).

[0075] The specific conditions were as follows: denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute, for a total of 30 cycles; and then extension at 72°C for 5 minutes.

[0076] The Pichia pastoris expression vector pPICZα (Figure 4) contains a zeocin resistance gene, providing an additional selection marker. The vector was double-digested with XhoI and NotI, and the PDI gene, obtained by PCR, was then used to construct the expression vector pPICZα-PDI (Figure 5) using the BM Seamless Cloning Kit (Beijing Biomed Gene Technology Co., Ltd.). Sequencing confirmed the construct.

[0077] 5. Electroporation of Pichia pastoris using the pPICZα-PDI expression vector

[0078] Prepare electroporation competent cells using the GS115-FSA strain obtained in Step 3 as the host strain. Linearize the pPICZα-PDI vector with SacⅠ and add 150 μl of GS115-FSA competent cells. Electroporation was performed using a Bio-Rad MicroPulser (2 mm cuvette, 2000 V, 5 ms). Spread the transformant onto YPD solid medium (formula: 2% peptone, 1% yeast extract, 2% glucose, 100 μg / ml Zeocin, 2% agar powder; all percentages represent g / 100 ml) and incubate at 30°C.

[0079] 6. Screening of rFSA and PDI co-expression strains

[0080] The recombinant strain growing on the transformation plate was transferred to YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 2% agar powder; each % represents g / 100 ml) containing 2 mg / ml zeocin, grown at 30°C for 48 hours, and then subjected to antibiotic enrichment screening. The strain grown after the first antibiotic enrichment was transferred to YPD solid medium containing 4 mg / ml zeocin, grown at 30°C for 48 hours, and then subjected to a second antibiotic enrichment, thereby obtaining the rFSA expression strain GS115-FSA-PDI containing multiple copies of the PDI integrated gene.

[0081] A single colony of the GS115-FSA-PDI strain was inoculated into 10 ml of YPD liquid medium (formula: 2% peptone, 1% yeast extract, 2% glucose; all percentages represent g / 100 ml). The strain was cultured at 30°C for 24 hours, harvested by centrifugation, and transferred to 20 ml of YP liquid medium (formula: 2% peptone, 1% yeast extract, 0.5% methanol; peptone and yeast extract are weight-to-volume ratios (i.e., % represents g / 100 ml), while methanol is expressed as volume percentage). Expression was induced for 72 hours, with 0.5% (volume percentage) added every 12 hours. After induction, the culture supernatant was analyzed by SDS-PAGE electrophoresis (Figure 6). The FSA expression level in the FSA and PDI co-expressing strain was significantly higher than that in the original strain.

[0082] 7. HAC1 gene synthesis and yeast expression vector construction

[0083] The amino acid sequence of Pichia pastoris HAC1 published in the Uniprot database is shown as SEQ ID No. 9. The HAC1 gene sequence (SEQ ID No. 10) was synthesized based on the optimal codons of Pichia pastoris. Gene synthesis was completed by Suzhou Jinweizhi Biotechnology Co., Ltd. The following primers were designed and the synthesized gene sequence was amplified by PCR using SEQ ID No. 10 as a template:

[0084] HAC1-F: 5'-CAACTAATTATTCGAAACGATGCCAGTTGACTCTTC-3' (SEQ ID No. 11);

[0085] HAC1-R: 5'-GTTCTAGAAAGCTGGCGGCCCGCTTATCTGATAGCGATACAAG-3' (SEQ ID No. 12).

[0086] The specific conditions were as follows: denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute, for a total of 30 cycles; and then extension at 72°C for 5 minutes.

[0087] The Pichia pastoris expression vector pPIC6α (Figure 7) contains a blasticidin-resistance gene, providing an additional selection marker. The vector was digested with AusⅡ and NotⅠ, and the HAC1 gene, obtained by PCR, was then used to construct the expression vector pPIC6α-HAC1 (Figure 8) using the BM Seamless Cloning Kit (Beijing Bomade Gene Technology Co., Ltd.). Sequencing confirmed the construct.

[0088] 8. VHb gene synthesis and yeast expression vector construction

[0089] The amino acid sequence of Vitreoscilla VHb published in the Uniprot database is shown as SEQ ID No. 13. The VHb gene sequence (SEQ ID No. 14) was synthesized based on the optimal codons of Pichia pastoris. Gene synthesis was completed by Suzhou Jinweizhi Biotechnology Co., Ltd. The following primers were designed and the synthesized gene sequence was amplified by PCR using SEQ ID No. 14 as a template:

[0090] VHb-F1: 5'-CAACTAATTATTCGAAACGATGTTGGACCAACAAACT-3' (SEQ ID No. 15);

[0091] VHb-R1: 5'-GTTCTAGAAAGCTGGCGGCCGCTTATTCAACAGCTTGAGCG-3' (SEQ ID No. 16).

[0092] The specific conditions were as follows: denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 30 cycles; and then extension at 72°C for 5 minutes.

[0093] The pPIC6α vector was double-digested with AusⅡ and NotⅠ, and the VHb gene obtained by PCR was used to construct the expression vector pPIC6α-VHb (Figure 9) using the BM seamless cloning kit (Beijing Bomade Gene Technology Co., Ltd.), and the sequencing was correct.

[0094] 9. Construction of HAC1 and VHb dual expression vector

[0095] The following primers were designed to amplify the VHb gene sequence by PCR using SEQ ID No. 14 as a template:

[0096] VHb-F2: 5'-CTTGTATCGCTATCAGATAAGCGGCCGCCAACTAATTATTCGAAACGATGTTGGACC AACAAACT-3' (SEQ ID No. 17);

[0097] VHb-R2: 5'-CGCTCAAGCTGTTGAATAATCTAGAACAAAAACTCATC-3' (SEQ ID No. 18).

[0098] The specific conditions were as follows: denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 30 cycles; and then extension at 72°C for 5 minutes.

[0099] The pPIC6α-HAC1 vector constructed above was double-digested with NotⅠ and XbaⅠ, and the VHb gene obtained by PCR was used to construct the expression vector pPIC6α-HAC1-VHb ( Figure 10 ) using the BM seamless cloning kit (Beijing Bomade Gene Technology Co., Ltd.), and the sequencing was correct.

[0100] 10. Construction and screening of HAC1, rFSA, and PDI co-expression strains

[0101] Use GS115-FSA-PDI obtained in step 6 as the host strain to prepare electroporation competent cells. Use SacⅠ to linearize the pPIC6α-HAC1 vector, add 150 μl of GS115-FSA-PDI electroporation competent cells, and use a Bio-Rad MicroPulser electroporator for electroporation (2 mm electroporation cuvette, 2000 V, 5 ms). Spread the transformation product on YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 100 μg / ml Blasticidin, 2% agar powder; all % represent g / 100 ml) and culture at 30°C.

[0102] The recombinant strain growing on the transformation plate was transferred to YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 2% agar powder; each % represents g / 100 ml) containing 2 mg / ml blasticidin, grown at 30°C for 48 hours, and then subjected to antibiotic enrichment screening. The strain grown after the first antibiotic enrichment was transferred to YPD solid medium containing 4 mg / ml blasticidin, grown at 30°C for 48 hours, and then subjected to a second antibiotic enrichment, thereby obtaining the rFSA expression strain GS115-FSA-PDI-HAC1 containing multiple copies of the HAC1 integrated gene.

[0103] 11. Construction and screening of VHb, rFSA, and PDI co-expression strains

[0104] Using the GS115-FSA-PDI obtained in step 6 as the host strain, prepare an electroporation competent cell. Use SacⅠ to linearize the pPIC6α-VHb vector, add 150 μl of GS115-FSA-PDI electroporation competent cells, and use a Bio-Rad MicroPulser electroporator for electroporation (2 mm electroporation cuvette, 2000 V, 5 ms). The transformation product is spread on YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 100 μg / ml Blasticidin, 2% agar powder; all % represent g / 100 ml) and cultured at 30°C.

[0105] The recombinant strain growing on the transformation plate was transferred to YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 2% agar powder; all % represent g / 100 ml) containing 2 mg / ml blasticidin and grown at 30°C for 48 hours for antibiotic enrichment screening. The strain that grew after the first antibiotic enrichment was transferred to YPD solid medium containing 4 mg / ml blasticidin and grown at 30°C for 48 hours for a second antibiotic enrichment, thereby obtaining the rFSA expression strain GS115-FSA-PDI-VHb containing multiple copies of the VHb gene.

[0106] 12. Construction and screening of VHb, HAC1, rFSA, and PDI co-expression strains

[0107] Use GS115-FSA-PDI obtained in step 6 as the host strain to prepare electroporation competent cells. Use SacⅠ to linearize the pPIC6α-HAC1-VHb vector, add 150 μl of GS115-FSA-PDI electroporation competent cells, and use a Bio-Rad MicroPulser electroporator for electroporation (2 mm electroporation cuvette, 2000 V, 5 ms). The transformation product is spread on YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 100 μg / ml Blasticidin, 2% agar powder; each % represents g / 100 ml) and cultured at 30°C.

[0108] The recombinant strain growing on the transformation plate was transferred to YPD solid medium (formula: 2% peptone, 1% yeast powder, 2% glucose, 2% agar powder; each % represents g / 100 ml) containing 2 mg / ml blasticidin, grown at 30°C for 48 hours, and then subjected to antibiotic enrichment screening. The strain grown after the first antibiotic enrichment was transferred to YPD solid medium containing 4 mg / ml blasticidin, grown at 30°C for 48 hours, and then subjected to a second antibiotic enrichment, thereby obtaining the rFSA expression strain GS115-FSA-PDI-HAC1-VHb containing multiple copies of the HAC1 and VHb integrated genes.

[0109] 13. Shake flask expression of rFSA and auxiliary factor co-expression strain

[0110] Single colonies of the GS115-FSA-PDI-HAC1, GS115-FSA-PDI-VHb, and GS115-FSA-PDI-HAC1-VHb strains from the above steps were selected and inoculated into 10 ml of YPD liquid medium (formula: 2% peptone, 1% yeast extract, 2% glucose; all percentages represent g / 100 ml). Culture was performed at 30°C for 24 hours. The cells were harvested by centrifugation and transferred to 20 ml of YP liquid medium (formula: 2% peptone, 1% yeast extract, 0.5% methanol; peptone and yeast extract are weight-to-volume ratios (i.e., % represents g / 100 ml), and methanol is expressed as volume percentage). Expression was induced for 72 hours, with 0.5% methanol (volume percentage) added every 12 hours. After induction, the culture supernatant was analyzed by SDS-PAGE electrophoresis. The results are shown in Figure 11. Calculated by Quantity One protein imaging software, the GS115-FSA-PDI-HAC1-VHb strain had the highest FSA expression level. At the same time, the FSA expression levels of all strains co-expressing with auxiliary factors were significantly higher than those of the original strain.

[0111] 14. Fermentation of VHb, HAC1, rFSA, and PDI co-expression strains

[0112] The FSA high-expression strain GS115-FSA-PDI-HAC1-VHb obtained in step 13 was used as the starting strain and fermented in a 5 L fermentor.

[0113] Seed culture medium: 2% peptone (mass-to-volume ratio, i.e., % represents g / 100 ml), 1% yeast powder (mass-to-volume ratio, i.e., % represents g / 100 ml), 1% glycerol (volume percentage).

[0114] Fermentation medium: 1 L contains the following components: glycerol 40 g, H3PO4 (85% concentration) 26.7 mL, CaSO4 0.93 g, K2SO4 18.2 g, MgSO4•7H2O 14.9 g, KOH 4.13 g, and biotin solution (0.2 g / L) 1.6 mL.

[0115] Feed: ammonia (automatically added according to the set pH value), glycerol, methanol (automatically added according to the dissolved oxygen value of 20-30%).

[0116] (1) Seed culture

[0117] A single colony of the GS115-FSA-PDI-HAC1-VHb strain obtained in step 13 was inoculated into 500 mL of seed culture medium and cultured in a shaking incubator at 30°C for 24 hours. After the culture was completed, the entire bacterial suspension was inoculated into 4.5 L of fermentation medium.

[0118] (2) Fermentation culture

[0119] A 5L fermenter was used for fermentation culture, ventilation and stirring, the upper and lower limits of the stirring speed were controlled at 200rpm and 1000rpm respectively, the temperature was set at 30℃, the pH value was set at 6.0, and glycerol was added to maintain the dissolved oxygen at 30%-40%. When the bacteria grew to OD 600 =200, stop adding glycerol, cool to 28℃, start adding methanol, maintain dissolved oxygen at 20%-30%, and continue fermentation for 72 hours.

[0120] Culture supernatants were collected at different fermentation time points and analyzed by electrophoresis for FSA expression. BSA standards (at two concentration gradients, 8 g / L and 16 g / L) were used as controls. The electrophoresis results are shown in Figure 12. Calculated using Quantity One protein imaging software, the FSA expression level in the 72-hour fermentation supernatant was consistent with that of the 16 g / L BSA standard (indicating that the present invention can achieve a yield of approximately 16 g / L). This invention lays the foundation for large-scale industrial production of FSA.

[0121] Cross-reference to related applications:

[0122] This application claims priority to the Chinese patent application (application number 202311503698.4) filed on November 13, 2023, the entire contents of which are incorporated herein by reference. Industrial Applicability

[0123] The engineered bacteria of the present invention can efficiently express rFSA. Compared with directly expressing rFSA alone, the expression level of rFSA in the co-expression strain is significantly improved, reaching a maximum of 16g / L. The present invention lays the foundation for the large-scale industrial production of rFSA.

Claims

1. A method for constructing an engineered strain capable of recombinantly expressing feline serum albumin, comprising the following steps (A): (A) Feline serum albumin, protein disulfide isomerase and regulatory factor HAC1 were co-expressed in a recipient yeast, and the resulting strain was named engineered strain 1; the engineered strain 1 is an engineered strain capable of recombinantly expressing feline serum albumin.

2. A method for constructing an engineered strain capable of expressing recombinant feline serum albumin, comprising the following steps (B): (B) FSA, protein disulfide isomerase and Vitreoscilla hemoglobin were co-expressed in the recipient yeast, and the resulting strain was named Engineered Bacteria 2; the Engineered Bacteria 2 is an engineered strain capable of recombinantly expressing FSA.

3. A method for constructing an engineered strain capable of recombinantly expressing feline serum albumin, comprising the following steps (C): (C) FSA, protein disulfide isomerase, regulatory factor HAC1 and Vitreoscilla hemoglobin were co-expressed in the recipient yeast, and the resulting strain was named Engineered Bacteria 3; the Engineered Bacteria 3 is an engineered strain capable of recombinantly expressing FSA.

4. The method according to claim 1, characterized in that: The step (A) is: introducing the gene encoding the serum albumin, the gene encoding the protein disulfide isomerase and the gene encoding the regulatory factor HAC1 into the recipient yeast, and the resulting strain is the engineered strain 1.

5. The method according to claim 2, characterized in that: The step (B) is: introducing the gene encoding the serum albumin, the gene encoding the protein disulfide isomerase and the gene encoding the Vitreoscilla hemoglobin into the recipient yeast, and the obtained strain is the engineered bacteria 2.

6. The method according to claim 3, characterized in that: The step (C) is: introducing the gene encoding the serum albumin, the gene encoding the protein disulfide isomerase, the gene encoding the regulatory factor HAC1 and the gene encoding the Vitreoscilla hemoglobin into the recipient yeast, and the resulting strain is the engineered bacteria 3.

7. The method according to any one of claims 1 to 6, characterized in that: The feline serum albumin is a protein whose amino acid sequence is SEQ ID No. 1, or a protein having the same function after one or more amino acid residues are substituted and / or deleted and / or added to SEQ ID No. 1, or a protein having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with SEQ ID No. 1 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein whose amino acid sequence is SEQ ID No.

1.

8. The method according to any one of claims 1 to 7, characterized in that: The protein disulfide isomerase is a protein whose amino acid sequence is SEQ ID No.5, or a protein having the same function after one or more amino acid residues are substituted and / or deleted and / or added to SEQ ID No.5, or a protein having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with SEQ ID No.5 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein whose amino acid sequence is SEQ ID No.

5.

9. The method according to any one of claims 1 to 8, characterized in that: The regulatory factor HAC1 is a protein whose amino acid sequence is SEQ ID No.9, or a protein having the same function after one or more amino acid residues are replaced and / or deleted and / or added to SEQ ID No.9, or a protein having more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with SEQ ID No.9 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein whose amino acid sequence is SEQ ID No.

9.

10. The method according to any one of claims 1 to 9, characterized in that: The Vitreoscilla hemoglobin is a protein whose amino acid sequence is SEQ ID No. 13, or a protein having the same function after one or more amino acid residues are replaced and / or deleted and / or added to SEQ ID No. 13, or a protein having more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with SEQ ID No. 13 and having the same function, or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein whose amino acid sequence is SEQ ID No.

13.

11. The method according to any one of claims 1 to 10, characterized in that: The gene encoding serum albumin is a DNA molecule whose nucleotide sequence is SEQ ID No. 2, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No. 2 under stringent conditions and encodes a protein whose amino acid sequence is SEQ ID No. 1, or a DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more homology with the DNA sequence defined by SEQ ID No. 2 and encodes a protein whose amino acid sequence is SEQ ID No.

1.

12. The method according to any one of claims 1 to 11, characterized in that: The gene encoding the protein disulfide isomerase is a DNA molecule whose nucleotide sequence is SEQ ID No.6, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No.6 under strict conditions and encodes a protein whose amino acid sequence is SEQ ID No.5, or a DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more homology with the DNA sequence defined by SEQ ID No.6 and encodes a protein whose amino acid sequence is SEQ ID No.

5.

13. The method according to any one of claims 1 to 12, characterized in that: The gene encoding the regulatory factor HAC1 is a DNA molecule whose nucleotide sequence is SEQ ID No.10, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No.10 under strict conditions and encodes a protein whose amino acid sequence is SEQ ID No.9, or a DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more homology with the DNA sequence defined by SEQ ID No.10 and encodes a protein whose amino acid sequence is SEQ ID No.

9.

14. The method according to any one of claims 1 to 13, characterized in that: The gene encoding the Vitreoscilla hemoglobin is a DNA molecule whose nucleotide sequence is SEQ ID No. 14, or a DNA molecule that hybridizes with the DNA molecule shown in SEQ ID No. 14 under strict conditions and encodes a protein with an amino acid sequence of SEQ ID No. 13, or a DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more homology with the DNA sequence defined by SEQ ID No. 14 and encodes a protein with an amino acid sequence of SEQ ID No.

13.

15. The method according to any one of claims 1 to 14, characterized in that: The recipient yeast is Pichia pastoris.

16. The method according to claim 15, characterized in that: The Pichia pastoris is Pichia pastoris GS115.

17. An engineered strain constructed using the method described in any one of claims 1 to 16.

18. Use of the engineered strain according to claim 17 in the preparation of feline serum albumin.

19. A method for preparing feline serum albumin, comprising the following steps: fermenting and expressing the engineered strain according to claim 17, and obtaining feline serum albumin from the fermentation broth.

Images