Application of NbMYB159 gene in regulating mva metabolic pathway of nicotiana benthamiana

By specifically binding to the promoter of a key gene in the MVA pathway in Nicotiana benthamiana using the NbMYB159 gene, its expression is activated, thus solving the problems of complex regulation and low production efficiency of MYB transcription factors in Nicotiana benthamiana and achieving efficient production of sesquiterpenes and triterpenoids.

CN122235167APending Publication Date: 2026-06-19TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-30
Publication Date
2026-06-19

Smart Images

  • Figure CN122235167A_ABST
    Figure CN122235167A_ABST
Patent Text Reader

Abstract

This invention discloses the application of the NbMYB159 gene in the positive regulation of the MVA metabolic pathway in Nicotiana benthamiana, belonging to the field of genetic engineering technology. The technical solution includes the application of the NbMYB159 gene in the positive regulation of the MVA metabolic pathway in Nicotiana benthamiana. The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The NbMYB159 gene can enhance the metabolic flux of the MVA pathway by activating the expression of key structural genes in the Nicotiana benthamiana MVA pathway. This invention discovers that NbMYB159 can specifically bind to the promoter regions of NbHMGR and NbHMGS, activating the expression of all genes in the MVA pathway. Transient overexpression of NbMYB159 in Nicotiana benthamiana significantly increases the content of endogenous FPP in Nicotiana benthamiana. Stable overexpression lines significantly increase the content of endogenous FPP in Nicotiana benthamiana without affecting the biomass of Nicotiana benthamiana, while transcriptional repression overexpression lines significantly reduce the content of FPP. This discovery is of great significance for the engineering modification of the Nicotiana benthamiana chassis and can effectively solve the problem of low production efficiency of sesquiterpenes and triterpenes in Nicotiana benthamiana.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of the NbMYB159 gene in the positive regulation of the MVA metabolic pathway of Nicotiana benthamiana. Background Technology

[0002] Terpenes are among the most abundant and structurally diverse secondary metabolites in plants, widely participating in plant growth, development, defense responses, and environmental adaptation. They not only exert physiological functions such as antibacterial, insecticidal, and signal transduction effects in plants, but also have broad application prospects in pharmaceuticals, fragrances, and cosmetics due to their significant medicinal activity. Traditionally, terpenes are obtained primarily through direct extraction from plants, but this method is limited by long plant growth cycles, low terpenoid content in plant tissues, and may lead to environmental and ecological risks. *Nicotiana benthamiana*, as a model plant with a relatively short growth cycle and mature genetic modification capabilities, has broad application prospects. In particular, the widespread application of transient expression systems in *Nicotiana benthamiana* allows for rapid and efficient expression of recombinant genes and large-scale production of target compounds. Compared to traditional stable transformation plants, transient expression systems offer advantages such as rapid initiation and the absence of genetic stability issues. The synthesis of terpenoids mainly relies on the MVA and MEP pathways. The MVA pathway, in particular, is a key node in the synthesis of farnesyl pyrophosphate (FPP), a precursor to important compounds such as sesquiterpenes (C15) and triterpenes (C30), in the cytoplasm. Therefore, increasing the FPP content in Nicotiana benthamiana is crucial for achieving efficient synthesis of sesquiterpenes and triterpenoids.

[0003] MYB transcription factors are widely involved in the biosynthesis of plant terpenes. For example, SmMYB36 acts as an activator of tanshinone biosynthesis by upregulating AACT1, AACT2, HMGS, MK, PMK, MDC, CPS1, CYP76AH1, and KSL1; SmMYB98b and SmMYB9b regulate DXS2, DXR, GGPPS, and KSL to significantly increase tanshinone content; and AaMYB15 inhibits the expression of AaORA, ADS, CYP, DBR2, and ALDH1 and reduces artemisinin production.

[0004] Although MYB transcription factors play a significant role in the regulation of terpene synthesis, their application in the MVA pathway of *Nicotiana benthamiana* still faces systemic challenges. First, MYB transcription factor regulation exhibits strong specificity and complexity; its target genes and regulatory networks are not yet fully elucidated, limiting precise regulation of key genes in the MVA pathway. Second, the regulatory effect of a single transcription factor is often limited by feedback regulation and flux allocation within the endogenous metabolic network, making it difficult to significantly enhance overall metabolic flux. Furthermore, overexpression of MYB transcription factors typically regulates multiple genes in the metabolic pathway, frequently affecting plant growth and development, leading to biomass decline. Therefore, utilizing endogenous MYB transcription factors in *Nicotiana benthamiana* that positively regulate the MVA metabolic pathway to increase FPP content can effectively address the low production efficiency of sesquiterpenes and triterpenes in *Nicotiana benthamiana*, and is of great significance for achieving efficient production of sesquiterpenes and triterpenes in this plant. Summary of the Invention

[0005] This invention provides an application of the NbMYB159 gene in the positive regulation of the MVA metabolic pathway in Nicotiana benthamiana. The invention reveals that NbMYB159 can specifically bind to the promoter regions of NbHMGR and NbHMGS, activating the expression of all genes in the MVA pathway. Transient overexpression of NbMYB159 in Nicotiana benthamiana significantly increases the content of endogenous FPP. Stable overexpression lines significantly increase the content of endogenous FPP in Nicotiana benthamiana without affecting its biomass, while transcriptional repression overexpression lines significantly reduce FPP content. This discovery is of great significance for the engineering modification of the Nicotiana benthamiana chassis and can effectively solve the problem of low production efficiency of sesquiterpenes and triterpenoids in Nicotiana benthamiana.

[0006] To solve the aforementioned technical problem, the technical solution adopted by the present invention is as follows: This invention provides an application of the NbMYB159 gene in the positive regulation of the MVA metabolic pathway of Nicotiana benthamiana, and the nucleotide sequence of the NbMYB159 gene is shown in SEQ ID NO: 1.

[0007] As a preferred option, the NbMYB159 gene can enhance the metabolic flux of the MVA pathway by activating the expression of key structural genes in the Nicotiana benthamiana MVA pathway.

[0008] Preferably, the key structural genes in the Nicotiana benthamiana MVA pathway include NbAACT, NbHMGS, NbHMGR, NbMK, NbPMK, NbMPDC, and NbFPS.

[0009] As a preferred embodiment, the NbMYB159 gene activates the expression of key structural genes in the Nicotiana benthamian MVA pathway by specifically binding to the promoter regions of the NbHMGR and NbHMGS genes.

[0010] In a second aspect, the present invention provides a method for constructing the above-mentioned NbMYB159 gene overexpression vector, comprising the following steps: according to NbMYB159 Full-length primers were designed, and using Nicotiana benthamiana cDNA as a template, PrimeSTAR HS DNA high-fidelity enzyme was used for sequencing. NbMYB159 The full-length sequence was amplified, and the overexpression vector PCHF3 was linearized using NEB restriction endonucleases KpnI and BamHI. The target gene fragment was then constructed into the PCHF3 vector using homologous recombination ligation.

[0011] As a preferred option, according to NbMYB159 The primers designed for the full-length sequence are: NbMYB159 -F: ATGGATCATCACCATGTTAA; N bMYB159 -R:TCAATAATTTTCACTCATTC.

[0012] In a third aspect, the present invention provides an NbMYB159 gene overexpression vector, wherein the NbMYB159 gene overexpression vector is constructed using the above-described method for constructing an NbMYB159 gene overexpression vector.

[0013] In a fourth aspect, this invention provides a method for constructing a transgenic Nicotiana benthamiana plant with high FPP content, comprising the following steps: The NbMYB159 gene overexpression vector was transferred into Nicotiana benthamiana plants using Agrobacterium-mediated leaf disc transformation. Positive strains were then screened and seeded to obtain progeny plants. The α-bisabolol synthase gene was transiently expressed in the progeny plants. By detecting the α-bisabolol content in the progeny plants, transgenic Nicotiana benthamiana plants with high FPP content were screened.

[0014] Furthermore, the method for constructing the transgenic Nicotiana benthamiana plant with high FPP content includes the following steps: The NbMYB159 gene overexpression vector was transferred into Nicotiana benthamiana plants using Agrobacterium-mediated leaf disc transformation. Positive strains were then screened and seeded. When the T1 generation reached 4 weeks of growth, the α-bisabolol synthase gene MrBBS was transiently overexpressed. The α-bisabolol content was detected 4 days later, and transgenic Nicotiana benthamiana plants with high FPP content were screened out.

[0015] In a fifth aspect, the present invention provides the application of the NbMYB159 gene in the preparation of growth regulators that increase the FPP content of Nicotiana benthamiana plants.

[0016] Preferably, the agent that promotes tobacco plant growth is a microbial inoculant or a microbial fertilizer.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides an application of the NbMYB159 gene in the positive regulation of the MVA metabolic pathway in Nicotiana benthamiana. It was found that NbMYB159 can specifically bind to the promoter regions of NbHMGR and NbHMGS, activating the expression of all genes in the MVA pathway. Transient overexpression of NbMYB159 in Nicotiana benthamiana significantly increases the content of endogenous FPP. Stable overexpression lines significantly increase the content of endogenous FPP in Nicotiana benthamiana without affecting its biomass, while transcriptional repression overexpression lines significantly reduce FPP content. This finding is of great significance for the engineering modification of the Nicotiana benthamiana chassis and can effectively solve the problem of low production efficiency of sesquiterpenes and triterpenes in Nicotiana benthamiana. Attached Figure Description

[0018] Figure 1 This is a diagram showing the effect of transient overexpression of the NbMYB159 gene on the accumulation of α-bisabolol and the expression levels of MVA pathway genes, as provided in an embodiment of the present invention. Figure 2 The dual-luciferase reporter and yeast one-hybrid experiments provided in this embodiment of the invention verify the interaction diagram between NbMYB159 and the NbHMGR and NbHMGS promoters; Figure 3 This is a graph showing the biomass of the NbMYB159 overexpression line and its effect on α-bisabolol accumulation, provided in an embodiment of the present invention. Figure 4 The figure shows the identification of the NbMYB159-SRDX overexpression line and its effect on α-bisabolol accumulation, provided in the embodiments of the present invention. Detailed Implementation

[0019] The technical solutions in specific embodiments of the present invention will now be described in detail and completely with reference to the accompanying drawings. Obviously, the described embodiments are merely some specific implementations of the overall technical solution of the present invention, and not all implementations. Based on the overall concept of the present invention, all other embodiments obtained by those skilled in the art fall within the protection scope of the present invention.

[0020] Example 1: Effects of the NbMYB159 gene on the MVA metabolic pathway in Nicotiana benthamiana 1.1 Obtaining the NbMYB159 gene sequence RNA was extracted from tobacco leaves and reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser. The reverse transcription system consisted of: 1 μL Oligo dT (18T) Primer (50 μM), 1 μL dNTP Mix (10 mM each), 5 μg RNA, and RNase-free water to a total volume of 10 μL. The reaction program was 65℃ for 5 min. After denaturation and annealing, 10 μL of the reaction buffer, 4 μL of 5X RTase Plus Reaction Buffer, and 0.5 μL of RNase Inhibitor were added. Evo M-MLV Add 1 μL of RTase (200 U / μL) and make up the total volume to 20 μL with RNase-free water. Reaction program: 42℃ for 60 min, 95℃ for 5 min. NbMYB159 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, according to NbMYB159 Full-length sequence primer design: NbMYB159 -F: ATGGATCATCACCATGTTAA; N bMYB159 -R:TCAATAATTTTCACTCATTC; Using PrimeSTAR HS DNA high-fidelity enzyme NbMYB159 Full-length sequence amplification. Reaction system: 2×Phanta® Max Master Mix 25μL. NbMYB159 -F 2μL, NbMYB159 -R 2μL, cDNA 1μL, ddH2O 20μL, reaction program: 95℃ 3min; 95℃ 15s, 55℃ 15s, 72℃ 3s, 35 PCR cycles, 72℃ 7min. The amplified products were subjected to agarose gel electrophoresis. After electrophoresis, the amplified products were... EasyPure ® The Quick Gel Extraction Kit is used to recover the target band. Refer to the instruction manual for detailed gel recovery procedures.

[0021] 1.2 Synthesis of the MrBBS gene sequence MrBBS The gene is obtained through gene synthesis, and the nucleotide sequence of the gene is shown in SEQ ID No. 2.

[0022] 1.3 NbMYB159 and MrBBS Construction of gene transient overexpression vectors The transient overexpression vector pEAQ-HT was linearized using NEB restriction endonucleases Age I and Xho I. The reaction mixture consisted of 1 μg pEAQ-HT vector, 1 μL Age I, 1 μL Xho I, 5 μL 10X NEB Buffer, and ddH2O to a final volume of 50 μL. The reaction program was 37℃ for 2 h. The NbMYB159 and MrBBS gene fragments were then constructed into the pEAQ-HT vector using the T4 ligation method, yielding... NbMYB159 Transient overexpression vectors and MrBBS Transient overexpression vector for genes. Reaction system: 2 μL linearized pEAQ-HT vector, 10 μL gene fragment, 1 μL T4 DNA Ligase, 2 μL 10X T4 DNA Ligase Buffer, 5 μL ddH2O. Reaction program: incubate at room temperature for 30 min.

[0023] 1.4 Transformation of Agrobacterium competent GV3101 cells The built NbMYB159 Transient overexpression vectors and MrBBS The gene transient overexpression vector was transformed into Agrobacterium GV3101. Transformation procedure: (1) Take out Agrobacterium competent cells GV3101 or GV3101 containing pSoup (for dual luciferase reporter assay) from the -80℃ freezer and place them on ice to thaw.

[0024] (2) Add 1 μL of plasmid to every 50 μL of competent cells, gently stir the bottom of the centrifuge tube with your finger to mix the plasmid thoroughly, and place on ice for 5 min.

[0025] (3) Place the centrifuge tube on a floating plate, put it in liquid nitrogen for 5 min, then put it in 37℃ for 5 min, and then put it in an ice water bath for 5 min.

[0026] (4) Add 700 μL of antibiotic-free LB liquid medium and incubate in a constant temperature shaker at 28℃ and 220 rpm for 3h.

[0027] (5) Take 50 μL of the cultured bacterial solution and spread it on the corresponding antibiotic YEP plate in the ultra-clean workbench. Place it in a 28℃ constant temperature incubator and incubate for 3 days until colonies grow.

[0028] 1.5 NbMYB159 and MrBBS Culture of Agrobacterium tumefaciens (1) In the clean bench, use the nozzle to pick up the identified samples. NbMYB159 and MrBBSPositive monoclonal Agrobacterium was dipped into a 5 mL sterile centrifuge tube containing 1 mL YEP liquid medium (containing 50 μg / mL rifampin + 50 μg / mL kanamycin) and incubated overnight at 28℃ and 220 rpm for 18-20 h. (2) Take 50 μL of the overnight culture into 15 mL of YEP liquid medium containing antibiotics and incubate overnight at 28°C and 220 rpm for 18 h. (3) Centrifuge at 6000 rpm for 10 min, collect the bacterial cells, discard the supernatant, and try to remove the supernatant completely. Add a certain amount of resuspension to adjust the OD. 600 Up to 0.6; (4) After the bacterial resuspension, it is placed in the dark for 3 hours to avoid light and then prepared for injection.

[0029] 1.6 NbMYB159 Transcription factors increase α-bisabolol production When the tobacco plant reached 4 weeks of growth, the experimental group was momentarily injected with a total of [missing information - likely referring to a specific substance or method] onto the leaves. NbMYB159 Agrobacterium bacterial culture (OD) 600 =0.6) and MrBBS (α-bisabolol synthase gene) Agrobacterium bacterial culture (OD) 600 =0.6) 1mL of mixture, Agrobacterium tumefaciens bacterial suspension (OD) 600 =0.6) and MrBBS (α-bisabolol synthase gene) Agrobacterium bacterial culture (OD) 600 The volume ratio of (=0.6) was 1:1, and the control group was injected only. MrBBS Agrobacterium bacterial culture (OD) 600 =0.6) 1mL.

[0030] Four days later, 0.15 g of leaves were collected, and α-bisabolol was extracted with 1.5 mL of n-hexane by shaking. The extract was then analyzed by HPLC. Three biological replicates were set up for the experiment. HPLC detection conditions: column: C18 column (250 mm × 4.6 mm, 5 μm); mobile phase: acetonitrile-water (80:20, v / v); flow rate: 1.0 mL / min; column temperature: room temperature; detection wavelength: 200 nm; injection volume: 10 μL; run time: 20 min.

[0031] like Figure 1 As shown in A, a total of injections were performed. NbMYB159 It can significantly increase the accumulation of α-bisabolol, reaching 3 times that of the control.

[0032] 1.7 NbMYB159 Regulatory mechanisms of the MVA pathway To explore in depth NbMYB159Regarding the regulatory mechanism of the MVA pathway, we injected it separately. NbMYB159 Agrobacterium bacterial culture (OD) 600 =0.6) 1mL, and samples of tobacco leaves were collected at 0h, 3h, 6h, 9h, 12h and 24h after injection. The control group was injected with 1mL of empty vector. RNA was extracted and the expression changes of 7 key metabolic enzyme genes were detected by qRT-PCR.

[0033] Design qRT-PCR primers: qNbMYB159-F: GCATTTAAGGATACCATGCGT, qNbMYB159-R: CTTGGCTTATTAACAGCGTTGT; Internal control primers: qNbActin-F: CGGAATCCACGAGACTACATAC, qNbActin-R: GGGAAGCCAAGATAGAGC. qRT-PCR was performed using the Taq Pro Universal SYBR qPCR Master Mix kit. The reaction mixture consisted of 10 μL of 2 × Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL of Primer 1 (10 μM), 1 μL of cDNA, and 8.2 μL of RNase-free ddH2O. The reaction program was as follows: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, 95℃ for 15 s, 60℃ for 1 min, for 40 cycles of 95℃ for 15 s and 60℃ for 15 s.

[0034] like Figure 1 As shown in BH, the expression levels of all genes were significantly upregulated, and generally reached their peak at 6 h after injection: NbAACT Increased by approximately 17 times. NbHMGS Increased by approximately 197 times. NbHMG Increased by approximately 137 times. NbMK Increased by approximately 50 times. NbPMK Increased by approximately 14 times. NbMPDC Increased by approximately 17 times. NbFPS It increased by approximately 25 times. The above results indicate that... NbMYB159 It can significantly activate the expression of multiple key structural genes in the MVA pathway, enhance the metabolic flux of this pathway, and thus effectively increase the amount of FPP synthesized in Nicotiana benthamiana.

[0035] Example 2: Mechanism of action of NbMYB159 in enhancing metabolic flux in the MVA pathway In order to investigate NbMYB159The mechanism of action of enhancing metabolic flux in the MVA pathway was investigated using a dual-luciferase reporter assay in Nicotiana benthamiana. pGreen II 62-SK was digested with restriction endonuclease XbaI, and pGreen II 0800-LUC was digested with restriction endonuclease PstI. The digestion method was the same as that used in Example 1 for digesting the transient overexpression vector pEAQ-HT. The vector pGreen II 62-SK:: was constructed using homologous recombination. NbMYB159 , pGreen Ⅱ 0800-LUC:: pNbHMGR and pGreen Ⅱ 0800-LUC:: pNbHMGS, Homologous recombination method: The ClonExpress Ultra One Step Cloning Kit was used. The reaction mixture consisted of 5 μL of 2×ClonExpress Mix, 3 μL of linearized vector, and 2 μL of gene fragment. The reaction program was 50℃ for 15 min. After constructing the vector, it was transformed into Agrobacterium GV3101 (pSoup). pNbHMGR The nucleotide sequence of the gene is shown in SEQ ID NO: 3. pNbHMGS The nucleotide sequence of the gene is shown in SEQ ID NO: 4. It was then prepared according to the methods described in 1.4-1.5 of Example 1. NbMYB159 Agrobacterium bacterial culture (OD) 600 =0.6), pNbHMGR Agrobacterium bacterial culture (OD) 600 =0.6) and pNbHMGS Agrobacterium bacterial culture (OD) 600 =0.6).

[0036] When the tobacco plant reached 4 weeks of growth, 100 μL of Agrobacterium-Bacillus bacterial suspension with different combinations was injected into the leaves, including: pNbHMGR Treatment group injected 50 μL pNbHMGR Agrobacterium bacterial culture (OD) 600 =0.6) + 50 μL pGreen II 62-SK empty-carrying Agrobacterium bacterial suspension (OD 600 =0.6); NbMYB159 group injection 50μL NbMYB159 Agrobacterium bacterial culture (OD) 600 =0.6) + 50 μL pGreen Ⅱ 0800-LUC empty-carrying Agrobacterium bacterial suspension (OD 600 =0.6); pNbHMGR+NbMYB159 Group injection of 50μL pNbHMGR Agrobacterium bacterial culture (OD) 600 =0.6) + 50μL NbMYB159 Agrobacterium bacterial culture (OD) 600 =0.6); pNbHMGS group Inject 50μL pNbHMGS Agrobacterium bacterial culture (OD) 600 =0.6) + 50 μL pGreen II 62-SK empty-carrying Agrobacterium bacterial suspension (OD 600 =0.6); pNbHMGS+NbMYB159 Group injection of 50μL pNbHMGS Agrobacterium bacterial culture (OD) 600 =0.6) + 50μL NbMYB159 Agrobacterium bacterial culture (OD) 600 =0.6).

[0037] Two days later, the leaves of *Nicotiana benthamiana* were harvested, and the undersides of the leaves were immersed in a D-luciferase sodium solution for 4 minutes in the dark. Afterward, they were placed in a ChemiDoc Western blot imaging analyzer and photographed using a low-light cooled CCD imaging system. Following the photographs, a subset of leaves was taken for luciferase activity assay. The luciferase activity assay was performed using the Dual Luciferase Reporter Gene Assay Kit; detailed operating procedures are described in the kit's instruction manual. Figure 2 A shows a schematic diagram of the carrier, which is... Figure 2 (BE) shows that NbMYB159 Co-expression with reporter plasmids can both activate fluorescence signals, indicating that... NbMYB159 yes NbHMGR and NbHMGS Direct transcriptional activation of genes.

[0038] To further verify NbMYB159 To investigate whether it can directly bind to the promoters of the two genes mentioned above, a yeast one-hybrid experiment was conducted.

[0039] pB42AD was digested with restriction endonucleases EcoRI and XhoI, and pLaczizu was digested with restriction endonucleases EcoRI and XhoI. Homologous recombination was then used to... NbMYB159 Constructed in the transcriptional activation domain vector pB42AD, and simultaneously... NbHMGR and NbHMGS The promoter fragments were cloned into cells containing reporter genes. lacZ The pLacZi vectors were used to construct yeast monohybrids. The vectors pB42AD::NbMYB159(Prey), pLaczizu::pNbHMGR(Bait), and pLaczizu::pNbHMGS(Bait) were used. The vector digestion and homologous recombination methods were the same as above. Prey and Bait were co-transformed into yeast EGY48, and after identifying positive colonies, the cells were cultured in SD / -Trp / Ura liquid medium until OD2000. 600=0.2, diluted 10 times with 0.9% NaCl solution, and 10 μL was taken into the corresponding SD / -Trp / Ura and SD / -Trp / Ura / Gal / Raf / X-Gal plates. The plates were placed in a 30℃ incubator and incubated in the dark for 3 days. The color change was observed, with the empty plate as a control.

[0040] The results show that ( Figure 2 F and Figure 2 G), on X-Gal-deficient medium (SD / -Trp / -Ura / Raf / X-Gal), yeast strains co-transformed with pB42AD-NbMYB159 and pLacZi containing the promoter fragment showed blue spots, while the negative control group showed no color change. This result further validates that NbMYB159 can specifically bind to... NbHMGR and NbHMGS It activates the promoter region and downstream gene expression.

[0041] Example 3: Biomass of NbMYB159 overexpression lines and its effect on α-bisabolol accumulation according to NbMYB159 Full-length sequence primer design: NbMYB159 -F: ATGGATCATCACCATGTTAA; N bMYB159 -R: TCATAATTTTCACTCATTC; Using Nicotiana benthamiana cDNA as a template, and employing PrimeSTAR HS DNA high-fidelity enzyme... NbMYB159 The full-length sequence was amplified, and the overexpression vector PCHF3 was linearized using NEB restriction endonucleases KpnI and BamHI. The target gene fragment was then constructed into the PCHF3 vector using homologous recombination ligation. Figure 3 A), transforming Agrobacterium and then transforming Nicotiana benthamiana using the leaf disc method.

[0042] Conversion method: (1) Pre-culture of Nicotiana benthamiana: Disinfect Nicotiana benthamiana seeds with 75% alcohol for 30 s in a clean bench, then rinse with sterile water for 1 min, disinfect with 84 disinfectant for 4 min, and then rinse with sterile water for 1 min each time, for a total of 3 times. After that, place the seeds on the culture medium and culture at 23℃ for 16 h / 8 h light / dark for 4-5 weeks. Cut the leaves into small pieces and place them on the pre-culture medium.

[0043] (2) Agrobacterium infection and co-culture: After tobacco leaves were cultured in the pre-medium for 3 days, they were inoculated into OD. 600 Infect with Agrobacterium resuspension at 0.2 for 15 min, wipe dry with filter paper, and incubate in the dark for 3 days.

[0044] (3) Induction: Transfer the leaves to the induction medium for about 10 days to induce the formation of callus.

[0045] (4) Screening: Select callus tissue and inoculate it on resistance screening medium, and culture at 24℃ for 24 days.

[0046] (5) Differentiation and rooting: Positive callus tissue was picked and cultured on differentiation medium at 23℃ for 16h / 8h light / dark for 24d. After seedling formation, the seedlings were inoculated onto seedling strengthening medium and grown for 10d. Genomic DNA was extracted from the obtained overexpressing plants and PCR amplified with the marker gene Kan. Kan-F: GATGGATTGCACGCAGGTTC, Kan-R: GGCCACAGTCGATGAATCCA. The amplification program was: 95℃ for 3min; 95℃ for 15s, 55℃ for 15s, 72℃ for 30s, 35 PCR cycles, 72℃ for 7min. Sixteen positive lines were screened ( Figure 3 B).

[0047] RNA was extracted from the screened positive lines, and the expression level of NbMYB159 was identified by qRT-PCR. OE_6 and OE_9 showed the highest fold-up expression, upregulated by 2168 and 1727 times, respectively. Figure 3 C). To clarify whether overexpression of NbMYB159 has an adverse effect on the growth of Nicotiana benthamiana, the growth status of Nicotiana benthamiana was observed after approximately 5 weeks of natural growth. It was found that there was no significant difference between the overexpressing strain and the wild type. Figure 3 D). Aboveground height of overexpressing lines ( Figure 3 E) and fresh weight of above-ground parts ( Figure 3 F) showed no significant difference compared to the wild type. When *Nicotiana benthamiana* reached 4 weeks of growth, the content of α-bisabolol was measured 4 days after transient overexpression of MrBBS. Figure 3 (G) It was found that overexpression lines of OE_6 and OE_9 significantly increased the yield of α-bisabolol, indirectly indicating that the FPP content in OE_6 and OE_9 was significantly higher than that in the wild type.

[0048] Example 4: Inhibitory effect of NbMYB159-SRDX overexpression on metabolic flux in the MVA pathway NbMYB159 was fused with SRDX (transcriptional repressor domain), the SRDX sequence of which is shown in SEQ ID NO: 5. The overexpression vector PCHF3 was linearized using NEB restriction endonucleases KpnI and BamHI. The target gene fragment was then constructed into the PCHF3 vector using homologous recombination ligation. Figure 4A). SRDX transcriptional repression technology is an artificial transcriptional repression strategy commonly used in plant functional gene research. This technique constructs a chimeric transcriptional repressor by fusing a target transcription factor with a potent transcriptional repressor domain, thereby endowing the activating transcription factor with the ability to repress the expression of the target gene. Genomic DNA is extracted from the obtained overexpressing plants to mark the gene. Kan PCR amplification was performed, and 15 positive strains were screened. Figure 4 B). The transformation and screening methods are the same as in Example 3. RNA was extracted from the screened positive lines and identified by qRT-PCR. NbMYB159-SRDX The expression levels of OE_7 and OE_9 were the highest, upregulated by 951 and 1320 times, respectively. Figure 4 C). Transient overexpression occurred when *N. benthamiana* reached 4 weeks of growth. MrBBS Four days later, the content of α-bisabolol was measured, and it was found that the yield of α-bisabolol was significantly reduced in the OE_7 and OE_9 overexpression lines. Figure 4 D) indirectly indicates that the FPP content in OE_7 and OE_9 is significantly lower than that in the wild type, suggesting that NbMYB159-SRDX Overexpression inhibits metabolic flux through the MVA pathway.

Claims

1. Application of NbMYB159 gene in positively regulating MVA metabolic pathway of Nicotiana benthamiana, characterized in that, The nucleotide sequence of the NbMYB159 gene is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, The NbMYB159 gene can enhance the MVA pathway metabolic flow by activating the expression of key structural genes in the MVA pathway of N. benthamiana.

3. Use according to claim 2, characterized in that, The key structural genes in the MVA pathway of N. benthamiana include NbAACT, NbHMGS, NbHMGR, NbMK, NbPMK, NbMPDC and NbFPS.

4. Use according to claim 3, characterized in that, The NbMYB159 gene activates the expression of key structural genes in the MVA pathway of N. benthamiana by specifically binding to the promoter regions of NbHMGR gene and NbHMGS gene.

5. A method for constructing a NbMYB159 gene overexpression vector, characterized in that, The method comprises the following steps: According to NbMYB159 The primers were designed according to the full-length sequence, and the cDNA of N. benthamiana was used as a template. PrimeSTAR HS DNA high-fidelity enzyme was used for amplification NbMYB159 The full-length sequence was amplified, and the overexpression vector PCHF3 was linearized using NEB restriction endonuclease KpnI and BamHI. The target gene fragment was constructed into PCHF3 vector by homologous recombination ligation.

6. The construction method of claim 5, wherein, According to NbMYB159 Primers for full-length sequence design were: NbMYB159 F: ATGGATCATCACCATGTTAA; N bMYB159 - R: TCAATAATTTTCACTCATTC.

7. A NbMYB159 gene overexpression vector, characterized in that, The NbMYB159 gene overexpression vector is constructed by the method for constructing the NbMYB159 gene overexpression vector according to claim 5 or 6.

8. A method of constructing a transgenic N. benthamiana plant with high FPP content, characterized in that, The method comprises the following steps: The NbMYB159 gene overexpression vector is transformed into N. benthamiana plants by means of leaf disc transformation mediated by Agrobacterium strains for overexpression, and then positive strains are screened and seeds are collected, and offspring plants are cultivated and obtained, and the alpha-bisabolol synthase gene is transiently expressed in the offspring plants, and the transgenic N. benthamiana plants with high FPP content are screened by detecting the content of alpha-bisabolol in the offspring plants.

9. The construction method of claim 8, wherein, The method comprises the following steps: The NbMYB159 gene overexpression vector is transformed into N. benthamiana plants by means of leaf disc transformation mediated by Agrobacterium strains for overexpression, and then positive strains are screened and seeds are collected, and the alpha-bisabolol synthase gene MrBBS is transiently overexpressed when the T1 generation grows to 4 weeks, and the content of alpha-bisabolol is detected after 4 days, and the transgenic N. benthamiana plants with high FPP content are screened.

10. Application of NbMYB159 gene in preparing a growth preparation for increasing the FPP content of N. benthamiana plants.