A kit for auxiliary diagnosis of benign and malignant thyroid nodules

Abstract

This invention discloses an auxiliary diagnostic kit for benign and malignant thyroid nodules, belonging to the technical field of diagnostic kits. The kit includes a primer-probe combination comprising BRAF V600E, TERT C228T, TERT C250T, RET M918T, CCDC6-RET, and NCOA4-RET. The kit provides high sensitivity and a short detection time, capable of detecting 0.5% mutant DNA and 25 copies of RNA at a concentration of 2 ng / μl, with a detection time reduced to 1 hour and 40 minutes. Optimization of the detection site can further improve the detection sensitivity to 88.15% and the specificity to 96.92%.

Description

Technical Field

[0001] This invention relates to the field of reagent kit technology, specifically to a reagent kit for the auxiliary diagnosis of benign and malignant thyroid nodules. Background Technology

[0002] Thyroid cancer (TC) is a common malignant tumor of the endocrine system and head and neck. Currently, fine needle aspiration (FNA) of the thyroid is considered the most reliable and cost-effective diagnostic tool for determining the nature of thyroid nodules. However, due to the overlap in cellular morphological features between benign and some malignant nodules, FNA can still cause a significant degree of diagnostic uncertainty, especially in the TBSRTC classification of atypia / follicular lesions of indeterminate significance (AUS / FLUS, category III), follicular tumors / suspicious follicular tumors (FN / SFN, category IV), and malignant tumors (category V). Therefore, indeterminate diagnoses in categories III to V pose a significant challenge to clinicians.

[0003] In recent years, molecular biology techniques have developed rapidly, and multi-gene mutation detection has shown great potential in the diagnosis, prognostic assessment, and personalized treatment of thyroid cancer.

[0004] Currently, the gold standard for gene mutation detection in clinical practice is Sanger sequencing. While it offers advantages such as low cost and easily analyzable results, its low sensitivity and long processing time fail to meet clinical needs. ARMS-PCR technology, compared to Sanger, boasts high sensitivity (<1%) and a short processing time (<2 hours), gradually becoming a new method for gene mutation detection in clinical practice. Currently, there is a patent (CN118109593A) related to the use of ARMS-PCR for the assessment of benign and malignant thyroid nodules; however, the kit requires a DNA concentration greater than 5 ng / μL, an RNA copy number greater than 100 copies, and a limited number of detection sites, leading to reduced sensitivity.

[0005] Therefore, there is an urgent need to provide a diagnostic kit for benign and malignant thyroid nodules with high detection sensitivity. Summary of the Invention

[0006] The purpose of this invention is to provide a diagnostic kit for benign and malignant thyroid nodules.

[0007] To achieve the above-mentioned objectives, the technical solution of the present invention is as follows:

[0008] On one hand, the present invention provides an auxiliary diagnostic kit for benign and malignant thyroid nodules, comprising a primer-probe combination; the primer-probe combination includes: The forward primer sequence of BRAF V600E is shown in SEQ ID NO:2, the reverse primer sequence of BRAF V600E is shown in SEQ ID NO:3, and the probe sequence of BRAF V600E is shown in SEQ ID NO:4. The forward primer sequence of TERT C228T is shown in SEQ ID NO:7, the reverse primer sequence of TERT C228T is shown in SEQ ID NO:8, and the probe sequence of TERT C228T is shown in SEQ ID NO:9. The forward primer sequence of TERT C250T is shown in SEQ ID NO:10, the reverse primer sequence of TERT C250T is shown in SEQ ID NO:11, and the probe sequence of TERT C250T is shown in SEQ ID NO:12. The forward primer sequence of RET M918T is shown in SEQ ID NO:15, the reverse primer sequence of RET M918T is shown in SEQ ID NO:16, and the probe sequence of RET M918T is shown in SEQ ID NO:17. The forward primer sequence of CCDC6-RET is shown in SEQ ID NO:23, the reverse primer sequence of CCDC6-RET is shown in SEQ ID NO:24, and the probe sequence of CCDC6-RET is shown in SEQ ID NO:25. The forward primer sequence of NCOA4-RET is shown in SEQ ID NO:27, the reverse primer sequence of NCOA4-RET is shown in SEQ ID NO:24, and the probe sequence of NCOA4-RET is shown in SEQ ID NO:25.

[0009] Specifically, the kit also includes primers and probes for internal controls; The forward primer sequence of the ACTB DNA internal control is shown in SEQ ID NO:19, the reverse primer sequence of the ACTB DNA internal control is shown in SEQ ID NO:20, and the probe sequence of the ACTB DNA internal control is shown in SEQ ID NO:21. The forward primer sequence of the ABL RNA internal control is shown in SEQ ID NO:29, the reverse primer sequence of the ABL RNA internal control is shown in SEQ ID NO:30, and the probe sequence of the ABL RNA internal control is shown in SEQ ID NO:31.

[0010] Specifically, the kit also includes a BRAF V600E Blocker sequence and a TERT C250T Blocker sequence, the BRAF V600E Blocker sequence being shown in SEQ ID NO:5; and the TERT C250T Blocker sequence being shown in SEQ ID NO:13.

[0011] Furthermore, the probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

[0012] More preferably, the fluorescent reporter group is selected from at least one of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, Texas Red, NED, AMCA, Pacific Blue, Atto 425, BODIPY FL, Alexa Fluor 488, Yakima Yellow, Quasar 570, Aqua Phluor 593, Atto 590, and Cy5.5.

[0013] More preferably, the fluorescence quenching group is selected from at least one of 6-TAMRA, BHQ-1, BHQ-2, BHQ-3, Dabcyl, Eclipse, MGB, and QYS-7.

[0014] More preferably, the 5' end of the BRAF V600E probe is labeled with ROX; the 5' end of the TERT C228T probe is labeled with FAM; the 5' end of the TERT C250T probe is labeled with FAM; the 5' end of the CCDC6-RET probe is labeled with FAM; the 5' end of the NCOA4-RET probe is labeled with FAM; the 5' end of the ACTB DNA internal reference probe is labeled with HEX; and the 5' end of the ABL RNA internal reference probe is labeled with HEX.

[0015] More preferably, the 3' end of the BRAF V600E probe is labeled with BHQ1; the 3' end of the TERT C228T probe is labeled with BHQ1; the 3' end of the TERT C250T probe is labeled with MGB; the 3' end of the CCDC6-RET probe is labeled with MGB; the 3' end of the NCOA4-RET probe is labeled with MGB; the 3' end of the ACTB DNA internal reference probe is labeled with MGB; and the 3' end of the ABL RNA internal reference probe is labeled with MGB.

[0016] Specifically, the detection sites of the kit include any one or more of BRAF V600E, TERT C228T, TERT C250T, CCDC6-RET (E1-E12), NCOA4-RET (E8-E12), and RET M918T.

[0017] Further, the target sequence of BRAF V600E is shown in SEQ ID NO:1; the target sequence of TERT C228T is shown in SEQ ID NO:6; the target sequence of TERT C250T is shown in SEQ ID NO:6; the target sequence of RETM918T is shown in SEQ ID NO:14; the target sequence of CCDC6-RET is shown in SEQ ID NO:22; the target sequence of NCOA4-RET is shown in SEQ ID NO:26; the target sequence of the ACTB DNA internal control is shown in SEQ ID NO:18; and the target sequence of the ABL RNA internal control is shown in SEQ ID NO:28.

[0018] Specifically, the kit also includes Taq enzyme, dNTPs, and Mg. + .

[0019] Specifically, the kit also includes a PCR enhancer, which comprises 0.4-0.6M betaine and 1.5-2.5% DMSO by volume.

[0020] According to some embodiments of the present invention, the concentration of betaine in the PCR enhancer is 0.4M, 0.5M, 0.6M, or any value in between.

[0021] According to some embodiments of the present invention, the PCR enhancer includes DMSO in a volume percentage of 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, and any intermediate value range can be selected.

[0022] Preferably, the PCR enhancer comprises 0.5M betaine and 2.0% DMSO by volume.

[0023] The concentration ranges of each primer, probe, and blocker in the kit are as follows: The concentration of the forward primer sequence SEQ ID NO:2 for BRAF V600E is 0.2-0.6 μM; The reverse primer sequence for BRAF V600E is shown in SEQ ID NO:3, and its concentration is 0.2-0.6 μM. The probe sequence for BRAF V600E is shown in SEQ ID NO:4, and the concentration is 0.1-0.3 μM. The BRAF V600E Blocker sequence is shown in SEQ ID NO:5, and the concentration is 0.5-1.0 μM. The forward primer sequence for TERT C228T is shown in SEQ ID NO:7, and its concentration is 0.3-0.9 μM. The reverse primer sequence for TERT C228T is shown in SEQ ID NO:8, and its concentration is 0.3-0.9 μM. The probe sequence for TERT C228T is shown in SEQ ID NO:9, and the concentration is 0.2-0.6 μM. The forward primer sequence for TERT C250T is shown in SEQ ID NO:10, and its concentration is 0.2-0.6 μM. The reverse primer sequence for TERT C250T is shown in SEQ ID NO:11, and its concentration is 0.5-1.0 μM. The probe sequence of TERT C250T is as shown in SEQ ID NO:12, and the concentration is 0.2-0.6 μM; The TERT C250T Blocker sequence is shown in SEQ ID NO:13, and the concentration is 0.5-1.0 μM. The forward primer sequence for RET M918T is shown in SEQ ID NO:15, and the concentration is 0.1-0.3 μM. The reverse primer sequence for RET M918T is shown in SEQ ID NO:16, and the concentration is 0.5-1.0 μM. The probe sequence for RET M918T is shown in SEQ ID NO:17, and the concentration is 0.1-0.3 μM. The forward primer sequence for the ACTB DNA internal control is as shown in SEQ ID NO:19, and the concentration is 0.2-0.6 μM. The reverse primer sequence for the ACTB DNA internal control is shown in SEQ ID NO:20, and the concentration is 0.2-0.6 μM. The probe sequence for the ACTB DNA internal control is shown in SEQ ID NO:21, and its concentration is 0.1-0.3 μM. The forward primer sequence for CCDC6-RET is shown in SEQ ID NO:23, and the concentration is 0.2-0.6 μM. The reverse primer sequence for CCDC6-RET / NCOA4-RET is shown in SEQ ID NO:24, and the concentration is 0.2-0.6 μM. The probe sequence for CCDC6-RET / NCOA4-RET is shown in SEQ ID NO:25, and the concentration is 0.1-0.3 μM. The forward primer sequence for NCOA4-RET is shown in SEQ ID NO:27, and the concentration is 0.3-0.9 μM. The forward primer sequence for the ABL RNA internal control is shown in SEQ ID NO:29, and the concentration is 0.2-0.6 μM. The reverse primer sequence for the ABL RNA internal control is shown in SEQ ID NO:30, and the concentration is 0.2-0.6 μM. The probe sequence for the ABL RNA internal control is shown in SEQ ID NO:31, and the concentration is 0.1-0.3 μM.

[0024] Preferably, the concentrations of each primer, probe, and blocker in the kit are as follows: The concentration of the forward primer sequence SEQ ID NO:2 for BRAF V600E is 0.4 μM; The reverse primer sequence for BRAF V600E is shown in SEQ ID NO:3, and its concentration is 0.4 μM. The probe sequence for BRAF V600E is shown in SEQ ID NO:4, and the concentration is 0.2 μM. The BRAF V600E Blocker sequence is shown in SEQ ID NO:5, and the concentration is 0.8 μM. The forward primer sequence for TERT C228T is shown in SEQ ID NO:7, and its concentration is 0.6 μM. The reverse primer sequence for TERT C228T is shown in SEQ ID NO:8, and its concentration is 0.6 μM. The probe sequence of TERT C228T is shown in SEQ ID NO:9, and the concentration is 0.4 μM. The forward primer sequence for TERT C250T is shown in SEQ ID NO:10, and its concentration is 0.4 μM. The reverse primer sequence for TERT C250T is shown in SEQ ID NO:11, and its concentration is 0.8 μM. The probe sequence of TERT C250T is as shown in SEQ ID NO:12, and the concentration is 0.4 μM. The TERT C250T Blocker sequence is shown in SEQ ID NO:13 at a concentration of 0.8 μM. The forward primer sequence for RET M918T is shown in SEQ ID NO:15, and its concentration is 0.2 μM. The reverse primer sequence for RET M918T is shown in SEQ ID NO:16, and its concentration is 0.8 μM. The probe sequence for RET M918T is shown in SEQ ID NO:17, and the concentration is 0.2 μM. The forward primer sequence for the ACTB DNA internal control is as shown in SEQ ID NO:19, and the concentration is 0.4 μM. The reverse primer sequence for the ACTB DNA internal control is shown in SEQ ID NO:20, and the concentration is 0.4 μM. The probe sequence for the ACTB DNA internal control is shown in SEQ ID NO:21, and its concentration is 0.2 μM. The forward primer sequence for CCDC6-RET is shown in SEQ ID NO:23, and its concentration is 0.4 μM. The reverse primer sequence for CCDC6-RET / NCOA4-RET is shown in SEQ ID NO:24, and the concentration is 0.4 μM. The probe sequence for CCDC6-RET / NCOA4-RET is shown in SEQ ID NO:25, and the concentration is 0.2 μM. The forward primer sequence for NCOA4-RET is shown in SEQ ID NO:27, and the concentration is 0.6 μM. The forward primer sequence for the ABL RNA internal control is as shown in SEQ ID NO:29, and the concentration is 0.4 μM. The reverse primer sequence for the ABL RNA internal control is shown in SEQ ID NO:30, and the concentration is 0.4 μM. The probe sequence for the ABL RNA internal control is shown in SEQ ID NO:31, and the concentration is 0.2 μM.

[0025] The beneficial effects of this invention are as follows: The thyroid nodule benign and malignant auxiliary diagnostic kit provided by this invention has high sensitivity and short detection time. It can detect 0.5% DNA mutations and 25 copies of RNA at a concentration of 2 ng / μl, and the detection time is shortened to 1 hour and 40 minutes. By optimizing the detection sites—specifically, detecting BRAF gene V600E mutation, TERT promoter C228T mutation, TERT promoter C250T mutation, RET M918T mutation, CCDC6-RET(E1:E12) fusion, and NCOA4-RET(E8:E12) fusion—the detection sensitivity can be further improved to 88.15%, and the specificity to 96.92%. Attached Figure Description

[0026] Figure 1 The results are from DNA testing for different mutation frequencies of the TERT C228T mutation.

[0027] Figure 2 The results of DNA testing for different mutation frequencies of the TERT C250T mutation.

[0028] Figure 3 The results are from DNA testing for different mutation frequencies of the RET M918T mutation.

[0029] Figure 4 The results of DNA testing for different mutation frequencies of the BRAF V600E mutation.

[0030] Figure 5 Results of detection of CCDC6-RET fusion RNA with different copy numbers.

[0031] Figure 6 Results of detection of RNA with different copy numbers fused to NCOA4-RET. Detailed Implementation

[0032] To make the technical means, creative features, and achieved objectives and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention. Unless otherwise specified, the operating methods and equipment used in the following embodiments are conventional operating methods, and the materials and equipment used in each embodiment are the same.

[0033] Basic Implementation Reagent kit components: Primers and probes include: (1) Primers and probes for detecting the V600E site of the BRAF gene; (2) Primers and probes for detecting the C250T site of the TERT gene; (3) Primers and probes for detecting the C228T site of the TERT gene; (4) Primers and probes for detecting the M918T site of the RET gene; (5) Primers and probes for detecting the CCDC6-RET (E1:E12) fusion; (6) Primers and probes for detecting the NCOA4-RET (E8:E12) fusion; (7) Primers and probes for the DNA internal reference ACTB and the RNA internal reference ABL.

[0034] Primers and probes were all designed and synthesized in-house.

[0035] Reagents: Taq enzyme, dNTPs, Mg+, etc. were all purchased externally.

[0036] Instruments: ABI 7500 Real-Time PCR System (Thermo Scientific), SLAN-96S Real-Time PCR System (Shanghai Hongshi Medical Technology Co., Ltd.)

[0037] This kit utilizes ARMS-PCR technology, taking advantage of the lack of 3'→5' exonuclease activity in Taq DNA polymerase. Allele-specific elongation is controlled through 3' end primer design, and fluorescence signal values ​​are detected using TaqMan probes to distinguish between wild-type and mutant alleles. The 3' end nucleotide of the upstream primer is designed to be the same as the mutant site but different from the wild-type site. Under the action of Taq DNA polymerase, upstream primers that do not perfectly match the negative template will not form complete complementary base pairs, resulting in mismatches and no PCR product. Primers that match the positive template, however, will amplify the corresponding PCR product. A TaqMan probe is placed between the upstream and downstream primers. During PCR amplification, Taq DNA polymerase, with its 5'-3' exonuclease activity, cleaves the probe, and the fluorescent group on the probe generates a fluorescence signal that can be detected by the instrument. By optimizing the multiplex primer-probe combination, four reactions can be used to detect six sites, reducing sample volume.

[0038] Example 1: Detection Site Selection The selected detection sites are BRAF V600E, TERT C228T / C250T, CCDC6-RET (E1-E12), NCOA4-RET (E8-E12), and RET M918T.

[0039] Example 2 Primer and probe synthesis Primers and probes for the following gene sites were designed based on NCBI gene sequences: BRAF gene V600E site detection primers and probes; TERT gene C250T site detection primers and probes; TERT gene C228T site detection primers and probes; RET gene M918T site detection primers and probes; CCDC6-RET (E1:E12) fusion detection primers and probes; NCOA4-RET (E8:E12) fusion detection primers and probes; as well as DNA detection internal control ACTB and RNA detection internal control ABL primers and probes. All primers and probes were designed in-house and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0040] BRAF V600E site sequence: BRAF V600E target sequence (SEQ ID NO:1); BRAF V600E forward primer sequence (SEQ ID NO:2); BRAF V600E reverse primer sequence (SEQ ID NO:3); BRAF V600E probe sequence (SEQ ID NO:4): ROX-CAGACAACTGTTCAAACTGATGGGA-BHQ1.

[0041] BRAF V600E Blocker sequence (SEQ ID NO:5): TAGCTACAGTGAAATCTCGATG - C3 Spacer (the 9th position in the sequence is an LNA modification, and the 10th position in the sequence is a detection site).

[0042] TERT C228T site sequence: TERT C228T target sequence (SEQ ID NO:6); TERT C228T forward primer sequence (SEQ ID NO:7); TERT C228T reverse primer sequence (SEQ ID NO:8); TERT C228T probe sequence (SEQ ID NO:9): FAM-CGGACCCCGCCCCGTCCC-BHQ1.

[0043] TERT C250T site sequence: TERT C250T target sequence (SEQ ID NO:6); TERT C250T forward primer sequence (SEQ ID NO:10); TERT C250T reverse primer sequence (SEQ ID NO:11); TERT C250T probe sequence (SEQ ID NO:12): FAM-TTCCAGCTCCGCCTCC-MGB.

[0044] TERT C250T Blocker sequence (SEQ ID NO:13): GGACCCGGGAGGGGTC-C3 Spacer (the 9th position in the sequence is the LNA modification and detection site).

[0045] RET M918T site sequence: RET M918T target sequence (SEQ ID NO:14); RET M918T forward primer sequence (SEQ ID NO:15); RET M918T reverse primer sequence (SEQ ID NO:16); RET M918T probe sequence (SEQ ID NO:17); ACTB (DNA internal reference) site sequence: ACTB (DNA internal reference) target sequence (SEQ ID NO:18); ACTB (DNA internal reference) forward primer sequence (SEQ ID NO:19); ACTB (DNA internal reference) reverse primer sequence (SEQ ID NO:20); ACTB (DNA internal reference) probe sequence (SEQ ID NO:21): HEX-CAGTAGGTCTGAACAGACT-MGB.

[0046] CCDC6-RET fusion site sequence: CCDC6-RET target sequence (SEQ ID NO:22); CCDC6-RET forward primer sequence (SEQ ID NO:23); CCDC6-RET reverse primer sequence (SEQ ID NO:24); CCDC6-RET probe sequence (SEQ ID NO:25): FAM-CAAGAACCAAGTTCTTCCGA-MGB.

[0047] NCOA4-RET fusion site sequence: NCOA4-RET target sequence (SEQ ID NO:26); NCOA4-RET forward primer sequence (SEQ ID NO:27); NCOA4-RET reverse primer sequence (SEQ ID NO:24); NCOA4-RET probe sequence (SEQ ID NO:25): FAM-CAAGAACCAAGTTCTTCCGA-MGB.

[0048] ABL (RNA internal reference) fusion site sequence: ABL (RNA internal reference) target sequence (SEQ ID NO:28); ABL (RNA internal reference) forward primer sequence (SEQ ID NO:29); ABL (RNA internal reference) reverse primer sequence (SEQ ID NO:30); ABL (RNA internal reference) probe sequence (SEQ ID NO:31): HEX-TCCTCCGAGAGCCGCTT-MGB.

[0049] Example 3: Blocker enhances amplification specificity The BRAF V600E and TERT C250T primer-probe combination is prone to non-specific amplification in the detection of negative DNA. Corresponding blocks were designed to improve the specificity of the detection. The 3' ends of both blocks are modified to prevent extension. The Tm value of the blocks is 5-10°C higher than that of the primers, and both the blocks and the upstream primers have at least three overlapping bases.

[0050] 1. Cell DNA extraction Genomic DNA was extracted from GM12878, BCPAP, 8305C, and TPC-1 cells using a blood / cell / tissue genomic DNA extraction kit purchased from Tiangen Biotech (Beijing) Co., Ltd. (catalog number: DP304-03). BCPAP cell DNA contained the BRAF V600E mutation, 8305C cell DNA contained the TERT C250T mutation, and TPC-1 cell DNA contained the TERTC228T mutation. GM12878 cell DNA was negative. GM12878, TPC-1, and BCPAP cells were purchased from Shanghai Haling Biotechnology Co., Ltd., and 8305C cells were purchased from Changsha Aibiwei Biotechnology Co., Ltd.

[0051] 1×10 7 Add 2 ml of buffer GA to the corresponding cell pellet and vortex until completely resuspended. Add 2 ml of buffer GB, mix thoroughly by inverting, and incubate at 70°C for 20 min. The solution should become clear. Centrifuge to remove water droplets from the inner wall of the tube cap. Transfer the solution and flocculent precipitate from the previous step to adsorption column CB3 (place the adsorption column in the collection tube), 620 μl per tube. Centrifuge at 12000 rpm (-13400×g) for 30 sec, discard the waste liquid, and place the adsorption column CB3 back into the collection tube. Add 600 μl of wash buffer PW to the adsorption column CB3 (check that anhydrous ethanol has been added before use), centrifuge at 12000 rpm (-13400×g) for 30 sec, discard the waste liquid, and place the adsorption column CB3 back into the collection tube (repeat this step twice). Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm (-13400×g) for 2 min, and discard the waste liquid. Incubate the CB3 adsorption column at room temperature for 7 minutes to allow any residual wash solution to dry completely. Transfer the CB3 column to a clean centrifuge tube, add 60 μl of elution buffer TE dropwise to the center of the adsorption membrane, incubate at room temperature for 5 minutes, centrifuge at 12000 rpm (-13400 × g) for 2 minutes, and collect the solution in the centrifuge tube. Detect the DNA concentration using a UV spectrophotometer.

[0052] 2. Preparation of reference materials The extracted GM12878 cell DNA was diluted to 100 ng / μl using 1×TE buffer to obtain a negative DNA reference.

[0053] GM12878 cell DNA, BCPAP cell DNA, and 8305C cell DNA were diluted to 10 ng / μl using 1×TE buffer. Digital PCR was used to detect the frequencies of the BRAF V600E mutation in diluted BCPAP cell DNA and the TERT C250T mutation in diluted 8305C cell DNA. 2% V600E mutant DNA reference samples and 2% C250T mutant DNA reference samples were calculated and prepared according to the following formulas.

[0054] 2% V600E / C228T mutant DNA reference standard preparation formula: BCPAP cell DNA addition volume (μl) = reference preparation volume (μl) × 2% / BCPAP cell DNA BRAFV600E mutation frequency.

[0055] TPC-1 cell DNA addition volume (μl) = reference preparation volume (μl) × 2% / TPC-1 cell DNA TERTM918T mutation frequency.

[0056] GM12878 cell DNA addition volume (μl) = Reference preparation volume (μl) - BCPAP cell DNA addition volume (μl) - TPC-1 cell DNA addition volume (μl).

[0057] 2% C250T mutant DNA reference standard preparation formula: Volume of 8305C cell DNA added (μl) = Volume of reference preparation (μl) × 2% / TERTC250T mutation frequency of 8305C cell DNA.

[0058] GM12878 cell DNA addition volume (μl) = reference preparation volume (μl) - 8305C cell DNA addition volume (μl).

[0059] 3. Real-time fluorescence quantitative nucleic acid amplification detection 3.1 Preparation of reaction mixture Dilute primers and probes to 10 μM. Prepare V600E / C228T reaction mixture according to Table 1 and C250T reaction mixture according to Table 2. Vortex to mix and then centrifuge. 10× buffer (10 × Taq Buffer, Mg) 2+ The reagents, including Taq DNA polymerase (5 U / μl) and dNTP mix (10 mM each), were all high-purity, heat-resistant DNA polymerases (Taq DNA Polymerase, Mg...). 2+The internal component of plus Buffer (Catalog No.: P101-d1) was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0060] Table 1. Preparation of V600E / C228T reaction mixture

[0061] Table 2 Preparation of C250T reaction mixture

[0062] 3.2 Adding Samples and Blockers with Different Gradients Dilute the Blocker concentration to 10 μM, divide the V600E / C228T reaction mixture and the C250T reaction mixture into 8 tubes, and add 18 μL of the reaction mixture to each tube. Add 1 μL of negative DNA reference to tubes 1-4, followed by 0 μL, 1 μL, 2 μL, and 3 μL of BRAF V600E Blocker, respectively; add 1 μL of 2% V600E mutant DNA reference to tubes 5-8, followed by 0 μL, 1 μL, 2 μL, and 3 μL of BRAF V600E Blocker, respectively; add 1 μL of negative DNA reference to tubes 9-12, followed by 0 μL, 1 μL, 2 μL, and 3 μL of TERT C250T Blocker, respectively; add 1 μL of 2% C250T mutant DNA reference to tubes 13-16, followed by 0 μL, 1 μL, 2 μL, and 3 μL of TERT C250T Blocker, respectively; bring the volume of purified water in tubes 1-16 to 25 μL, vortex to mix, centrifuge, and transfer to an 8-segment array for PCR amplification.

[0063] 3.3 PCR Amplification Perform the PCR amplification reaction according to the following procedure: Table 3 Amplification Reaction Procedure

[0064] Instrument parameter settings: Select "Qualitative / Absolute Quantitative" for experiment type; select "FAM, ROX, HEX" for fluorescence channels; select "Use Hot Lid" for hot lid setting; select "Module Temperature Control" for temperature control method; select "Full Channel Scan" for channel scanning settings. When analyzing data, set the "Amplification Curve Algorithm" to "Absolute Fluorescence Method" before analyzing the experimental results.

[0065] 3.4 Results Analysis Simultaneous detection of 100 ng negative DNA reference and 10 ng 2% V600E / C228T mutant DNA reference showed that adding 1 μL of BRAF V600E Blocker to the V600E / C228T system increased the FAM Ct value of the negative DNA reference, while the FAM Ct value of the 2% V600E mutant DNA reference remained unaffected. Adding 2 μL of BRAF V600E Blocker rendered the FAM Ct value of the negative DNA reference undetectable, while the FAM Ct value of the 2% V600E mutant DNA reference remained unaffected. Adding 3 μL of BRAF V600E Blocker rendered the FAM Ct value of the negative DNA reference undetectable, while the FAM Ct value of the 2% V600E mutant DNA reference increased. These results indicate that adding 2 μL of BRAF V600E Blocker to the V600E / C228T system yields the best results, improving specificity without affecting sensitivity.

[0066] Adding 1 μL of TERT C250T Blocker to the C250T system increased the FAM Ct value of the negative DNA reference, while the FAM Ct value of the 2% C250T mutant DNA reference remained unaffected. Adding 2 μL of TERT C250T Blocker further increased the FAM Ct value of the negative DNA reference, while the FAM Ct value of the 2% C250T mutant DNA reference remained unaffected. Adding 3 μL of TERT C250T Blocker rendered the FAM Ct value of the negative DNA reference undetectable, while the FAM Ct value of the 2% C250T mutant DNA reference increased. These results indicate that adding 2 μL of TERT C250T Blocker to the C250T system yields the best results, improving specificity without affecting sensitivity. The detection results are shown in Table 4.

[0067] Table 4 Blocker enhances amplification specificity

[0068] Example 4: PCR enhancers improve the detection sensitivity of high GC fragments The kit detects TERT C228T and C250T sites located in the high GC region of the promoter, with the amplified fragment containing approximately 80% GC. Ordinary amplification enzymes have low amplification efficiency and low detection sensitivity in high GC regions. This invention, by optimizing the ratio of betaine and DMSO to formulate a PCR enhancer, can significantly improve the detection sensitivity of high GC fragments.

[0069] 1. Cell DNA extraction DNA was extracted from GM12878, BCPAP, 8305C, TPC-1, M918T cells (cell pellet of RET p.M918T Reference Standard), and 293T cells according to the cell DNA extraction procedure in Example 3.

[0070] 2. Preparation of reference materials For details on the preparation of 2% V600E / C228T mutant DNA reference, 2% C250T mutant DNA reference, and negative DNA reference, please refer to the reference preparation in Example 3.

[0071] Calculate and prepare a 2% M918T mutant DNA reference sample according to the following formula.

[0072] 2% M918T mutant DNA reference standard preparation formula: M918T cell DNA addition volume (μl) = reference preparation volume (μl) × 2% / M918T cell DNA RETM918T mutation frequency.

[0073] GM12878 cell DNA addition volume (μl) = reference preparation volume (μl) - M918T cell DNA addition volume (μl).

[0074] 3. Real-time fluorescence quantitative nucleic acid amplification detection 3.1 Preparation of reaction mixture Dilute the primers and probes to 10 μM, prepare the V600E / C228T reaction mixture according to Table 5, the C250T reaction mixture according to Table 6, and the M918T reaction mixture according to Table 7. Vortex mix and then centrifuge.

[0075] Table 5. Preparation of V600E / C228T reaction mixture

[0076] Table 6. Preparation of C250T Reaction Mixture

[0077] Table 7 Preparation of M918T Reaction Mixture

[0078] 3.2 Effects of different gradients of betaine and DMSO on the detection reaction After diluting betaine to a concentration of 5M, the effects of adding 0 μL, 1.25 μL, 2.5 μL, and 5 μL of sample were tested on the V600E / C228T, C250T, and M918T reaction systems. The effects of adding 0 μL, 0.25 μL, 0.5 μL, and 1 μL of 100% DMSO on the V600E / C228T, C250T, and M918T reaction systems were also tested. Details of the betaine and DMSO combinations are shown in Table 8.

[0079] Table 8. Combinations of betaine and DMSO

[0080] For each reaction, add 16 μL of V600E / C228T reaction mixture, C250T reaction mixture, and M918T reaction mixture, and add betaine and DMSO according to Table 8. For each combination, add 1 μL of negative DNA reference or 1 μL of the corresponding 2% V600E / C228T mutant DNA reference, 2% C250T mutant DNA reference, and 2% M918T mutant DNA reference. Finally, add purified water to make up to 25 μL.

[0081] 3.3 PCR Amplification Perform the PCR amplification reaction according to the following procedure: Table 9 Amplification Reaction Procedure

[0082] Instrument parameter settings: Select "Qualitative / Absolute Quantitative" for experiment type; select "FAM, ROX, HEX" for fluorescence channels; select "Use Hot Lid" for hot lid setting; select "Module Temperature Control" for temperature control method; select "Full Channel Scan" for channel scanning settings. When analyzing data, set the "Amplification Curve Algorithm" to "Absolute Fluorescence Method" before analyzing the experimental results.

[0083] 3.4 Results Analysis The results showed that for the detection of high-GC TERT C228T and TERT C250T sites, both betaine and DMSO could reduce the FAM fluorescence Ct value and increase detection sensitivity. However, for RET M918T and BRAF V600E sites with normal GC content, the FAM fluorescence Ct value did not change significantly. Adding 1M betaine resulted in non-specific amplification in the TERT C228T, TERT C250T, RET M918T, and BRAF V600E negative DNA reference reaction systems. Adding 4% DMSO resulted in non-specific amplification in the TERT C228T and RET M918T negative DNA reference reaction systems. While ensuring specificity, the combination of 0.5M betaine and 2% DMSO can maximize the detection sensitivity of high GC TERT C228T and TERT C250T sites. Specifically, the detection of FAM fluorescence by TERT C228T can be reduced by about 2 Ct, and the detection of FAM fluorescence by TERT C250T can be reduced by about 1 Ct.

[0084] Table 10 Effects of different gradients of betaine and DMSO on the C228T reaction system

[0085] Table 11 Effects of different gradients of betaine and DMSO on the V600E reaction system

[0086] Table 12 Effects of different gradients of betaine and DMSO on the C250T reaction system

[0087] Table 13 Effects of different gradients of betaine and DMSO on the M918T reaction system

[0088] Example 5 Performance Evaluation of the Detection System 1. Cell DNA extraction DNA was extracted from GM12878, BCPAP, 8305C, TPC-1, M918T cells (cell pellet of RET p.M918T Reference Standard), and 293T cells according to the cell DNA extraction procedure in Example 3.

[0089] 2. Cell RNA extraction TPC-1, GM12878, and NCOA4 cells were extracted using the DP430-RNAperp Pure Cell / Bacterial Total RNA Extraction Kit (centrifuge column type). (Cell Pellet of AI-Edigene) ® NCOA4(E8)-RET(E12) Fusion RNA was extracted using a kit purchased from Tiangen Biotech (Beijing) Co., Ltd. (Catalog No.: DP430). Specifically, TPC-1 cell RNA contained CCDC6-RET fusion, NCOA4 cell RNA contained NCOOA4-RET fusion, and GM12878 cell RNA was negative.

[0090] Take out 1×10 7 Add 350 µl of lysis buffer RL to the cells, transfer the cell lysis buffer to a centrifuge tube, and vortex to mix. Transfer all the solution to the filter column CS (place the filter column CS in the collection tube), centrifuge at 12000 rpm for 2 min, and collect the filtrate. Add 1 volume of 70% ethanol (usually 350 µl) to the filtrate, mix well (precipitation may occur at this point), and transfer the resulting solution and precipitate together to the adsorption column CR3 (place the adsorption column CR3 in the collection tube), centrifuge at 12000 rpm for 30 sec, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube. Add 350 µl of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 30 sec, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube. Preparation of DNase I working solution: Take 240 µl of DNase I stock solution and place it in a new RNase-Free centrifuge tube, add 1680 µl of RDD buffer, and gently mix. Add 80 μl of DNase I working solution to the center of adsorption column CR3 and incubate at room temperature for 15 min. Add 350 μl of protein removal buffer RW1 to adsorption column CR3, centrifuge at 12000 rpm for 30 sec, discard the waste liquid in the collection tube, and return adsorption column CR3 to the collection tube. Add 500 μl of wash buffer RW to adsorption column CR3 (please check that ethanol has been added before use), incubate at room temperature for 2 min, centrifuge at 12000 rpm for 30 sec, discard the waste liquid in the collection tube, and return adsorption column CR3 to the collection tube (repeat twice). Centrifuge at 12000 rpm for 2 min and discard the waste liquid. Incubate adsorption column CR3 at room temperature for 5 min to completely dry any remaining wash liquid in the adsorption material. Transfer adsorption column CR3 to a new RNase-Free centrifuge tube, add 50 μl of RNA storage solution, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 2 min to obtain the RNA solution. Detect the RNA concentration using a UV spectrophotometer.

[0091] 3. Preparation of reference materials Referring to Example 4, 2% V600E / C228T mutant DNA reference, 2% C250T mutant DNA reference, 2% M918T mutant DNA reference, and negative DNA reference were prepared. The 2% reference and the negative DNA reference were diluted at mass ratios of 1:1 and 1:4 to obtain 1% and 0.5% mutant DNA references, respectively.

[0092] Preparation of CCDC6-RET and NCOOA4-RET fusion reference standards: ddPCR was used to detect the copy numbers of CCDC6-RET and NCOOA4-RET fusion RNA in TPC-1 and NCOOA4 cell RNA, respectively. The CCDC6-RET and NCOOA4-RET fusion reference standards were prepared by diluting them with purified water to 5 copies / μL, 10 copies / μL, and 20 copies / μL, respectively.

[0093] 4. Preparation of TN DNA and TN RNA reaction solutions Prepare the TN DNA reaction solution according to Table 14.

[0094] Table 14 Preparation of TN DNA Reaction Solution

[0095] Preparation of TN RNA reaction solution: The TN RNA reaction solution is a reverse transcription amplification enzyme (Hifair). ® It is formulated using UH Ⅲ Enzymes. Reverse transcription amplification enzyme (Hifair) is also included. ® UH Ⅲ Enzymes) and 2× buffer (2×Hifair) ® III Pbuffer is a one-step reverse transcription amplification kit (Hifair) ® The components of the One Step RT-qPCR Probe Kit (catalog number: 11145ES50) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0096] 5. Preparation of primer-probe mixture After diluting the primers, probes, and blocker to 100 μM, prepare the primer-probe mixture according to the table below.

[0097] Table 15 Preparation of primer-probe mixture

[0098] Table 16

[0099] Table 17

[0100] 6. Prepare the reaction system Prepare the DNA reaction system and the RNA reaction system according to Tables 18 and 19, respectively.

[0101] Table 18 DNA Reaction System

[0102] Table 19 RNA Reaction System

[0103] For the V600E / C228T system, add 0.5%, 1%, and 2% mutant DNA reference samples of V600E / C228T, respectively. For the C250T system, add 5 μL of 0.5%, 1%, and 2% mutant DNA reference samples of C250T, respectively. For the M918T system, add 0.5%, 1%, and 2% mutant DNA reference samples of M918T, respectively. For the RET fusion system, add 5 μL of CCDC6-RET and NCOA4-RET fusion reference samples of 5 copies / μL, 10 copies / μL, and 20 copies / μL, respectively. Vortex to mix and then centrifuge.

[0104] 7. PCR amplification Perform the PCR amplification reaction according to the following procedure: Table 20 Amplification Reaction Procedure

[0105] Instrument parameter settings: Select "Qualitative / Absolute Quantitative" for experiment type; select "FAM, ROX, HEX" for fluorescence channels; select "Use Hot Lid" for hot lid setting; select "Module Temperature Control" for temperature control method; select "Full Channel Scan" for channel scanning settings. When analyzing data, set the "Amplification Curve Algorithm" to "Absolute Fluorescence Method" before analyzing the experimental results.

[0106] 8. Results Analysis The results showed that this kit could detect 0.5% mutant DNA reference and 25 copies of RNA reference at a concentration of 2 ng / μL. See details below. Figures 1-6 .

[0107] Example 6: Consistency assessment of reagent kit and clinical sample pathology results Two hundred samples from patients at the China-Japan Friendship Hospital with clinical stage III-V and surgical resection pathology results were selected and tested using a reagent kit. All patients had signed informed consent forms. The testing procedure was the same as in Example 5.

[0108] The test results of the kit were compared with the pathological results of surgically removed samples. The results showed that the sensitivity of this kit in detecting benign and malignant stage III-V thyroid nodules was 88.15%, the specificity was 96.92%, and the accuracy was 91.00%. This demonstrates that the kit of the present invention has a high consistency with the pathological results of surgically removed samples in detecting benign and malignant stage III-V thyroid nodules.

[0109] Table 21 Consistency assessment between reagent kits and clinical sample pathology results

[0110] Comparative Example 1 This invention compared the forward primer sequences for BRAF V600E. The forward primers for BRAF V600E in Example 5 were replaced, while other conditions remained unchanged, to detect 2% V600E / C228T mutant DNA reference and negative DNA reference. The comparison results are detailed in Table 22. The detection specificity of the forward primers for V600E in Comparison 1 and Comparison 2 was no different from the sequence shown in SEQ ID NO:2, but the sensitivity was lower.

[0111] Table 22 Comparison of BRAF V600E forward primers

[0112] Comparative Example 2 This invention compares the reverse primer sequence of TERT C228T, replaces the reverse primer of TERT C228T in Example 5, and keeps other conditions unchanged, to detect 2% V600E / C228T mutant DNA reference and negative DNA reference.

[0113] The comparison results are detailed in Table 23. In comparison 3, the detection sensitivity of the reverse primer of TERT C228T is lower than that of the reverse primer sequence of TERT C228T shown in SEQ ID NO:8. In comparison 4, the detection specificity of the reverse primer of TERT C228T is lower than that of the reverse primer sequence of TERT C228T shown in SEQ ID NO:8.

[0114] Table 23 Comparison of C228T reverse primer sequences

[0115] Comparative Example 3 This invention compared the reverse primer sequence of TERT C250T. The reverse primer of TERT C250T in Example 5 was replaced, while other conditions remained unchanged, to detect 2% C250T mutant DNA reference and negative DNA reference. The comparison results are detailed in Table 24. The detection specificity of the reverse primers for TERT C250T in Comparisons 5 and 6 was no different from the sequence ultimately selected in this invention (SEQ ID NO: 11), but the sensitivity was lower than that of the reverse primer sequence of TERT C250T ultimately selected in this invention (SEQ ID NO: 11).

[0116] Table 24 Comparison of C250T reverse primer sequences

[0117] Comparative Example 4 This invention compared the reverse primer sequences for RET M918T. The reverse primer for RET M918T in Example 5 was replaced, while other conditions remained unchanged, and 2% M918T mutant DNA reference and negative DNA reference were detected. The comparison results are detailed in Table 25. The sensitivity of the reverse primer for RET M918T in Comparison 7 was lower than that of the reverse primer sequence finally selected in this invention (SEQ ID NO:16), and the specificity of the reverse primer for RET M918T in Comparison 8 was lower than that of the reverse primer sequence finally selected in this invention (SEQ ID NO:16).

[0118] Table 25 Comparison of M918T reverse primer sequences

[0119] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A diagnostic kit for benign and malignant thyroid nodules, comprising a primer-probe combination, characterized in that, The primer-probe combination includes: The forward primer sequence of BRAF V600E is shown in SEQ ID NO:2, the reverse primer sequence of BRAF V600E is shown in SEQ ID NO:3, and the probe sequence of BRAF V600E is shown in SEQ ID NO:

4. The forward primer sequence of TERT C228T is shown in SEQ ID NO:7, the reverse primer sequence of TERT C228T is shown in SEQ ID NO:8, and the probe sequence of TERT C228T is shown in SEQ ID NO:

9. The forward primer sequence of TERT C250T is shown in SEQ ID NO:10, the reverse primer sequence of TERT C250T is shown in SEQ ID NO:11, and the probe sequence of TERT C250T is shown in SEQ ID NO:

12. The forward primer sequence of RET M918T is shown in SEQ ID NO:15, the reverse primer sequence of RET M918T is shown in SEQ ID NO:16, and the probe sequence of RET M918T is shown in SEQ ID NO:

17. The forward primer sequence of CCDC6-RET is shown in SEQ ID NO:23, the reverse primer sequence of CCDC6-RET is shown in SEQ ID NO:24, and the probe sequence of CCDC6-RET is shown in SEQ ID NO:

25. The forward primer sequence of NCOA4-RET is shown in SEQ ID NO:27, the reverse primer sequence of NCOA4-RET is shown in SEQ ID NO:24, and the probe sequence of NCOA4-RET is shown in SEQ ID NO:

25.

2. The thyroid nodule benign and malignant auxiliary diagnostic kit according to claim 1, characterized in that, The kit also includes primers and probes for internal controls; The forward primer sequence of the ACTB DNA internal control is shown in SEQ ID NO:19, the reverse primer sequence of the ACTB DNA internal control is shown in SEQ ID NO:20, and the probe sequence of the ACTB DNA internal control is shown in SEQ ID NO:

21. The forward primer sequence of the ABL RNA internal control is shown in SEQ ID NO:29, the reverse primer sequence of the ABL RNA internal control is shown in SEQ ID NO:30, and the probe sequence of the ABL RNA internal control is shown in SEQ ID NO:

31.

3. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 1, characterized in that, The kit also includes a BRAF V600E Blocker sequence and a TERT C250T Blocker sequence, as shown in SEQ ID NO:5; the TERT C250T Blocker sequence is shown in SEQ ID NO:

13.

4. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to any one of claims 1-3, characterized in that, The probe is labeled with a fluorescent reporter gene at its 5' end and a fluorescent quencher gene at its 3' end.

5. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 4, characterized in that, The fluorescent reporter group is selected from at least one of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, Texas Red, NED, AMCA, Pacific Blue, Atto 425, BODIPY FL, Alexa Fluor 488, Yakima Yellow, Quasar 570, AquaPhluor593, Atto 590, and Cy5.

5. The fluorescence quenching group is selected from at least one of 6-TAMRA, BHQ-1, BHQ-2, BHQ-3, Dabcyl, Eclipse, MGB, and QYS-7.

6. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 5, characterized in that, The 5' ends of the TERT C228T probe, TERT C250T probe, CCDC6-RET probe, and NCOA4-RET probe are labeled with FAM; the 5' end of the BRAF V600E probe is labeled with ROX; and the 5' end of the ACTB DNA internal reference probe and the ABL RNA internal reference probe is labeled with HEX.

7. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 5, characterized in that, The 3' ends of the BRAF V600E probe and the TERT C228T probe are labeled with BHQ1; the 3' ends of the TERT C250T probe, the CCDC6-RET probe, the NCOA4-RET probe, the ACTB DNA internal reference probe, and the ABL RNA internal reference probe are labeled with MGB.

8. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 1, characterized in that, The detection sites of the kit include any one or more of BRAF V600E, TERT C228T, TERT C250T, CCDC6-RET, NCOA4-RET, and RETM918T.

9. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 8, characterized in that, The target sequence of BRAFV600E is shown in SEQ ID NO:1; the target sequence of TERT C228T is shown in SEQ ID NO:6; the target sequence of TERT C250T is shown in SEQ ID NO:6; the target sequence of RET M918T is shown in SEQ ID NO:14; the target sequence of CCDC6-RET is shown in SEQ ID NO:22; the target sequence of NCOA4-RET is shown in SEQ ID NO:26; the target sequence of the ACTB DNA internal reference is shown in SEQ ID NO:18; and the target sequence of the ABL RNA internal reference is shown in SEQ ID NO:

28.

10. The auxiliary diagnostic kit for benign and malignant thyroid nodules according to claim 1, characterized in that, The kit also includes a PCR enhancer comprising 0.4-0.6 M betaine and 1.5-2.5% DMSO by volume.

Images