Application of a molecular marker affecting chest circumference traits of duomun sheep
By detecting specific nucleotide sequences in the genomic DNA of Dumont sheep, the problems of long breeding cycles and slow genetic progress in traditional phenotypic selection methods have been solved, enabling early identification and rapid genetic improvement of the chest girth trait in Dumont sheep, thus improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INNER MONGOLIA AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-05-18
- Publication Date
- 2026-07-24
AI Technical Summary
Current technologies rely on traditional phenotypic selection methods for the breeding of breast girth traits in Dumont sheep, resulting in long breeding cycles, high costs, and slow genetic progress, making it difficult to meet the demands of the high-end meat product market.
By using molecular markers that influence the chest girth trait of Dumont sheep, specific nucleotide sequences (such as the 101bp nucleotide sites shown in SEQ ID NO.2 and SEQ ID NO.4) in the genomic DNA of Dumont sheep can be detected to identify chest girth traits or select superior parents, thus achieving early and accurate screening and genetic improvement.
Shorten the breeding cycle, reduce feeding costs, improve selection efficiency and genetic progress speed, achieve rapid improvement of chest girth traits, and ensure the objectivity and reliability of breeding results.
Smart Images

Figure CN122235327B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic breeding technology, specifically involving the application of a molecular marker that affects the chest girth trait of Dumont sheep. Background Technology
[0002] The Dorper sheep is a high-quality meat sheep breed developed through crossbreeding technology, using Dorper sheep as the sire and Mongolian sheep as the dam. This breed combines the advantages of rapid growth and development, excellent carcass quality, tolerance to roughage, strong disease resistance, and high reproductive rate. It exhibits robust physique, outstanding meat performance, and wide adaptability. Its meat is characterized by high protein, low fat, even distribution of intramuscular fat, and a unique flavor, making it a high-quality meat sheep resource with significant market potential.
[0003] The high-end meat product market is experiencing strong demand, which the Dumont sheep, as a premium meat sheep breed, struggles to meet. This is due to the scarcity of purebred Dumont sheep and severe inbreeding depression in some populations, which significantly restricts their genetic diversity and meat production performance. Chest circumference, a core indicator of Dumont sheep's body development, is significantly positively correlated with individual growth rate, adult weight, and carcass meat yield. Currently, breeding for the chest circumference trait in Dumont sheep mainly relies on traditional phenotypic selection methods, i.e., screening by directly measuring the chest circumference of adult individuals. However, this method has significant limitations: firstly, phenotypic measurements must be conducted in the later stages of sheep growth and development, resulting in a long breeding cycle and high feeding costs; secondly, chest circumference, as a quantitative trait, is easily affected by environmental, nutritional, and management factors, leading to limited accuracy and slow genetic progress through phenotypic selection alone; furthermore, given the limited purebred resources and the risk of inbreeding, traditional methods are insufficient for rapid and targeted genetic improvement of this trait.
[0004] Therefore, developing a new strategy that can accurately identify and screen the genetic potential related to chest circumference traits at an early stage is of urgent practical significance for breaking through the current bottleneck in Dumont sheep breeding and accelerating the process of cultivating superior breeds. Summary of the Invention
[0005] The purpose of this invention is to provide an application of molecular markers that affect the chest girth trait of Dumont sheep, which solves the problems of long breeding cycles and slow genetic progress in the prior art.
[0006] The technical solution adopted in this invention is: This invention provides an application of molecular markers that affect the chest girth trait of Dumont sheep, wherein the molecular markers are at least one of the following ① and ②: ①The nucleotide sequence shown in SEQ ID NO.2 has a nucleotide at position 101 bp that is either A or C; ②The nucleotide sequence shown in SEQ ID NO.4 has a nucleotide at position 101 bp that is either G or A; The application refers to any one of the following (1) and (2): (1) Determine the chest circumference of the Dumont sheep; (2) Increase the chest circumference of Dumont sheep offspring.
[0007] Preferably, the method for determining the chest circumference of a Dumont sheep is as follows: Genomic DNA was extracted from the Dumont sheep to be tested and sequenced. Determine the genotype of the Dumont sheep at position 101 bp of SEQ ID NO.2 or SEQ ID NO.4; If the genotype is at least one of A) and B) below, then the Dumont sheep is large-chested, and large-chested means a chest circumference of 91.35cm to 98.08cm; A) The genotype at 101bp of SEQ ID NO.2 is CC; B) The genotype at 101bp of SEQ ID NO.4 is AA.
[0008] Preferably, the method for increasing the chest circumference of Dumont sheep offspring is as follows: Genomic DNA was extracted from the Dumont sheep to be tested and sequenced. Determine the genotype of the Dumont sheep at position 101 bp of SEQ ID NO.2 or SEQ ID NO.4; By selecting Dumont sheep individuals carrying at least one of the genotypes shown in a) and b) as parents for breeding, it is possible to increase the chest circumference of Dumont sheep offspring. a) The genotype at 101bp of SEQ ID NO.2 is CC; b) The genotype at 101bp of SEQ ID NO.4 is AA.
[0009] Preferably, the genomic DNA of the Dumont sheep is derived from the blood of the Dumont sheep.
[0010] Preferably, the genomic DNA of the Dumont sheep is extracted using the phenol-chloroform method.
[0011] Preferably, the chest circumference refers to: The circumference of the chest, measured from the posterior border of the scapula perpendicular to the body axis.
[0012] Compared with the prior art, the beneficial effects of the present invention are: This invention provides an application of molecular markers affecting the chest girth trait of Dumont sheep, wherein the molecular markers are at least one of the following ① and ②: ① the nucleotide sequence shown in SEQ ID NO.2, where the nucleotide at the 101bp site is A or C; ② the nucleotide sequence shown in SEQ ID NO.4, where the nucleotide at the 101bp site is G or A; the application refers to any one of the following (1) and (2): (1) identifying the chest girth of Dumont sheep; (2) improving the chest girth of Dumont sheep offspring. By detecting the molecular markers closely related to the chest girth trait described in this invention, the chest girth development potential of Dumont sheep can be accurately predicted early in life, even before birth. Compared with traditional breeding methods that rely on body phenotype measurements, this invention significantly shortens the breeding cycle, reduces feeding costs, and improves the targeting and efficiency of selection. Based on the molecular markers described in this invention, by selectively retaining individuals carrying favorable genotypes as breeding sheep, a breeding core group with excellent chest girth traits can be quickly established, accelerating the genetic improvement of chest girth-related traits in Dumont sheep. The molecular markers of this invention are based on genomic DNA detection, unaffected by environmental factors, measurement timing, or subjective human intervention, and can accurately reflect an individual's genetic potential. Therefore, using the molecular markers described in this invention for chest girth trait identification or parental selection yields more objective and reliable results, which is beneficial for continuously improving the genetic progress of chest girth traits in Dumont sheep.
[0013] In summary, this invention provides a reliable molecular-assisted selection tool for the breeding of breast girth traits in Dumont sheep, which not only helps to accelerate the breeding process of superior sheep, but also provides important technical support for achieving efficient and precise genetic improvement of Dumont sheep. Attached Figure Description
[0014] Figure 1 This is a distribution diagram of SNPs within a 1Mb window of a chromosome after quality control. The Y-axis represents the chromosome name, and the X-axis represents the window size.
[0015] Figure 2 The principal component analysis plot shows the percentage of variance explained by the first two plots, PC1 and PC2, as the X and Y axes. The top density distribution of PC1 shows the distribution of all data points on PC1 and the degree of data variation along the PC1 axis. The right density distribution of PC2 shows the distribution of all data points on PC2 and the degree of data variation along the PC2 axis.
[0016] Figure 3 This is a visualization of the G matrix, where each small square represents the kinship value between two samples. The smaller the value, the closer it is to blue, meaning the more distant the kinship between the two individuals, and vice versa.
[0017] Figure 4 The Manhattan plot and QQ plot of this invention show the GWAS results of the chest girth trait in Dumont sheep. A is the Manhattan plot; B is the QQ plot. Detailed Implementation
[0018] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.
[0019] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.
[0020] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium; Manhattan Plot; QQ chart: Quantile-Quantile Plot; SNP: Single nucleotide polymorphism; GWAS: Genome-wide association analysis.
[0021] The experimental animals and phenotypic sources of this invention: The sheep used in this invention were all from Sinosheep Technology Co., Ltd. Chest circumference traits of adult Dumont sheep from 2023 to 2024 were measured and phenotypically recorded. Descriptions of chest circumference traits are shown in Table 1.
[0022] Blood samples were collected from 300 Dumont sheep. All samples were immediately stored at -80°C after collection and transported to the laboratory on dry ice for long-term storage at -80°C.
[0023] Table 1. Description of breast circumference traits in Dumont sheep.
[0024] Example 1 The application of a molecular marker affecting the chest girth trait in Dumont sheep is as follows: 1. Genomic DNA extraction and quality control.
[0025] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration was measured using a NanoDrop2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm to 280 nm was calculated to measure the content of DNA, protein, and phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm to 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was then assessed using 1% (w / v) agarose gel electrophoresis.
[0026] 2. Library construction and sequencing.
[0027] The qualified genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly(A) addition, sequencing adapter addition, purification, and PCR amplification to complete the library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0028] 3. Identification, screening, and annotation of variant sites.
[0029] Raw reads were filtered into clean reads using FastP software version 0.20.0, and a genome index was built on the reference genome. The quality-controlled clean reads were aligned with the Dumont sheep reference genome using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted to BAM files using SAMtools software version 1.8-20, and the BAM files were sorted. Duplicates were removed from the sorted BAM files using the MarkDuplicates program in Genome Analysis Toolkit version 3.8, resulting in the final BAM file. An index was built on the final BAM file, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. The resulting VCF file was then filtered using the VariantFiltration module. Functional annotation of the detected gene variants was performed using the ANNOVAR software package. Based on the location of the variant sites on the reference genome and the gene location information on the reference genome, the region in which the variant sites occurred and the impact of the variants, such as synonymous or non-synonymous mutations, can be determined.
[0030] The reference genome used in this invention is Oar_v4.0, GCF_000298735.2.
[0031] 4. Data quality control and group stratification correction.
[0032] Whole-genome resequencing was performed on 300 individuals of Dumont sheep to establish a genotype database, generating a total of 17072.62 Gbp of raw reads and obtaining a total of 73,286,363 SNPs.
[0033] The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and Hardy-Weinberg equilibrium test p-values of less than 10 were removed. -6 SNPs. A total of 24,121,810 high-quality SNPs were identified in the Dumont sheep population. These loci are evenly distributed across the 26 pairs of autosomes in Dumont sheep, such as... Figure 1 As shown.
[0034] The first three principal components were calculated using the "--pca 3" parameter in Plink V1.90 software. The PCA plot was then drawn using R (V3.6.0), and the results are as follows. Figure 2 As shown, the experimental sample did not exhibit population stratification, and the degree of genetic correlation among individuals was low. Genomic phylogenetic analysis based on the G-matrix was performed on this population using Plink V1.90, and the results are as follows: Figure 3 As shown, this indicates that the average kinship among individuals of the Dumont sheep is relatively distant.
[0035] 5. Genome-wide association analysis.
[0036] The association between SNP and chest circumference traits was analyzed using the fastGWA-mlm model in GCTA V1.94.0beta software, and the formula is as follows: .
[0037] in y It is a phenotypic vector; X snp It is a genotype vector, and its effect is β snp ; X c This is the correlation matrix of the first three PCA variables in the field area, with their corresponding coefficients being... β c ; g It is a vector of total genetic effects captured by the genetic relationship matrix derived from SNPs. g ~ N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e It is the residual vector. e ~ N(0, ).
[0038] Since using the Bonferroni correction method with a value of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent, this invention employs linkage disequilibrium screening to remove redundancy, obtaining independent SNPs for threshold calculation. The parameters are: 50: Window size, number of SNPs; 10: Step length, number of SNPs; 0.2: r 2 Delete one of the SNP pairs where LD is greater than 0.2.
[0039] This invention adjusts the threshold for genome-wide significant association to P=1 / 933699. The genomic expansion factor λ, used for the test statistics, is calculated by the slope of a linear regression between the observed quantiles and the theoretical quantiles in R (V3.6.0). The calculated λ value for the chest circumference trait is 0.971, indicating no genome expansion.
[0040] Based on resequencing data from 300 Dumont sheep, 11 significant SNP loci associated with chest girth were detected. These loci are located on chromosomes 3, 5, 6, 8, 17, and 23, as shown in Table 2. Figure 4 As shown.
[0041] Table 2. Significant SNP loci associated with chest circumference traits at age 1 year old.
[0042] 6. SNPs affecting chest circumference traits in Dumont sheep.
[0043] (1) Further research on SNPs that reached the level of genome-wide significance revealed that the C→A mutation at position 213989554 on chromosome 3 of the Dumont sheep genome can significantly affect the chest girth trait of Dumont sheep.
[0044] Association analysis was performed on the SNP locus at position 213989554 on chromosome 3 of the Dumont sheep genome with chest girth trait. The results are shown in Table 3.
[0045] Table 3. Polymorphism at position 213989554 on chromosome 3
[0046] Note: In Table 3, different lowercase letters indicate significant differences. P <0.05; the same letter indicates no significant difference. P >0.05.
[0047] As shown in Table 3, individuals with the CC genotype have the largest chest circumference, while individuals with the AA genotype have the smallest chest circumference.
[0048] In the genome-wide association analysis, the SNP molecular marker at position 213989554 on chromosome 3 of the Dumont sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the chest circumference trait of Dumont sheep, and that when the base of this molecular marker is C, it is beneficial for Dumont sheep to have a larger chest circumference.
[0049] Subsequently, the gene frequency and genotype frequency of the SNP at position 213989554 on chromosome 3 of the Dumont sheep genome were statistically analyzed, as shown in Table 4.
[0050] Table 4. SNP gene frequency and genotype frequency at position 213989554 on chromosome 3.
[0051] The nucleotide sequence of the molecular marker containing the C→A mutation site at position 213989554 on chromosome 3 is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0052] SEQ ID NO.1: CTGCAACCCCGTGGACTGCAGCCTGCCAGGCTCCTCTGTCCTTGGGAATTCTCCAGGTGAGAATACTAGAGTGGGTTGCCACGCCCTCCCTCCAGGGGATCTTCCCAGGCCAGGGATCAAACGCAGGTCTCCCACAGTGCAGGTGGATTCTTTACTGCCTGAGCCACAAGGGAGGCACATTAGGGGAACAAGTGGTAATTG.
[0053] SEQ ID NO.2: CTGCAACCCCGTGGACTGCAGCCTGCCAGGCTCCTCTGTCCTTGGGAATTCTCCAGGTGAGAATACTAGAGTGGGTTGCCACGCCCTCCCTCCAGGGGATATTCCCAGGCCAGGGATCAAACGCAGGTCTCCCACAGTGCAGGTGGATTCTTTACTGCCTGAGCCACAAGGGAGGCACATTAGGGGAACAAGTGGTAATTG.
[0054] (2) Further research on SNPs that reached the level of genome-wide significance revealed that the A→G mutation at position 71595855 on chromosome 8 of the Dumont sheep genome can significantly affect the chest girth trait of Dumont sheep.
[0055] Association analysis was performed on the SNP locus at position 71595855 on chromosome 8 of the Dumont sheep genome with chest girth trait. The results are shown in Table 5.
[0056] Table 5. Polymorphism at position 71595855 on chromosome 8
[0057] Note: In Table 5, different lowercase letters indicate significant differences. P <0.05; the same letter indicates no significant difference. P >0.05.
[0058] As shown in Table 5, individuals with the genotype AA have the largest chest circumference, while individuals with the genotype GG have the smallest chest circumference.
[0059] In the genome-wide association analysis, the SNP molecular marker at position 71595855 on chromosome 8 of the Dumont sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the chest circumference trait of Dumont sheep, and that when the base of this molecular marker is A, it is beneficial for Dumont sheep to have a larger chest circumference.
[0060] Subsequently, the gene frequency and genotype frequency of the SNP at position 71595855 on chromosome 8 of the Dumont sheep genome were calculated, as shown in Table 6.
[0061] Table 6. Frequency of SNP gene and genotype at position 71595855 on chromosome 8
[0062] The nucleotide sequence of the molecular marker containing the A→G mutation site at position 71595855 on chromosome 8 is shown in SEQ ID NO.3 and SEQ ID NO.4.
[0063] SEQ ID NO.3: TGTGGTCATGTGTTTTACTGGCCTCAGAAAATTTAAGCTTCTGACGAAGTTTTCCCGATGTAGAAGGCATTGGGAATCATGAGAAGACCACTAGGGCTAAGAGAACATTTGTCCCACCCACTGTGGAATCTGTGGATCTGGAGAAAGCCACATGGACTGGGGGAAGTCTGCACACACATCTCCCCCTTTCAACAAATGA.
[0064] SEQ ID NO.4: TGTGGTCATGTGTTTTACTGGCCTCAGAAAATTTAAGCTTCTGACGAGAAGTTTTCCCGATGTAGAAGGCATTGGGAATCATGAGAAGACCACTAGGGCTGAGAGACATTTGTCCCACCCACTGTGGAATCTGTGGATCTGGAGAAAGCCACATGGACTGGGGGAAGTCTGCACACACATCTCCCCCTTTCAACAAATGA.
[0065] Based on the above results, we can see that: (1) The Dumont sheep genome uses a C→A mutation at position 213989554 on chromosome 3 to breed Dumont sheep with large chest circumference. Individuals with the CC genotype are selected as the father or mother to increase the chest circumference of the offspring of Dumont sheep.
[0066] (2) The A→G mutation at position 71595855 on chromosome 8 of the Dumont sheep genome is used to breed Dumont sheep with large chest circumference. Individuals with the AA genotype are selected as the father or mother to increase the chest circumference of the offspring of Dumont sheep.
[0067] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0068] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. The application of a molecular marker affecting the chest girth trait of Dumont sheep, characterized in that, The molecular marker is any one of the following ① and ②: ①The nucleotide sequence shown in SEQ ID NO.2 has a nucleotide at position 101 bp that is either A or C; when the genotype at position 101 bp of SEQ ID NO.2 is CC, the Dumont sheep have a large chest circumference; ②The nucleotide sequence shown in SEQ ID NO.4 has a nucleotide at position 101 bp that is either G or A; when the genotype at position 101 bp of SEQ ID NO.4 is AA, the Dumont sheep have a large chest circumference. The application refers to any one of the following (1) and (2): (1) Determine the chest circumference of the Dumont sheep; (2) Increase the chest circumference of Dumont sheep offspring.
2. The application as described in claim 1, characterized in that, The method for determining the chest circumference of a Dumont sheep is as follows: Genomic DNA was extracted from the Dumont sheep to be tested and sequenced. Determine the genotype of the Dumont sheep at position 101 bp of SEQ ID NO.2 or SEQ ID NO.4; If the genotype is either A) or B) below, then the Dumont sheep will have a large chest. A) The genotype at 101bp of SEQ ID NO.2 is CC; B) The genotype at 101bp of SEQ ID NO.4 is AA.
3. The application as described in claim 1, characterized in that, The method to increase the chest circumference of offspring of Dumont sheep is as follows: Genomic DNA was extracted from the Dumont sheep to be tested and sequenced. Determine the genotype of the Dumont sheep at position 101 bp of SEQ ID NO.2 or SEQ ID NO.4; By selecting Dumont sheep individuals carrying either of the genotypes shown in a) and b) as parents for breeding, the chest circumference of Dumont sheep offspring can be increased. a) The genotype at 101bp of SEQ ID NO.2 is CC; b) The genotype at 101bp of SEQ ID NO.4 is AA.
4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA of the Dumont sheep was derived from the blood of the Dumont sheep.
5. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA of Dumont sheep was extracted using the phenol-chloroform method.
6. The application as described in claim 1, characterized in that, The chest circumference refers to: The circumference of the chest, measured from the posterior border of the scapula perpendicular to the body axis.