Application of SNP molecular marker related to calf delivery stillborn rate of dairy cow

Abstract

This invention discloses the application of a SNP molecular marker associated with stillbirth rate in dairy cows, belonging to the field of dairy cow breeding marker technology. The SNP molecular marker is chr9:g.89847787 T>C, with coordinates based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000166.1. The genotypes of the SNP molecular marker with the highest to lowest stillbirth rate are CC, CT, and TT. By detecting the genotype of this SNP locus in bovine blood samples, future reproductive traits can be effectively predicted. Compared to predicting reproductive traits in adulthood, this prediction is made one generation earlier, significantly shortening the selection time and improving the reproductive efficiency of dairy cow herds.

Description

Technical Field

[0001] This invention relates to the field of dairy cow breeding marker technology, specifically to the application of a SNP molecular marker related to stillbirth rate in dairy cows. Background Technology

[0002] Stillbirth in dairy cows is a reproductive disorder, with its incidence varying depending on feeding conditions and management levels, typically ranging from 5% to 7%. Many factors influence stillbirth in dairy cows, including but not limited to infectious diseases, nutritional deficiencies, management stress, parity, calving season, premature birth, and twin births. Regarding genetic factors, previous research has focused primarily on inbreeding and recessive lethal genes. Inbreeding increases the probability of stillbirths, weak fetuses, and deformed fetuses because offspring may inherit harmful recessive alleles, leading to slow growth and development and decreased disease resistance. In purebred cattle, multiple recessive lethal alleles may exist in the population. When both bulls and cows carry the same lethal allele, approximately 25% of offspring may experience early embryonic death due to homozygous recessive inheritance.

[0003] The development of genome-wide association analysis (GWAS) and marker-assisted selection (MAS) techniques has enabled more in-depth research on stillbirth in dairy cows. Olsen HG et al. used 17,343 SNP markers to find loci significantly associated with stillbirth and dystocia on multiple chromosomes of Norwegian Red cattle, with six markers on chromosome 6 being the most significant. Through linkage disequilibrium analysis, the study inferred the existence of two quantitative trait loci (QTLs) in this region and located three candidate genes related to bone and cartilage formation: SPP1, IBSP, and MEPE. These are considered key genes for studying dystocia and stillbirth in cattle and other species (Olsen HG, et al., Genome-wide association mapping in Norwegian Red cattle identifies quantitative trait loci for fertility and milk production on BTA12. Anim Genet. 2011 Oct;42(5):466-474).

[0004] Given that stillbirth rate in dairy cows is significantly influenced by genetic factors and is negatively correlated with reproductive traits, it is essential to study stillbirth rate at the genetic level and, in order to reduce this loss through precision breeding. The main dairy cow breed in my country is Holstein, and research on the genetic level of stillbirth rate in Holstein cattle is currently limited, with research on stillbirths at all being virtually nonexistent. Summary of the Invention

[0005] The purpose of this invention is to address the technical problem that there is currently a lack of research on the genetic level of stillbirth rate in dairy cows, and that research on stillbirth is almost non-existent, by providing a SNP molecular marker related to stillbirth rate.

[0006] The technical solution of this invention is described in detail below: In one aspect, the present invention provides an application of SNP molecular markers related to stillbirth rate in dairy cows, used to determine the level of stillbirth rate. The SNP molecular marker is chr9:g.89847787 T>C, with coordinates based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000166.1; The SNP molecular marker genotypes with the highest to lowest stillbirth rates are CC, CT, and TT.

[0007] Calving refers to the calving trait of a cow.

[0008] Optionally or preferably, the SNP molecular marker is the 25th nucleotide of the sequence shown in SEQ ID NO:1, with a polymorphism of T or C.

[0009] Optional or preferred methods for determining the stillbirth rate of calves include the following steps: (1) Extracting genomic DNA from cows; (2) Using the genomic DNA obtained in step (1) as a template, and the nucleotide sequences shown in SEQ ID NO:2~3 as primers, PCR amplification was performed to obtain amplification products containing SNP molecular markers; (3) Sequencing of the amplification products. The 25th position of the amplification product is an SNP molecular marker. The SNP molecular marker genotypes with the highest to lowest stillbirth rate are CC, CT, and TT.

[0010] In addition, the present invention also provides the application of products for detecting SNP molecular markers in determining the stillbirth rate of calves. The products can be detection kits, including primer pairs, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO:2~3. The SNP molecular marker is chr9:g.89847787 T>C, with coordinates based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000166.1; The SNP molecular marker genotypes with the highest to lowest stillbirth rates are CC, CT, and TT.

[0011] Compared with the prior art, the present invention has the following beneficial effects: This invention discovered a single SNP (chr9:g.89847787 T>C) through genotyping in dairy cow populations. Research revealed that this SNP molecular marker is significantly correlated with calving stillbirth rate. By detecting the genotype of this SNP locus in blood samples from cows during calves or young cattle, calving traits can be effectively predicted. Compared to observing the actual calving traits of cows, this method allows for prediction one generation earlier, significantly shortening the breeding time, improving the reproductive efficiency of dairy cow populations, reducing breeding costs, and increasing farm profits. Detailed Implementation

[0012] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all of the embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0013] Example 1: SNP site screening and identification of dominant genotypes 1. Screening for SNP loci (1) A total of 1,361 Chinese Holstein female calves were collected from 6 ranches. The location of the ranches and the number of samples collected from each ranch are shown in Table 1.

[0014] Table 1. Distribution of collected Holstein female calves in China (2) Genomic DNA was extracted from blood samples, and the genotypes of the collected samples were determined using the Illumina Bovine SNP50 chip. The determination of genotypes and the estimation of the stillbirth rate genomic breeding value (DSB_GEBV) for each individual based on genotypes were performed by Neocare Biotechnology (Shanghai) Co., Ltd. A total of 49,482 SNP marker loci were obtained, as well as 1 genomic breeding value for the stillbirth rate.

[0015] (3) Based on the genotype data obtained in step (2), a genome-wide association analysis was performed on the genomic breeding values ​​of calving stillbirth rate using GEMMA software with a mixed linear model, with pasture location and cattle age as covariates. Multiple regression analysis was performed using the FDR method. The association analysis results showed that the most significant SNP locus was located on chromosome 9, at position 89847787, with SNP id BTB-00404802. The significance P-value after multiple regression analysis was 0.0128.

[0016] 2. Identification of dominant genotypes at SNP loci Of the 1361 Chinese Holstein cows collected, 510 individuals with the homozygous TT genotype at the aforementioned SNP locus had a mean genomic estimated breeding value of 6.46 for stillbirth rate; 662 individuals with the heterozygous TC genotype had a mean genomic estimated breeding value of 6.56 for stillbirth rate; and 189 individuals with the homozygous CC genotype had a mean genomic estimated breeding value of 6.76 for stillbirth rate. In genomic genetic evaluation, a lower genomic estimated breeding value for stillbirth rate is better; therefore, the TT genotype at this SNP locus is the dominant genotype.

[0017] Example 2: Association Analysis of SNP Locus Genotypes with Calving Stillbirth Rate 1. Amplification of SNP loci sequences, detection and analysis of SNP genotype and allele frequency distribution. To determine whether the genotypes of the SNP loci selected in this application are related to the stillbirth rate, 946 Chinese Holstein cows were selected for association analysis of the genotype and the estimated breeding value of the stillbirth rate.

[0018] (1) Blood collection from bovine tail vein and extraction of genomic DNA Ninety-six cows with genomically estimated breeding values ​​for calving stillbirth rates were selected from three ranches as experimental subjects. Blood samples were collected from the tail veins of the cows, and genomic DNA was extracted.

[0019] (2) Primer design Based on the bovine gene sequence containing the SNP sites identified in Example 1, a pair of specific primers was designed. The forward primer is 5F (SEQ ID NO:2): TCCTATGAAGATTGCCCCCT; The reverse primer is 3R (SEQ ID NO:3): CCCTCCATGTTGTTGTCTCTG.

[0020] (3) Complex enzyme chain reaction Using genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The genotypes of the obtained PCR products were determined using Sanger sequencing, and the sequences are as follows: TCCTATGAAGATTGCCCCCTAGGA TTTAATGCATGTGACTATACTATTCTAGTGGTTAGATATAACACTTACAGGGTATTAGGTTTCAAAGAAATTAGGAATAAAAATAACATAATCATCAGAGACAACAACATGGAGGG (SEQ ID NO:1). The SNP site is located at position 25, and the polymorphism is T or C, indicated by bold and underline in the sequence.

[0021] (4) Distribution frequency of different genotypes at SNP loci The results of the analysis of allele frequency distribution at SNP loci are shown in Table 2.

[0022] Table 2. Distribution of different SNP genotypes in the cow population. The results showed that among all the populations tested, the frequency of the TT gene was 47.25%, the frequency of the TC genotype was 46.30%, and the frequency of the CC genotype was 6.45%, with the TT genotype being the dominant genotype.

[0023] (5) Different genotypes and associations at SNP loci Association analysis of SNP locus genotypes and genomically estimated breeding values ​​of calving stillbirth rate in 946 Chinese Holstein cattle.

[0024] Table 3. Association analysis results of cow SNP locus genotypes and estimated breeding values ​​for calving stillbirth rate. The results showed that the average estimated genomic breeding value for individuals with the TT genotype was 5.48, for individuals with the TC genotype it was 6.01, and for individuals with the CC genotype it was 7.08.

[0025] Association analysis was performed between this SNP locus and DSB_GEBV. The results showed that the mean DSB_GEBV values ​​for the TT, TC, and CC genotypes were 5.484, 6.017, and 7.082, respectively, exhibiting a trend of increasing with increasing "C" allele dosage. One-way ANOVA indicated that the differences in DSB_GEBV among different genotypes were highly significant (F(2,943)=73.083, P=3.11×10⁻⁶). -30 Genotype can explain approximately 13.4% of phenotypic variation. Tukey multiple comparisons showed that TC was significantly higher than TT, and CC was significantly higher than both TT and TC. Additive dosing models further indicated that for each additional "C" allele, DSB_GEBV increased by an average of 0.663 units (P = 1.92 × 10⁻⁶). -29The additive-dominant model shows that this site has a significant additive effect. In summary, this SNP is significantly associated with DSB_GEBV.

[0026] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker associated with stillbirth rate in dairy cows, characterized in that, The SNP molecular marker used to determine the stillbirth rate is chr9:g.89847787 T>C, with coordinates based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000166.

1. The SNP molecular marker genotypes with the highest to lowest stillbirth rates are CC, CT, and TT.

2. The application according to claim 1, characterized in that, The SNP molecular marker is the 25th nucleotide of the sequence shown in SEQ ID NO:1, with a polymorphism of T or C.

3. The application according to claim 1, characterized in that, The methods for determining the stillbirth rate of calves include the following steps: (1) Extracting genomic DNA from cows; (2) Using the genomic DNA obtained in step (1) as a template, and the nucleotide sequences shown in SEQ ID NO:2~3 as primers, PCR amplification was performed to obtain amplification products containing SNP molecular markers; (3) Sequencing of the amplification products. The 25th position of the amplification product is an SNP molecular marker. The SNP molecular marker genotypes with the highest to lowest stillbirth rate are CC, CT, and TT.

4. The application of products detecting SNP molecular markers in determining the stillbirth rate of calves, characterized in that, The product includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:2~3; The SNP molecular marker is chr9:g.89847787 T>C, with coordinates based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000166.1; The SNP molecular marker genotypes with the highest to lowest stillbirth rates are CC, CT, and TT.

5. The application of products detecting SNP molecular markers in determining the stillbirth rate of calves, characterized in that, The product is a detection kit, including primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:2~3; The SNP molecular marker is chr9:g.89847787 T>C, with coordinates based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000166.1; The SNP molecular marker genotypes with the highest to lowest stillbirth rates are CC, CT, and TT.

Images