Inhibition of hepatic glycerol metabolism for the treatment of hypertriglyceridemia and fatty liver disease
By using glycerol kinase inhibitors, especially GalNAc-siRNA conjugates, to interfere with glycerol kinase gene expression, the treatment challenges of hypertriglyceridemia and MASLD have been solved, achieving significant reduction in serum triglyceride and cholesterol levels, inhibition of mTORC1, and improvement of hepatic triglyceride storage.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- RUTGERS THE STATE UNIV
- Filing Date
- 2024-09-20
- Publication Date
- 2026-06-19
AI Technical Summary
Currently, there is a lack of effective treatments to reduce hypertriglyceridemia and non-alcoholic fatty liver disease (MASLD), and existing treatment options are limited with no FDA-approved therapies.
Glyceryl kinase (GK) inhibitors, including antibodies, antigen-binding fragments, small molecules, or nucleic acids, are used, particularly by administering chemically modified GalNAc-siRNA conjugates, to interfere with GK gene expression and reduce glyceryl kinase activity and expression levels.
It effectively reduces serum triglyceride levels by more than 70%, cholesterol levels by more than 50%, inhibits mTORC1 activity, alleviates hypertriglyceridemia and MASLD, reduces liver triglyceride storage, and improves related disease symptoms.
Smart Images

Figure CN122249555A_ABST
Abstract
Description
[0001] Cross-reference to related applications
[0002] This application claims the benefit of the earlier filing date of U.S. Provisional Patent No. 63 / 583,891, filed on September 20, 2023, pursuant to 35 USC §119(e), which is incorporated herein by reference in its entirety.
[0003] Reference to electronic sequence listing
[0004] The contents of the electronic sequence list (SeqList-070439-01844.xml; size 128,848 bytes, created on September 9, 2024) are incorporated herein by reference in their entirety.
[0005] Invention Field
[0006] This invention relates to methods for preventing or treating diseases associated with high serum triglycerides (TAG) using glycerol kinase (GK) inhibitors. Background of the Invention
[0008] Hypertriglyceridemia, or high serum triglyceride (TAG), is a common human condition affecting more than 100 million people in the United States and contributing to increased incidence of acute myocardial infarction, stroke, and peripheral vascular disease. TAG is synthesized from smaller molecules in a process called de novo lipogenesis. Quantitatively, most TAG is synthesized in the liver and transported to peripheral adipose tissue for long-term storage via serum lipoproteins. Excessive hepatic TAG synthesis (especially with a high-carbohydrate diet) overwhelms the TAG transport system, leading to excessive pathological storage and accumulation of TAG in the liver—a condition known as non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-associated steatotic liver disease (MASLD). Furthermore, diabetes and obesity can also contribute to TAG accumulation in the liver.
[0009] However, current treatment options for hypertriglyceridemia are limited, and there are no FDA-approved therapies for MASLD. Therefore, the need to develop effective treatments for both hypertriglyceridemia and MASLD remains urgent. Invention Overview
[0011] On the one hand, this disclosure provides a glycerol kinase (GK) inhibitor. On the other hand, this disclosure provides a method for treating or preventing diseases associated with elevated serum triglyceride (TAG) levels and MASLD, wherein the method includes administering a therapeutically effective amount of a GK inhibitor to a subject in need. In some embodiments, the disease is hypertriglyceridemia or MASLD.
[0012] In some embodiments, GK inhibitors comprise antibodies or antigen-binding fragments thereof, small molecules, or nucleic acids. In some embodiments, GK inhibitors comprise nucleic acids.
[0013] In some embodiments, the nucleic acid comprises at least one double-stranded region comprising at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein the nucleic acid comprises nucleic acid sequence pairs as shown in SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, or SEQ ID NO: 7 and SEQ ID NO: 8 or SEQ ID NO: 9 and SEQ ID NO: 10.
[0014] In some embodiments, the nucleic acid includes chemical modifications. In some embodiments, the chemical modification comprises one or more N-acetylgalactosamine (GalNAc) moieties or derivatives thereof that are directly conjugated to the nucleic acid or indirectly conjugated via a linker. In some embodiments, the chemical modification is conjugated to the 3′ end of the first strand.
[0015] In some implementation schemes, nucleic acids are modified as follows:
[0016] a) The nucleotides at positions 7, 9, 10, and 11, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0017] b) The nucleotides at positions 1-6, 8, and 12-21, starting from the 5′ end of the first strand, are modified with 2′-O-methyl (2′-Ome);
[0018] c) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0019] d) Nucleotides at positions 1, 3-5, 8-13, 15, and 17-23, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome); and
[0020] e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
[0021] In some implementation schemes, nucleic acids are modified as follows:
[0022] a) Nucleotides 1-4, 6, 10, 11 and 13-19 from the 5′ end of the first strand are modified with 2′-O-methyl (2′-Ome);
[0023] b) The nucleotides at positions 5, 7-9, and 12, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0024] c) The nucleotides at positions 1, 3, 4, 5, 9-13, 15-19, and 21, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome);
[0025] d) The nucleotides at positions 2, 6, 14, and 20, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0026] e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
[0027] In some implementation schemes, nucleic acids are modified as follows:
[0028] a) Nucleotides 1-4, 6, 10 and 11-19 from the 5′ end of the first strand are modified with 2′-O-methyl (2′-Ome);
[0029] b) The nucleotides at positions 5 and 7-9, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0030] c) The nucleotides at positions 1, 3, 4, 5, 9-13, 15, and 17-21, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome);
[0031] d) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0032] e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
[0033] In some embodiments, the nucleic acid includes at least one phosphate-thioester nucleotide linker. In some embodiments, the nucleic acid includes two consecutive phosphate-thioester nucleotide links at the 3′ and 5′ ends of the second strand, and two consecutive phosphate-thioester nucleotide links at the 5′ end of the first strand.
[0034] In some embodiments, the nucleic acid or its pharmaceutical composition is administered at a dose of about 100 mg to about 800 mg. In some embodiments, the nucleic acid or its pharmaceutical composition is administered subcutaneously. In some embodiments, administration of the nucleic acid or its pharmaceutical composition results in a reduction of serum triglyceride levels by about 70%.
[0035] In some embodiments, the nucleic acid or a pharmaceutical composition thereof is administered in combination with another therapeutic agent. In some embodiments, the second therapeutic agent is selected from the group consisting of fibrates, metformin, statins, and niacin.
[0036] In some embodiments, a method is provided to reduce the activity or expression level of glycerol kinase (GK) in a subject in need, the method comprising administering to the subject in need the nucleic acid or pharmaceutical composition thereof disclosed herein.
[0037] In some implementations, the application of nucleic acid or pharmaceutical composition inhibits mTORC1 (mTOR complex 1).
[0038] In some embodiments, a method for lowering cholesterol levels in a subject in need is provided, wherein the method includes administering a nucleic acid or a pharmaceutical composition thereof disclosed herein.
[0039] Brief description of the attached figures
[0040] Figure 1 This is a schematic diagram of the TAG synthesis pathway.
[0041] Figure 2 The image shows hematoxylin-eosin (H&E) staining of liver sections from liver GK knockout (LGKKO) mice. RD indicates a normal diet, and HFD indicates a high-fat diet.
[0042] Figure 3 This is a Western blot of lipogenesis protein expression in LGKKO mice and wild-type (WT) mice.
[0043] Figure 4 These are four figures showing the effects of incubation in primary mouse hepatocytes after incubation in a medium containing physiologically fasted concentrations of glycerol, pyruvate / lactate, L-glutamine, and glucose (Gro / PL / Gln / Glu). 13 Cellular metabolites labeled with C isotope. Only one substrate is shown in each image. 13 C is used as a designation, indicated by an asterisk. An exception is the pyruvate / lactate condition, where both substrates are rapidly interconverted and thus... 13 C-labeled. Error bars represent SEM. Cellular metabolites are shown. 13C isotopic configurations (isotope sequences) are labeled with different colors (m + 0 to m + 6), n = 9 biological replicates. Unless otherwise specified, the major marker for each condition is m+3. DHAP, dihydroxyacetone phosphate; GAP, glyceraldehyde-3-phosphate; Gln, L-glutamine.
[0044] Figure 5A and Figure 5B The body weight and GK expression in the kidneys of liver-specific GK knockout mice (LGKKO) and wild-type (WT) mice under RD (normal diet) are shown. Figure 5A A graph showing the weight of a mouse. Figure 5B GK expression in eWAT (epididymal adipose tissue), small intestine (sInt), kidney, liver, pancreas, and muscle is shown. RP17 (ribosomal protein L7) was used as a reference control to normalize expression. ## indicates p < 0.01 in the t-test comparing WT mice and LGKKO mice. The left bar represents WT mice, and the right bar represents LGKKO mice.
[0045] Figure 6A-6I The results showed that hepatic glycerol kinase deficiency reduced blood glucose levels and fasting blood glucose in LGKKO mice. Figure 6A GK expression in the kidneys and liver is shown. # indicates p < 0.05 in the t-test comparing WT and LGKKO mice under RD and HFD conditions. Figure 6B Western blots were used to visualize GK protein levels in WT and LGKKO mice. PPIB (peptidyl propionyl isomerase B) was used as a loading control. Figure 6C Blood glucose levels in WT, LGKKO, and albumin-cre (alb-CRE) mice after intraperitoneal (IP) injection of 9 mM / kg glycerol (glycerol tolerance test). Figure 6D The weights of WT and LGKKO mice fed a conventional diet (RD) or a high-fat diet (HFD) are shown. Figure 6E The lean mass and fat mass of LGKKO and WT mice fed RD and HFD are shown. ## indicates that the p < 0.01 of the t-test for comparing WT and LGKKO mice. Figure 6F The study showed the blood glucose levels in WT and LGKKO mice that were fed RD or HFD after a 12-hour fast. Figure 6GThe blood glucose levels of LGKKO and WT mice fed RD and HFD are shown. The Glycerol Tolerance Test (Glycerol TT) involved an intraperitoneal injection of 9 mM / kg glycerol, followed by blood glucose measurement. The Pyruvate Tolerance Test (Pyruvate TT) involved an intraperitoneal injection of 9 mM / kg sodium pyruvate, followed by blood glucose measurement. Figure 6H The circulating glycerol levels and non-esterified free fatty acids (NEFA) are shown in WT and LGKKO mice fed with RD or HFD. Figure 6I Plots showing fasting insulin levels in LGKKO and WT mice fed RD and HFD diets. # indicates p < 0.05 in the t-test comparing WT and LGKKO mice.
[0046] Figures 7A-7G The results showed that hepatic glycerol kinase deficiency reduced triglyceride storage in the liver of LGKKO mice. Figure 7A A graph showing the liver weight (g) of LGKKO and WT mice fed RD and HFD diets. # indicates p < 0.05 in the t-test comparing WT and LGKKO mice. Figure 7B Figures showing muscle and eWAT weights of LGKKO and WT mice fed RD and HFD. Figure 7C A graph showing the degree of steatosis in LGKKO and WT mice fed RD and HFD, respectively. # indicates p < 0.05 in the t-test comparing WT and LGKKO mice, and ## indicates p < 0.01 in the t-test comparing WT and LGKKO mice. Figure 7D A graph showing liver triglyceride levels in LGKKO and WT mice fed RD and HFD diets. Figure 7E A graph showing serum alanine aminotransferase (ALT) activity levels in LGKKO and WT mice fed RD and HFD diets. Figure 7F Plotting the levels of de novo lipogenesis (DNL) proteins in LGKKO and WT mice fed RD and HFD diets. Srebf1c = Gene encoding sterol regulatory element (SRE) binding transcription factor 1 (SREBP1). Pparg = Gene encoding peroxisome proliferation activation receptor γ. Acly = Gene encoding ATP citrate lyase. Acaca = Gene encoding acetyl-CoA carboxylase α. Fasn = Gene encoding fatty acid synthase. Figure 7G The protein levels of ACLY (ATP citrate lyase), ACC (acetyl-CoA carboxylase), and FAS (fatty acid synthase) (from the genes mentioned above) in LGKKO and WT mice fed RD and HFD diets are shown. # indicates p < 0.05 in the t-test comparing WT and LGKKO mice; ## indicates p < 0.01 in the t-test comparing WT and LGKKO mice.
[0047] Figures 8A-8D The results showed that in LGKKO mice, hepatitis GK enhanced the re-esterification of triglycerides in the liver. Figure 8A This is a schematic diagram illustrating the formation of triglycerides in the liver. Figure 8B The expression of CD36 and Slc27a5 (FATP5 gene) in LGKKO and WT mice fed RD and HFD is shown. Figure 8C The expression of Fapp1 (fatty acid binding protein 1), Acsl1 (acyl-CoA synthase long chain family member 1), and Acsl3 (acyl-CoA synthase long chain family member 3) in LGKKO and WT mice fed RD and HFD is shown. Figure 8D The expression of Gpam (glycerol-3-phosphoacyltransferase), Gpat4 (glycerol-3-phosphoacyltransferase 4), Agpat2 (1-acylglycerol-3-phospho-O-acyltransferase 2), Mogat1 (monoacylglycerol O-acyltransferase 1), Dgat1 (diacylglycerol O-acyltransferase 1), and Dgat2 (diacylglycerol O-acyltransferase 2) in LGKKO and WT mice fed RD and HFD is shown.
[0048] Figure 9A and 9B The results showed that in vitro administration of GalNAc-siRNA targeting GK could reproduce the LGKKO mouse phenotype. Figure 9A A graph showing the GK mRNA levels in primary WT mouse hepatocytes treated with GalNAc-siRNA (mGK1 (SEQ ID NO: 1) and mGK2 (SEQ ID NO: 3)) purified with 10 nM or 100 nM. Figure 9B A graph showing blood glucose levels in WT mice injected with 3 mg / kg (SQ) of the described GalNAc-siRNAs targeting GK (mGK1 (SEQ ID NO: 1) and mGK2 (SEQ ID NO: 3)) after a glycerol tolerance test. Ctrl (control) represents non-specific siRNAs. P < 0.04 compared to Ctrl. Invention Details
[0050] This disclosure relates to an unexpected finding: agents that inhibit glycerol kinase (GK) can effectively treat or alleviate diseases associated with elevated triglyceride (TAG) levels. GK converts glycerol into glycerol-3-phosphate (glycerol 3-P). It is generally believed that glycerol 3-P can be generated through multiple pathways, and its hepatic levels are not dependent on the intact GK pathway.
[0051] Glycerol 3-P is the backbone of triglyceride (TAG) synthesis. Figure 1 Elevated TAG levels are associated with a variety of diseases or conditions, such as hypertriglyceridemia or MASLD. TAG consists of three long-chain fatty acids (acyl groups) linked to a glycerol backbone molecule via ester bonds (the process of fatty acid-glycerol linkage is called esterification). In this configuration, TAG is nonpolar and rapidly assembles into lipid droplets in adipocytes. During fasting, lipases act on TAG in peripheral adipocytes, releasing fatty acids and glycerol into circulation. Glycerol returning to the liver must first be activated by glycerol kinase (to generate glycerol 3-phosphate) to initiate esterification.
[0052] GK inhibitors can be used in subjects who require them, for example, to treat or prevent conditions associated with elevated serum triglyceride (TAG) levels and MASLD. In some embodiments, the condition is hypertriglyceridemia or MASLD. In some embodiments, the GK inhibitor reduces GK activity or expression levels in the subject who requires them. In other embodiments, administration of a GK inhibitor to the subject who requires them reduces serum triglyceride levels by about 70%. For example, the GK inhibitor reduces serum triglyceride levels by at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any value between these values.
[0053] In addition, GK inhibitors can be used to lower cholesterol levels in subjects who require them. In some implementations, GK inhibitors can reduce cholesterol levels by at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any value between these values.
[0054] In some embodiments, administration of a GK inhibitor can inhibit mTORC1. In some embodiments, the GK inhibitor can inhibit mTORC1 such that the expression or activity level of mTORC1 is reduced by at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any value between these values.
[0055] GK inhibitors
[0056] In some embodiments, the pharmaceutical agent comprises a GK inhibitor. In some embodiments, the GK inhibitor comprises an antibody or its antigen-binding fragment, a small molecule, or a nucleic acid.
[0057] In some implementations, the nucleic acid is siRNA. In other implementations, the nucleic acid is a GalNAc-siRNA conjugate.
[0058] In this article, the term "nucleic acid" refers to two strands containing nucleotides capable of interfering with GK gene expression. The resulting GK repression can be complete or partial. The term "nucleic acid" can also include nucleic acid conjugates. As used herein, the term "GalNAc" refers to 2-(acetamido)-2-deoxy-D-galactopyranose, also known as N-acetylgalactosamine. Both the terms "GalNAc" and "N-acetylgalactosamine" include β-type: 2-(acetamido)-2-deoxy-β-D-galactopyranose and α-type: 2-(acetamido)-2-deoxy-α-D-galactopyranose. β-type: 2-(acetamido)-2-deoxy-β-D-galactopyranose and α-type: 2-(acetamido)-2-deoxy-α-D-galactopyranose are used interchangeably.
[0059] The nucleic acid comprises two independent polynucleotide chains. In some embodiments, the nucleic acid is a siRNA (short interfering RNA) molecule. siRNA can inhibit the expression of a target gene (i.e., GK) via the RNA interference (RNAi) pathway. Specifically, the inhibition of the target gene is achieved through the targeted degradation of the posttranscriptional target gene mRNA transcript. The siRNA is introduced into an RNA-induced silencing complex (RISC). The RISC complexes with the RNA through sequence complementarity with the target sequence.
[0060] In some implementations, each nucleic acid strand contains a two-base-pair overhang. These overhangs (5' or 3') can be located at either end of the first or second strand. In some implementations, both ends of the nucleic acid have overhangs. As used herein, an "overhang" refers to the single-stranded portion of a double-stranded nucleic acid that extends beyond the terminal nucleotide of the complementary strand. Members of the Argonaute protein family recognize these overhangs and select one nucleic acid strand as the guide strand (also known as the antisense strand). The second strand, called the passenger strand, is degraded.
[0061] In some embodiments, the nucleic acid is 18-29 nucleotides long. In some embodiments, the first strand of the nucleic acid is 18-29 nucleotides long. In some embodiments, the first strand of the nucleic acid is 19-25 nucleotides long. In some embodiments, the second strand of the nucleic acid is 18-29 nucleotides long. In some embodiments, the second strand of the nucleic acid is 20-27 nucleotides long.
[0062] In other embodiments, the first strand is 21 nucleotides long and the second strand is 23 nucleotides long. In other embodiments, the first strand is 19 nucleotides long and the second strand is 21 nucleotides long.
[0063] In some embodiments, the nucleic acid includes at least one double-stranded region comprising at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein the nucleic acid includes the nucleic acid sequence pairs listed in Table 1.
[0064] Table 1. Examples of nucleic acid sequences that inhibit GK mRNA expression.
[0065]
[0066] Note: Nucleotide modifications are represented by the following numbers (column 4): 1 = 2F'-dU, 2 = 2'F-dC, 3 = 2'F-dA, 4 = 2'-OMe-rA, 5 = 2'-OMe-rG, 6 = 2'-OMe-rC, 7 = 2'-OMe-rU, 8 = GNA (ethylene glycol nucleic acid), 9 = 2'F-dG
[0067] Nucleic acids may include ribonucleotides, modified ribonucleotides, deoxynucleotides, deoxyribonucleotides, or nucleotide analogs that mimic nucleotides and can pair with corresponding bases on a target sequence or complementary strand. In some embodiments, the nucleic acid comprises at least one modified nucleotide. In some embodiments, all nucleotides in the first and second strands are modified nucleotides.
[0068] Modified nucleotides can improve the resistance to degradation and / or stability of nucleic acids. Examples of modified nucleotides include, but are not limited to, 2'-deoxy-2'-fluoro (2'F), 2'-O-methyl (2'-Ome), glycol-based nucleic acids (GNA), non-locked nucleic acids (UNA), and locked nucleic acids (LNA). GNA is an acyclic nucleic acid analog linked by phosphodiester bonds. Modified nucleotides do not alter the nature of the nucleic acid. In other words, modifications to the nucleic acid backbone do not change the nature of the nucleotide because the nucleic acid bases themselves remain identical to those in the reference sequence.
[0069] In some implementations, the nucleic acid may contain a modified nucleoside. Examples of such modified nucleosides include, but are not limited to, 2-thiouridine (S). 2 U), pseudouridine (Ψ), and dihydrouridine (D). Modified nucleosides can modulate the silencing power of nucleic acids and affect their thermodynamic stability (Sipa et al. RNA. 2007. 13(8): 1301-1316).
[0070] In some implementation schemes, nucleic acids are modified as follows:
[0071] a) The nucleotides at positions 7, 9, 10, and 11, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0072] b) The nucleotides at positions 1-6, 8, and 12-21, starting from the 5′ end of the first strand, are modified with 2′-O-methyl (2′-Ome);
[0073] c) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0074] d) Nucleotides at positions 1, 3-5, 8-13, 15, and 17-23, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome); and
[0075] e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
[0076] In some implementation schemes, nucleic acids are modified as follows:
[0077] a) Nucleotides 1-4, 6, 10, 11 and 13-19 from the 5′ end of the first strand are modified with 2′-O-methyl (2′-Ome);
[0078] b) The nucleotides at positions 5, 7-9, and 12, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0079] c) The nucleotides at positions 1, 3, 4, 5, 9-13, 15-19, and 21, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome);
[0080] d) The nucleotides at positions 2, 6, 14, and 20, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0081] e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
[0082] In some implementation schemes, nucleic acids are modified as follows:
[0083] a) Nucleotides 1-4, 6, 10 and 11-19 from the 5′ end of the first strand are modified with 2′-O-methyl (2′-Ome);
[0084] b) The 5th and 7th-9th nucleotides starting from the 5′ end of the first strand are modified with 2′-deoxy-2′-fluorine (2′F);
[0085] c) The nucleotides at positions 1, 3, 4, 5, 9-13, 15, and 17-21, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome);
[0086] d) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F);
[0087] e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
[0088] The "duplex region" of a nucleic acid contains nucleotide base pairs between the first and second strands, typically based on Watson-Crick base pairing. The duplex region may contain modified nucleotides, or modified nucleotides may be located within a single-stranded region outside the duplex region.
[0089] In some embodiments, the nucleic acid comprises two or more nucleotides linked together by native phosphodiester bonds. In some embodiments, the nucleic acid comprises two or more nucleotides linked together by any other linkage, such as phosphate thioester (PS) linkages or phosphate dithioester linkages. Both non-linking oxygen atoms of the phosphate dithioester are replaced by sulfur atoms. One non-bridging oxygen atom of the phosphate thioester is replaced by a sulfur atom. In some embodiments, the nucleic acid comprises at least one phosphate thioester nucleotide linker. In other embodiments, the nucleic acid comprises two consecutive phosphate thioester nucleotide links at both the 3' and 5' ends of the second strand, and two consecutive phosphate thioester nucleotide links at the 5' end of the first strand. PS nucleotide links can improve the stability of the nucleic acid.
[0090] The nucleic acid may contain at least one chemical modification. In some embodiments, the chemical modification includes one or more N-acetylgalactosamine (GalNAc) moieties or derivatives thereof, which are directly conjugated to the nucleic acid or indirectly conjugated via a linker. GalNAc binds to the desialylate glycoprotein receptor (ASGPR), which is mainly expressed on hepatocytes. Thus, the GalNAc-siRNA conjugate is delivered to hepatocytes.
[0091] The chemical modification can be conjugated to the 5' or 3' end of the first or second chain. In some embodiments, the chemical modification is conjugated to the 3' end of the first chain. In other embodiments, the chemical modification is conjugated to the 3' end of the first chain via a three-armed GalNAc conjugate. Conjugates having three GalNAc ligands and containing phosphate groups are described in Dubber et al. Bioconjug. Chem. 2003. 14(1):239-46. Furthermore, U.S. Patent No. 5,885,968 also describes a three-armed cluster glycoside.
[0092] In some implementations, the nucleic acid is chemically conjugated with a compound containing formula (I):
[0093] [S—X]3-YZ— (I)
[0094] in:
[0095] S is GalNAc;
[0096] X is the connector that connects to the branch unit;
[0097] Y is the branch unit;
[0098] Z represents the bridging unit; and
[0099] In this case, nucleic acids, as described in this article, are conjugated to Z via phosphate or modified phosphate.
[0100] In some implementations, equation (I) has the following structure:
[0101]
[0102] In formula (I) above, the branching unit "A" is divided into three branches to accommodate three sugars. This branching unit is covalently linked to the remaining chemically modified linker and the nucleic acid. The branching unit may contain branched aliphatic groups selected from amides, alkyl groups, disulfide bonds, polyethylene glycol, ethers, thioethers, and hydroxylamino groups. The branching unit may also contain groups selected from alkyl and ether groups.
[0103] “X 3 "The bridging unit can be linear and covalently bound to the branching unit and nucleic acid."
[0104] The sugar in formula (I) may be selected from N-acetylgalactosamine, mannose, galactose, glucose, glucosamine, and fucose. In some embodiments, the sugar is N-acetylgalactosamine (GalNAc).
[0105] In some implementations, the nucleic acid is conjugated with chemical modifications and has the following structure:
[0106]
[0107] Where Z represents the nucleic acid described in this article.
[0108] The nucleic acids described herein can be synthesized using methods commonly used by those skilled in the art (Hu et al. Signal Transduction and Targeted Therapy. 2020. 5(101): doi.org / 10.1038 / s41392-020-0207-x). For example, nucleic acids can be synthesized through chemical synthesis or in vivo expression. In some embodiments, the target nucleic acid is produced in a host organism or cell via an expression vector.
[0109] Treatment
[0110] Other aspects of this disclosure include methods of treating diseases by administering the GK inhibitors described herein. In some embodiments, the GK inhibitors are used in methods of treating or preventing diseases associated with elevated serum TAG levels and MASLD. In some embodiments, the disease is hypertriglyceridemia or MASLD. MASLD typically progresses to steatohepatitis, cirrhosis, and hepatocellular carcinoma. Furthermore, diseases associated with MASLD include, but are not limited to, metabolic syndrome, type 2 diabetes, and dyslipidemia.
[0111] In some implementations, GK inhibitors are used in methods for treating or preventing high, elevated cholesterol levels (e.g., hyperlipidemia or hypercholesterolemia).
[0112] In some implementations, GK inhibitors treat disease by inhibiting mTORC1. mTORC1 is one of two complexes (mTORC2) containing mTOR. mTOR functions as a nutrient sensor, regulating cellular functions related to cell survival, proliferation, and growth. mTORC1 regulates cell growth and metabolism. mTORC1 is activated when recruited to the lysosomal surface. Dysregulation of mTORC1 signaling is associated with a variety of diseases, including diabetes (Orozco et al. Nat. Metab. 2020.2(9): 893-901). Inhibition of mTORC1 blocks the synthesis of fatty acids and cholesterol. In other implementations, the GK inhibitors described herein can treat diseases associated with high serum TAG and elevated cholesterol levels.
[0113] As used herein, the term "treatment" for any disease or condition, in one embodiment, means improving the disease or condition (i.e., preventing or alleviating the development of the disease or at least one of its clinical symptoms). In another embodiment, "treatment" means improving at least one physiological parameter that may not be identifiable by the subject. In yet another embodiment, "treatment" means regulating a disease or condition, including physical regulation (e.g., stabilizing identifiable symptoms), physiological regulation (e.g., stabilizing a physiological parameter), or both. In yet another embodiment, "treatment" means preventing or delaying the onset, development, or progression of a disease or condition.
[0114] Terms such as “prevention” or “avoidance” refer to reducing the probability of a subject developing a disease or condition that does not yet have, but is at risk or susceptible to developing.
[0115] As used herein, the term "subject" refers to a mammal. As used herein, the term "mammal" is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals include, but are not limited to, human or non-human mammals such as canines, bovines, equines, sheep, or felines. Individuals and patients are also subjects in this article.
[0116] As used herein, the term “therapeutic effective dose” generally refers to a specific amount of GK inhibitor that can result in one or more of the following: a) reducing the activity or expression level of GK, b) treating or preventing disease associated with elevated TAG levels and MASLD, c) inhibiting mTORC1, and / or d) reducing cholesterol levels in subjects in need.
[0117] As used herein, the term “hyperlipidemia” refers to an abnormally high level of lipids in the blood. Hyperlipidemia can manifest in at least three forms: (1) hypertriglyceridemia, i.e., elevated triglyceride levels; (2) hypercholesterolemia, i.e., elevated cholesterol levels; and (3) mixed hyperlipidemia, i.e., a combination of hypercholesterolemia and hypertriglyceridemia.
[0118] application
[0119] The GK inhibitors described herein can be delivered to subjects via various routes of administration. For example, GK inhibitors can be administered subcutaneously, intravenously, orally, parenterally, intraperitoneally, or systemically. In certain embodiments, GK inhibitors can be administered subcutaneously.
[0120] In some implementations, GK inhibitors can be used in combination with delivery media such as liposomes or any nucleic acid delivery method known in the art.
[0121] In some embodiments, the GK inhibitor is administered to a subject via a pharmaceutical composition comprising the GK inhibitor described herein. The pharmaceutical composition may comprise pharmaceutically acceptable excipients, such as buffers, diluents, preservatives, and stabilizers. In other embodiments, the pharmaceutical composition may be in lyophilized form, formulated as a sterile aqueous solution for injection, or as a galenic carrier material (e.g., gel, tablet, granules, etc.). In some embodiments, the pharmaceutical composition is formulated to improve stability.
[0122] The GK inhibitors described herein can be administered to subjects in need at therapeutically effective doses. In some embodiments, the GK inhibitor is an siRNA conjugate administered at doses of about 100 mg to about 800 mg. For example, the GK inhibitor can be administered at doses of about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, or any dose between these doses.
[0123] In some implementations, the GK inhibitor is a small molecule inhibitor administered at a dose of about 0.001 to about 1.0 mg per kilogram of patient body weight. For example, the GK inhibitor may be administered at a dose of about 0.01 mg / kg, about 0.02 mg / kg, about 0.03 mg / kg, about 0.04 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, or any dose between these doses.
[0124] In some implementations, a GK inhibitor is administered to the subject in need at a therapeutically effective dose for a period of time, followed by administration of another therapeutically effective dose. For example, a GK inhibitor may be administered at a dose of about 100 mg for at least one week, followed by administration of a dose of about 500 mg. In some implementations, a GK inhibitor is administered to the subject in need at a constant dose. If a subject experiences intolerable adverse reactions (assessed by the attending physician), the dose of the GK inhibitor may be adjusted.
[0125] In some implementation schemes, GK inhibitors are administered to subjects in need at least once a week, at least once a month, or at least once a year. For example, GK inhibitors may be administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, or annually. GK inhibitors are administered to subjects until the attending physician determines that GK inhibitors are no longer necessary.
[0126] Combination therapy
[0127] Some aspects of this disclosure include combining GK inhibitors with other therapeutic agents to produce a synergistic effect. In some embodiments, the GK inhibitor is administered in combination with a second therapeutic agent. For example, the second therapeutic agent may be selected from a group comprising fibrates, metformin, statins, and niacin (vitamin B3), which are used to treat high TAG levels. In one embodiment, if only TAG is elevated, fibrates and niacin may be used. In one embodiment, if the elevated TAG is caused by diabetes, metformin may be used. In one embodiment, if both cholesterol and TAG are elevated, statins may be used.
[0128] Fibrates are used to control and treat dyslipidemia. Examples of fibrates include, but are not limited to, gemfibrozil (LOPID®) and fenofibrate (Lipofen, FIBRICOR®, or TRIGLIDE). TM ).
[0129] Metformin (Riomet, GLUCOPHAGE®, or GLUMETZA®) is used to treat high blood sugar levels caused by type 2 diabetes.
[0130] Statins can lower cholesterol levels. Examples of statins include, but are not limited to, atorvastatin (LIPITOR). TM Fluvastatin (LESCOL® XL), lovastatin (ALTOPREV®), pitavastatin (LIVALO® or ZYPITAMAG®), pravastatin (PRAVACHOL®), rosuvastatin (CRESTOR® or Ezallor), and simvastatin (ZOCOR®).
[0131] In some implementations, the second therapeutic agent is administered on the same day as the GK inhibitor. In other implementations, the second therapeutic agent is administered separately from the GK inhibitor (e.g., on different days).
[0132] In some embodiments, at least two therapeutic agents are administered simultaneously in combination with a GK inhibitor. In some embodiments, at least two therapeutic agents are administered separately from the GK inhibitor (e.g., on different days).
[0133] Other definitions
[0134] As used herein and in the appended claims, the singular forms “a,” “the,” and “the” include the plural designations unless the context clearly specifies otherwise.
[0135] As used herein, the terms “including,” “comprising,” “containing,” or “having,” and variations thereof, are intended to cover the items listed thereafter and their equivalents, as well as other subjects, unless otherwise stated.
[0136] As used herein, phrases such as “in one implementation,” “in various implementations,” and “in some implementations” appear repeatedly. These phrases do not necessarily refer to the same implementation, but may refer to the same implementation unless the context otherwise requires.
[0137] As used herein, the terms “and / or” or “ / ” refer to any one of the items associated with that item, any combination of the items, or all of the items.
[0138] As used herein, the term "each" is intended to indicate a single item in a series of items, but not necessarily all items in the series, unless explicitly disclosed or otherwise provided by context. All publications mentioned herein are incorporated herein by reference in their entirety.
[0139] Example
[0140] Those skilled in the art will understand that modifications can be made to the above embodiments without departing from the overall inventive concept of the present invention. Therefore, it should be understood that the present invention is not limited to the specific embodiments or examples disclosed, but is intended to cover modifications within the spirit and scope of the invention as defined by the appended claims.
[0141] Example 1. Materials and Methods
[0142] This embodiment describes in detail the materials and methods used in Embodiment 2.
[0143] Primary hepatocyte isolation
[0144] Hepatocytes were isolated using age-matched 3- to 4-month-old albino male C57BL / 6J mice via pH culture. All mice were anesthetized with a ketamine / toluidine mixture (Henry Schein) prior to isolation. The portal vein was cannulated, and the cells were perfused for 10 minutes at 37°C with Kreb Ringer's bicarbonate buffer (Sigma-Aldrich) containing EGTA. Following the initial perfusion, the cells were washed with Kreb Ringer's wash buffer (Roche Holding AG) containing CaCl2 and Liberase (Roche Holding AG) at 37°C for 10 minutes. Hepatocytes were filtered through a gauze and resuspended in seeding medium: William E medium (Sigma-Aldrich) containing 10% fetal bovine serum (Sigma-Aldrich), 200 nM dexamethasone (Sigma-Aldrich), 1× penicillin / streptomycin (Thermo Fisher Scientific), and 2 mM L-glutamine (Thermo Fisher Scientific). Cells were cultured at 3 × 10⁶ cells / day. 5 Hepatocytes were seeded at a density in six-well collagen (Sigma-Aldrich) coated plates. Hepatocyte cultures were allowed to recover overnight. Unless otherwise specified, all experiments were initiated 24 hours after isolation.
[0145] In vitro isotope labeling experiment
[0146] After recovery from isolation at 37°C and 5% CO2, cells were serum starved for 3 hours in basal medium (glucose-free Dulbecco modified Eagle medium supplemented with 3.52 mg / ml Hepes, 1× penicillin / streptomycin, and 2 mM L-Gln), if applicable. For in vitro glucose production, cells were washed once with 1×PBS and then treated with glucose-producing medium (glucose-free Dulbecco modified Eagle medium supplemented with 3.52 mg / ml Hepes and 1× penicillin / streptomycin) and substrate, with or without 20 nM glucagon. For physiological concentration substrate protocols, 0.5 mM L-glutamine, 0.33 mM glycerol, 0.25 mM sodium pyruvate, and / or 2.5 mM sodium lactate were used. Medium was collected every 2 hours for glucose production and labeling assays. To compensate for substrate loss and maintain physiological concentrations, 0.22 μmol glycerol, 0.33 μmol pyruvate, and 0.05 μmol L-glutamine were added to each ml of culture every 2 hours after culture medium sampling.
[0147] 13 In the C-labeled substrate experiment, the same conditions were used, but the substrate was replaced with one of the following each time: 13 C3-Sodium pyruvate / sodium lactate, 13 C5- L-glutamine, 13 C3-glycerol or 13 C6-D-glucose (Cambridge Isotope Lab, Inc.), as shown. Culture medium metabolites were extracted directly with 100 volumes of ice-cold 40:40:20 methanol:acetonitrile:water solution (containing 0.1% formic acid). Cells were washed once with pre-warmed 1×PBS and then extracted with ice-cold 40:40:20 methanol:acetonitrile:water solution (containing 0.1% formic acid) (2 ml per million cells). Both culture medium and cell extracts were incubated on ice for 5 min, neutralized with 0.7% NH4HCO3, and then centrifuged at 16,000 g for 10 min. The supernatant was then transferred to another clean tube for mass spectrometry (LC-MS) analysis (see Chiles, E, et al. Anal. Biochem. 2019. 575: 40-43).
[0148] Animals and animal care
[0149] Glucose homeostasis in female mice changes during estrus (see Santiago, AM et al. Physiol. Behav. 2016. 167: 248-254). To avoid estrus-related variability, only male mice were used in this study. All mice were housed in a C57BL / 6J-albino background (Jackson Laboratory; B6(Cg)-Tyrc-2J / J). Fluxed mice were... Gk Mice were crossed with albumin-Cre transgenic mice to obtain either control (WT) mice or LGKKO mice. All mice described in this article were housed in a pathogen-free barrier facility with a 12-hour light / dark cycle. All animal experimental protocols were approved by the Institutional Animal Care and Use Committee of Rutgers University.
[0150] Protein extraction and Western blotting
[0151] Protein preparation was performed on hepatocytes and tissue samples lysed with Laemmli buffer containing β-mercaptoethanol, respectively. For tissue protein preparation, after animal sacrifice, tissue samples were immediately flash-frozen in liquid nitrogen and then mechanically homogenized using a Bullet Blender (Next Advance, Inc.) in ice-cold RIPA buffer (Sigma-Aldrich) containing 1× protease inhibitor (Roche Holding AG) and 1× phosphatase inhibitor (Thermo Fisher Scientific). The homogenate was centrifuged at 16,000 g at 4 °C, and the supernatant was collected. Protein concentration was determined using the Pierce BCA assay (Thermo Fisher Scientific). Western blotting was performed using standard procedures and the standard V3 Western Workflow (Bio-Rad Laboratories). All standard Western blotting reagents were obtained from Bio-Rad Laboratories. Antibodies obtained from Cell Signaling Technology: ACLY (catalog number 4332), ACC (catalog number 3676), HRP-linked anti-rabbit IgG (catalog number 7074S), HRP-linked anti-mouse IgG (catalog number 58802), FAS (catalog number 4233), or PPIB (catalog number 43603). Antibody obtained from Abcam: GK (catalog number ab126599).
[0152] Metabolic test
[0153] In the pyruvate and glycerol tolerance test, mice were fasted overnight (12 hours) and then injected intraperitoneally with either sodium pyruvate (9 mmol / kg; Sigma-Aldrich) or glycerol (9 mmol / kg; Sigma-Aldrich). Blood glucose was measured using a blood glucose meter (BaterContour) through a small incision in the caudal vein.
[0154] Statistical analysis
[0155] All analyses and graphs were performed using GraphPad Prism 7.0 software (graphpad.com / scientific-software / prism / ). Statistical analyses were performed using Student's t-tests or one-way ANOVA, depending on the circumstances.
[0156] Example 2. Liver GK knockout (LGKKO) mice were protected from high-fat diet (HFD)-induced hypertriglyceridemia and MASLD.
[0157] Glycerol metabolism in the liver is considered a secondary pathway and is not expected to be a major determinant of TAG synthesis and storage. However, liver GK knockout (L-GkKO) mice unexpectedly showed that approximately 90% of hepatic glycerol 3-P originates from the GK pathway. Figure 4 ).
[0158] Furthermore, LGKKO mice were protected from high-fat diet (HFD)-induced hypertriglyceridemia and MASLD. Figure 2 (Blank areas indicate TAG deposition). It might be expected that serum non-esterified fatty acids (NEFA) would be elevated in the presence of hepatic esterification defects. However, this was not the case in LGKKO mice; their serum NEFA levels were 60% lower than those in mice fed HFD, and the difference was statistically significant. Figure 3 These mice also exhibited a defect in de novo lipogenesis, which was associated with impaired activation of the nutrient sensor target protein complex 1 (mTORC1). Figure 3 The study revealed defects in the expression of lipogenic proteins (ACLY (ATP citrate lyase), ACC (acetyl-CoA carboxylase), and FAS) in LGKKO mice, indicating that defects in glycerol metabolism also reduce fatty acid synthesis.
[0159] A unique GalNAc-siRNA conjugate targeting GK in mouse primary hepatocytes reproduced the GK knockout effect in the liver. Several unmodified and modified GalNAc-siRNA conjugates targeting mouse GK were synthesized and tested in mouse primary hepatocytes. These modifications enhanced liver targeting (3xGalNAc) or improved siRNA stability (by altering the ribose or its linkage). The modifications used are listed in Table 1 (SEQ ID NO: 1 and SEQ ID NO: 2 (mGK1 and mGK1-2) and SEQ ID NO: 3 and SEQ ID NO: 4 (mGK2 and mGK2-2)). We screened for two unique modified GalNAc-siRNA conjugates that did not exhibit nonspecific effects and completely eliminated GK mRNA expression (Table 1 and SEQ ID NO: 4). Figure 3 Treatment with these conjugates reproduced the GK knockout effect in the liver, resulting in undetectable hepatic GK expression for 3-4 weeks post-treatment. Human GK GalNAc-siRNA conjugates were also synthesized for testing in human primary hepatocytes. Knockdown of hepatic GK expression using GalNAc-siRNA conjugates may be an effective treatment for hypertriglyceridemia and MASLD in humans.
[0160] Alterations in human glycerol metabolism also suggest its crucial role in TAG synthesis. For example, obese men and women often exhibit hypertriglyceridemia and MASLD, with statistically significant increases in fasting serum glycerol and NEFA levels, reflecting increased basal lipolysis in peripheral adipose tissue (Arner et al., Obes Facts. 2015. 8(2):147-55). These substrates can return to the liver and be esterified into TAG. In contrast, adults carrying germline GK mutations that reduce glycerol metabolism have been found to be asymptomatic, but their lipid metabolism profile remains unclear.
[0161] A systematic review of GK gene defects in adults showed that, compared with control subjects, GK gene defects were associated with a lower prevalence of cardiovascular disease, obesity, and diabetes (Lamiquiz-Moneo et al. Atherosclerosis, 2020 315: 24-32). As expected, serum glycerol levels were significantly elevated compared with control subjects, but serum TAG (directly measured) and GGT (a biomarker for obesity-related liver disease) levels were significantly lower.
[0162] Example 3. Phase II clinical trial of GK inhibitors
[0163] This study is a phase II trial designed to evaluate the efficacy of multiple escalation doses of 3xGalNAc-conjugated siRNA targeting GK in patients with hypertriglyceridemia and an increased risk of cardiovascular disease.
[0164] Research Objectives
[0165] The primary objective of the multiple dose escalation study was to evaluate the safety, tolerability, and pharmacokinetics (PK) of 3xGalNAc-conjugated siRNAs targeting GK (specifically, 1. SEQ ID NO: 5 and SEQ ID NO: 6, 2. SEQ ID NO: 7 and SEQ ID NO: 8, and 3. SEQ ID NO: 9 and SEQ ID NO: 10) at three different doses, administered as a single or double dose, compared to placebo-controlled injections.
[0166] A secondary objective of this study was to determine whether 3xGalNAc siRNA effectively reduced serum triglyceride levels compared to placebo-controlled injections.
[0167] Research Design
[0168] This is a phase II study designed to evaluate the efficacy of escalating doses of 3xGalNAc siRNA. Patients will be randomized to receive either a single dose of placebo or 200, 300, or 500 mg of 3xGalNAc siRNA, or two doses (on day 1 and day 90) of placebo or 100, 200, or 300 mg of 3xGalNAc siRNA. It is anticipated that 20 patients will be enrolled in each of the six 3xGalNAc siRNA treatment groups and the two placebo groups (one or two doses of placebo).
[0169] Patient participation is expected to last approximately 180 days, including several scheduled follow-up periods. Additional follow-up may be required, in which case the study is expected to last up to 270 days.
[0170] The patient received the following treatment:
[0171] Single dose (day 1):
[0172] Filtering: Day -14 to Day -1
[0173] Randomization to begin drug study: Day 1
[0174] Treatment phase: Day 1
[0175] Follow-up: Days 2, 14, 90, and 180
[0176] Two doses (one injection each on day 1 and day 90):
[0177] Filtering: Day -14 to Day -1
[0178] Randomization to begin drug study: Day 1
[0179] Follow-up: days 2, 14, 90, 92, 104, and 180.
[0180] Inclusion criteria
[0181] Patients meeting the following criteria will be included in the study:
[0182] 1. Male or female subjects aged ≥18 years.
[0183] 2. Presence of atherosclerotic cardiovascular disease or risk equivalents of atherosclerotic cardiovascular disease (type 2 diabetes, familial hypercholesterolemia, including those assessed according to the Framingham Risk Score). (or an equivalent method to assess the medical history of subjects with a 10-year risk of cardiovascular events).
[0184] 3. At the time of screening, subjects with atherosclerotic cardiovascular disease had serum triglycerides > 150 mg / dL, or subjects with risk equivalence factors for atherosclerotic cardiovascular disease had serum triglycerides ≥ 100 mg / dL.
[0185] 4. The calculated glomerular filtration rate is >30 mL / min (glomerular filtration rate is assessed using standardized local clinical methods).
[0186] 5. Subjects currently receiving lipid-lowering therapy (such as statins and / or ezetimibe) must have maintained a stable dose for ≥30 days prior to screening and must not plan to change medications or doses during the study.
[0187] 6. Willing and able to give informed consent before commencing any research-related procedures, and willing to comply with all required research procedures.
[0188] According to the Framingham Risk Score >20%.
[0189] Exclusion criteria
[0190] Patients will be excluded from the study for the following reasons:
[0191] 1. Any uncontrolled or serious illness, or any medical or surgical condition, may interfere with a subject's participation in the clinical study and / or may expose them to significant risks (in the investigator's judgment).
[0192] 2. Underlying known diseases, surgeries, physical or medical conditions that researchers believe may interfere with the interpretation of clinical study results.
[0193] 3. New York Heart Association (NYHA) class II, III, or IV heart failure, or a last known left ventricular ejection fraction of 180 mmHg, or a diastolic blood pressure >110 mmHg before randomization despite antihypertensive treatment.
[0194] 4. Cardiac arrhythmias that cannot be controlled by medication or ablation within 3 months prior to randomization.
[0195] 5. Any history of hemorrhagic stroke.
[0196] 6. A major adverse cardiac event occurred within 6 months prior to randomization.
[0197] 7. Uncontrolled severe hypertension: Despite receiving antihypertensive treatment, systolic blood pressure >180 mmHg or diastolic blood pressure >110 mmHg before randomization.
[0198] 8. Poorly controlled type 2 diabetes, i.e., glycated hemoglobin A1c (HbA1c) >10.0% before randomization.
[0199] 9. Active liver disease, defined as any known current infectious, neoplastic, or metabolic lesion of the liver, or an unexplained elevation of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) more than twice the upper limit of normal (ULN) at the time of screening, or an elevation of total bilirubin more than 1.5 times the upper limit of normal, confirmed by repeated measurements at intervals of at least 1 week.
[0200] 10. Serious comorbidities, where the subject's life expectancy is shorter than the duration of the trial (e.g., , (Acute systemic infection, cancer, or other serious illness). This includes all cancers, but excludes treated basal cell carcinoma that occurred more than 5 years prior to screening.
[0201] 11. Women who are pregnant or breastfeeding, or women of childbearing age who do not wish to use at least two methods of contraception (oral contraceptives, barrier methods, approved implantable contraceptives, long-acting injectable contraceptives, intrauterine devices, or tubal ligation throughout the study period). Women who have been postmenopausal for more than 2 years (defined as ≥1 year since their last menstrual period) and are less than 55 years of age and have a negative pregnancy test result within 24 hours prior to randomization or have undergone sterilization are exempt from this exclusion.
[0202] 12. Men who were unwilling to use an acceptable method of contraception (i.e., condoms with spermicide) throughout the study period.
[0203] 13. History of alcoholism and / or drug abuse within the past 5 years.
[0204] 14. Receive other experimental drugs or devices within 30 days or 5 half-lives (whichever is longer).
[0205] 15. Use of other investigational drugs or devices during the study.
[0206] 16. Any circumstances that the researcher believes may interfere with the research, such as, but not limited to:
[0207] a. Not suitable for this study, including subjects who are unable to communicate or cooperate with researchers.
[0208] b. Unable to understand protocol requirements, instructions, and limitations related to the study, the nature, scope, and potential consequences of the study (including subjects who are difficult to cooperate with due to substance abuse or alcohol dependence).
[0209] c. Unlikely to comply with protocol requirements, instructions, and research-related limitations (e.g., uncooperative attitude, inability to return for follow-up, and low likelihood of completing the study).
[0210] d. Having any medical or surgical condition that researchers believe increases the risk of participants participating in the study.
[0211] e. Having a connection or kinship with a direct participant in the research.
[0212] f. Any known cognitive impairment (e.g., Alzheimer's disease).
[0213] Data Analysis
[0214] Data were collected at baseline, day 90, and day 180. The primary endpoint of the analysis was the percentage reduction in triglyceride levels from baseline on day 180. The secondary endpoint of the analysis was the percentage reduction in serum cholesterol levels from baseline on day 180.
[0215] Fasting blood samples were collected at each visit, and serum triglyceride and LDL cholesterol levels were measured using standard methods. A questionnaire was administered at each visit to assess the side effects of 3xGalNAc siRNA.
[0216] result
[0217] The 3xGalNAc siRNA treatment is expected to target hepatic GK expression and reduce serum triglyceride levels to <50% of baseline compared to placebo (primary endpoint). Additionally, a reduction in serum LDL cholesterol is also expected (secondary endpoint).
[0218] Example 4. Generation of liver-specific glycerol kinase knockout mice
[0219] Because systemic GK knockout mice exhibit severe metabolic and developmental defects and postnatal lethality, liver-specific GK knockout mice (LGKKO) were generated using the Gk floxed and albumin-Cre strains. To generate Gk floxed mice, loxp sites were introduced before exon 2 and after exon 3 of Gk using CRISPR-Cas9 technology (see sequence below):
[0220] SEQ ID NO: 11 - Mouse nucleic acid sequence containing loxp sites before and after Gk exon 3.
[0221] GTTTTCAATTCAAAAACAGCTGAACTTCTTAGTCATCAT CAAGTAGAAATAAAACAGGAATTCCCAAGAGAAGG GTATGTTTCTTAATTTACTATGTAAAGACATATCACATTGATTGGTTTGTCTCACCCCATGTATGCTGTGGATTGATTGGTAGAGTAAACTTAGCCAGACACCTTCTGGAGAAGGCCTGAGAGAATGGGAGTGGTCAAGAAATGAAGCTAGAATGCAGTAATTCAGCAAAAATAGGGGAGCAATGGGTAGCTTAGGCATTCATTGACAGAAAGCAAAGTATAAGTAATGTAACACACACACATAAAGTCTGTATTACAACAAAGGAATATTAACCATCAGAGTCTGCATTAAGTCTGAAGTTTGAGGTGATTTCCTTCTGTGTCCC TGTTACTAGCAGTGCTAAAATGATTACTTTTCAGGAGTGTGTTCTATTTTACCTTTGTTTTTGCCTTTTGGAACCACGATCATATCAATGTACAGACCAGGCTCCCTCTCAAGGGCTGGGATTTGAAGTGTGTGAGCCACTGGTTAATGACCACCCTTAGAAGAAGGATGGATTATTATTAGTCTGTGAAGAATAAGAAAAATGTATAGGAAATAGGTTTTTTTTTATCCCTTTAGTATGTAGAAAACAGATATAATGTATTTATGGAAACATGTTATGTTTGTATTGAATTCTTGAAAACTAACATTTATCCTTTTGTTCCAAAG ATGGGTAGAACAAGACCCGAAGGAAATTCTGCAGTCTGTTTATGAGTGTATAGAGAAAACGTGTGAGAAACTT GGACAGCTCAATATTGATATTTCCAACATCAAAG
[0222] Note: Bold text indicates loxp sites. Bold and underlined sequences indicate exon 2. Bold and italic sequences indicate exon 3.
[0223] LGKKO mice exhibit highly efficient liver-specific GK loss ( Figure 6A ), and weight ( Figure 5A ) and kidneys ( Figure 5B and Figure 6A GK expression in other peripheral tissues (such as epididymal adipose tissue (eWAT) and small intestine (sInt)) was not affected. Figure 5B Therefore, compared with control WT mice, the liver GK level was undetectable in LGKKO mice. Figure 6B ).
[0224] Since GK is also expressed in other organs and tissues (e.g., kidneys, small intestine, and macrophages / neutrophils), the study also examined whether liver-specific GK deficiency affected blood glucose levels after glycerol administration. Interestingly, LGKKO mice showed significantly reduced blood glucose levels after glycerol administration, suggesting that direct conversion of glycerol in the liver mediates this effect. Figure 6C In summary, the LGKKO mouse is a novel animal model for studying the role of hepatic GK in glycerol-mediated gluconeogenesis (GNG) and adipogenesis.
[0225] Example 5. Hepatic glycerol kinase deficiency reduces fasting blood glucose, decreases hepatic triglyceride storage, and inhibits de novo lipogenesis.
[0226] To determine whether hepatic glycerol metabolism regulates glucose production in mice, LGKKO mice were fed either a conventional (RD) diet or a high-fat (HFD) diet (see Example 4 for production methods). HFD feeding increased body weight and fat mass in both WT and LGKKO mice, but had no effect on lean body mass. Figure 6D and 6E However, the fasting blood glucose levels in LGKKO mice fed RD and HFD ( Figure 6F ) and glycerol stimulate blood glucose levels ( Figure 6G All three parameters were significantly reduced, indicating impaired hepatic glucose production. Compared to control WT mice, LGKKO mice fed HFD also showed reduced pyruvate-induced blood glucose levels. Figure 6G This reflects the important role of hepatic glycerol metabolism in the production of triose phosphate pools. Since the liver is the primary site of glycerol metabolism, circulating glycerol levels were significantly elevated in LGKKO mice, but non-esterified free fatty acid (NEFA) levels remained unchanged compared to WT mice. Figure 6HCompared with WT mice, LGKKO mice fed RD and HFD also had significantly lower fasting insulin levels. Figure 6I These results indicate that liver-specific GK deficiency inhibits hepatic GNG, leading to decreased fasting blood glucose and insulin levels.
[0227] WT and LGKKO mice fed HFD for 16 weeks showed similar increases in body weight and total fat mass, while lean body mass showed no difference (as shown in Figure 6-6I). As expected, WT mice fed HFD showed a significant increase in liver weight compared to WT mice fed RD. However, LGKKO mice fed HFD showed a significant decrease in liver weight compared to WT mice fed HFD. Figure 7A There was no difference in weight between epididymal adipose tissue and muscle. Figure 7B To determine whether liver-specific GK deficiency blocked fat accumulation in the liver, TG liver content was measured. As expected, H&E staining showed increased fat accumulation in the liver of WT mice fed HFD compared to WT mice fed RD. However, H&E staining of LGKKO mice fed HFD showed reduced hepatic fat accumulation and a significantly lower degree of steatosis compared to WT mice fed HFD. Figure 7C TG detection results confirmed that, compared with WT mice fed HFD, LGKKO mice fed HFD had lower liver TG content. Figure 7D Consistent with the increased TG storage and liver inflammation observed in WT mice fed HFD, serum alanine aminotransferase (ALT) activity levels were elevated. Figure 7E In contrast, LGKKO mice fed with HFD showed decreased serum ALT levels compared to control WT mice fed with HFD. Figure 7E The results indicate that liver-specific GK deficiency alleviates HFD diet-induced TG accumulation and lipotoxicity.
[0228] To determine whether inhibition of de novo adipogenesis (DNL) could explain the reduced TG accumulation in the liver of LGKKO mice, the RNA and protein expression levels of the DNL gene were examined. Interestingly, compared with WT mice fed with HFD, the RNA expression of the major regulators of DNL, Srebf1c and Ppara, was significantly reduced in LGKKO mice fed with HFD. Figure 7F Correspondingly, compared with WT mice fed the same diet, the RNA expression of DNL genes such as Acly, Acaca, and Fasn was also significantly suppressed in LGKKO mice fed RD and HFD diets. Figure 7F We also examined the protein levels of the DNL gene in the liver. As expected, GK protein expression was increased in mice fed HFD, but not in LGKKO mice. Figure 7GCompared with WT mice fed RD, WT mice fed HFD showed increased expression of ACLY, ACC, and FAS, while LGKKO mice fed HFD showed no change in expression. Figure 7G This suggests that GK mediates, to some extent, the paradoxical increase in DNL under insulin resistance caused by HFD feeding.
[0229] The production of TG in the liver is also mediated by the re-esterification of pre-existing fatty acids. Figure 8A Therefore, the gene expression of key enzymes involved in fatty acid transport, acyl-CoA synthesis, and re-esterification was examined. Interestingly, compared with WT mice fed with HFD, the expression of fatty acid transporters (such as Cd36 and Slc27a5 (FATP5 genes)) and re-esterifying enzymes (including Gpam, Agpat2, Mogat, and Dgat2) was significantly suppressed in LGKKO mice fed with HFD. However, there was almost no difference in acyl-CoA synthesis in LGKKO mice fed with HFD. These results suggest that hepatic GK promotes the re-esterification of triglycerides (TG) in the liver.
[0230] Example 6. In vitro administration of GalNAc-siRNA targeting Gk can recreate the LGKKO mouse phenotype.
[0231] Purified GalNAc-siRNA (3 mg / kg SC) targeting mouse Gk (GK1, GK2, and GK3) was injected into 13-week-old WT mice (n=4 per group). Control GalNAc-siRNA was injected using the same method. Hepatic GkmRNA levels were measured after 5 weeks. Figure 9A GK1 and GK3 showed the most significant effects in reducing hepatic Gk mRNA levels. (Glycerol tolerance test) Figure 9B This study confirmed that these siRNAs also reduced glucose production after glycerol stimulation to a similar degree as observed in LGKKO mice. Figure 6G ).
[0232] Sequence list (all sequences are displayed in 5' to 3' increments)
[0233] SEQ ID NO: 1 - mGK1
[0234] CUUAGUCAUCAUCAAGUAGAA
[0235] SEQ ID NO: 2 – mGK1-2
[0236] UUCUACUUGAUGAUGACUAAGAA
[0237] SEQ ID NO: 3-mGK2
[0238] CCUGUGUAUUAUGCGUUGGAA
[0239] SEQ ID NO: 4 – mGK2-2
[0240] UUCCAACGCAUAAUACACAGGUU
[0241] SEQ ID NO: 5 – hGK1
[0242] GAACAGGACCCUAAGGAAA
[0243] SEQ ID NO: 6 – hGK1-2
[0244] UUUCCUUAGGGUCCUGUUCCU
[0245] SEQ ID NO: 7 – hGK2
[0246] AGAGAAAACAUGUGAGAAA
[0247] SEQ ID NO: 8 – hGK2-2
[0248] UUUCUCACAUGUUUUCUCUAU
[0249] SEQ ID NO: 9 -hGK3
[0250] GGAAGAAAGCUGUGAUGAA
[0251] SEQ ID NO: 10 – hGK3-3
[0252] UUCAUCACAGCUUUCUUCCAU
[0253] SEQ ID NO: 11 - Mouse nucleic acid sequence containing loxp sites before and after Gk exon 3.
[0254]
Claims
1. A method for treating or preventing disease associated with elevated serum triglyceride (TAG) levels and metabolic dysfunction-related fatty liver disease (MASLD), wherein the method comprises administering a therapeutically effective amount of a glycerol kinase (GK) inhibitor to a subject in need.
2. The method of claim 1, wherein the disease is hypertriglyceridemia or MASLD.
3. The method of claim 1, wherein the GK inhibitor comprises an antibody or its antigen-binding fragment, a small molecule or a nucleic acid.
4. The method of claim 3, wherein the GK inhibitor comprises a nucleic acid.
5. The method of claim 4, wherein the nucleic acid comprises at least one double-stranded region, the double-stranded region comprising at least a portion of a first strand and at least a portion of a second strand at least partially complementary to the first strand, wherein the nucleic acid comprises nucleic acid sequence pairs as shown in SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 or SEQ ID NO: 9 and SEQ ID NO:
10.
6. The method of claim 5, wherein the nucleic acid comprises chemical modification.
7. The method of claim 6, wherein the chemical modification comprises one or more N-acetylgalactosamine (GalNAc) moieties or derivatives thereof that are directly conjugated to nucleic acids or indirectly conjugated via linkers.
8. The method of claim 6, wherein the chemical modification is conjugated to the 3′ end of the first chain.
9. The method of claim 6, wherein the nucleic acid comprises at least one modified nucleotide.
10. The method of claim 9, wherein all nucleotides in the first chain and the second chain are modified nucleotides.
11. The method of claim 10, wherein: a) The nucleotides at positions 7, 9, 10, and 11, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F); b) The nucleotides at positions 1-6, 8, and 12-21, starting from the 5′ end of the first strand, are modified with 2′-O-methyl (2′-Ome); c) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F); d) Nucleotides at positions 1, 3-5, 8-13, 15, and 17-23, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome); and e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
12. The method of claim 11, wherein the nucleic acid comprises at least one phosphate thioester nucleotide linker.
13. The method of claim 12, wherein the nucleic acid comprises two consecutive phosphate-thioester nucleotides linked at the 3′ and 5′ ends of the second strand, and comprises two consecutive phosphate-thioester nucleotides linked at the 5′ end of the first strand.
14. The method of claim 5, wherein the nucleic acid or pharmaceutical composition thereof is administered at a dose of about 100 mg to about 800 mg.
15. The method of claim 15, wherein the nucleic acid or its pharmaceutical composition is administered subcutaneously.
16. The method of claim 15, wherein administration of the nucleic acid or its pharmaceutical composition reduces serum triglyceride levels by about 70%.
17. The method of claim 5, wherein the nucleic acid or its pharmaceutical composition is administered in combination with another therapeutic agent.
18. The method of claim 17, wherein the second therapeutic agent is selected from the group consisting of fibrates, metformin, statins and niacin.
19. A nucleic acid comprising at least one double-stranded region, the double-stranded region comprising at least a portion of a first strand and at least a portion of a second strand at least partially complementary to the first strand, wherein the nucleic acid comprises nucleic acid sequence pairs as shown in SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, or SEQ ID NO: 7 and SEQ ID NO: 8, or SEQ ID NO: 9 and SEQ ID NO:
10.
20. The nucleic acid of claim 19, wherein the nucleic acid comprises chemical modification.
21. The nucleic acid of claim 20, wherein the chemical modification comprises one or more N-acetylgalactosamine (GalNAc) moieties or derivatives thereof that are directly conjugated to the nucleic acid or indirectly conjugated via a linker.
22. The nucleic acid of claim 20, wherein the chemical modification is conjugated to the 3′ end of the first chain.
23. The nucleic acid of claim 20, wherein the nucleic acid comprises at least one modified nucleotide.
24. The nucleic acid of claim 23, wherein all nucleotides in the first and second chains are modified nucleotides.
25. The nucleic acid of claim 24, wherein: a) The nucleotides at positions 7, 9, 10, and 11, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F); b) The nucleotides at positions 1-6, 8, and 12-21, starting from the 5′ end of the first strand, are modified with 2′-O-methyl (2′-Ome); c) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F); d) Nucleotides at positions 1, 3-5, 8-13, 15, and 17-23, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome); and e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
26. The nucleic acid of claim 24, wherein: a) Nucleotides 1-4, 6, 10, 11 and 13-19 from the 5′ end of the first strand are modified with 2′-O-methyl (2′-Ome); b) The nucleotides at positions 5, 7-9, and 12, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F); d) The nucleotides at positions 1, 3, 4, 5, 9-13, 15-19, and 21, starting from the 5′ end of the second strand, are modified with 2′-O-methyl (2′-Ome); e) The nucleotides at positions 2, 6, 14, and 20, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F); f) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
27. The nucleic acid of claim 24, wherein: a) Nucleotides at positions 1-4, 6, 10, and 11-19, starting from the 5′ end of the first strand, are modified with 2′-O-methyl (2′-Ome); b) The nucleotides at positions 5 and 7-9, starting from the 5′ end of the first strand, are modified with 2′-deoxy-2′-fluorine (2′F); c) The nucleotides at positions 1, 3, 4, 5, 9-13, 15 and 17-21 from the 5′ end of the second strand are modified with 2′-O-methyl (2′-Ome); d) The nucleotides at positions 2, 6, 14, and 16, starting from the 5′ end of the second strand, are modified with 2′-deoxy-2′-fluorine (2′F); e) The 7th nucleotide starting from the 5′ end of the second strand is modified with ethylene glycol nucleic acid (GNA).
28. The nucleic acid of claim 24, wherein the nucleic acid comprises at least one phosphate thioester nucleotide linker.
29. The nucleic acid of claim 28, wherein the nucleic acid comprises two consecutive phosphate-thioester nucleotides linked at the 3′ and 5′ ends of the second strand, and comprises two consecutive phosphate-thioester nucleotides linked at the 5′ end of the first strand.
30. A method for treating or preventing a disease associated with elevated serum triglyceride (TAG) levels and metabolic dysfunction-associated fatty liver disease (MASLD), wherein the method comprises administering the nucleic acid of claim 19 or a pharmaceutical composition thereof to a subject in need.
31. A method for reducing the activity or expression level of glycerol kinase (GK) in a subject in need, the method comprising administering to the subject in need the nucleic acid of claim 19 or a pharmaceutical composition thereof.
32. The method of claim 30 or 31, wherein the nucleic acid or its pharmaceutical composition is administered subcutaneously.
33. The method of claim 30, wherein the disease is hypertriglyceridemia or MASLD.
34. The method of claim 30 or claim 31, wherein application of the nucleic acid or pharmaceutical composition inhibits mTORC1.
35. A method for lowering cholesterol levels in a subject in need, wherein the method comprises administering the nucleic acid of claim 19 or a pharmaceutical composition thereof.
Citation Information
Patent Citations
Triantennary cluster glycosides, their preparation and use
US5885968A