A modified crRNA, a light-controlled nucleic acid detection system, a kit and application

By introducing photosensitive protective groups into the crRNA backbone region, the sequence dependence and high energy consumption problems of light-controlled CRISPR technology are solved, realizing a portable nucleic acid detection with high sensitivity and low energy consumption, which is suitable for the detection of infectious pathogens and single nucleotide polymorphisms.

CN122256348APending Publication Date: 2026-06-23AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)
Filing Date
2026-03-13
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing optically controlled CRISPR technology suffers from sequence dependence limitations and high energy consumption, resulting in limited detection range and poor device compatibility, making it difficult to apply in portable POCT instruments.

Method used

By introducing photosensitive protective groups, such as 6-nitropiperyloxymethyl (NPOM), into the backbone region of crRNA to modify uracil nucleotides, steric hindrance or conformational changes are made to inhibit Cas12 protein activity. After light exposure, the protective groups are removed to restore crRNA activity. Combined with a low-energy light source module, Cas12 protein cleavage activity is activated.

Benefits of technology

It achieves 100% coverage of any target sequence, improves detection sensitivity by 100 times, reduces ultraviolet light intensity by 12 times, is compatible with portable devices, avoids damage to biological macromolecules, and has high detection accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a modified crRNA, a light-controlled nucleic acid detection system, a kit and application, and belongs to the cross field of biotechnology, intelligent sensing and molecular diagnosis. In view of the technical defects of strong target sequence dependence and high ultraviolet irradiation requirement of the existing light-controlled CRISPR technology, the application innovatively introduces a photosensitive protection group 6-nitropiperidin oxymethyl (NPOM) at a specific key node of a stem loop skeleton of crRNA maintaining conformation. In the constant temperature amplification stage, preferred double-site cooperative modification can transiently inhibit RNP complex assembly to realize target non-interference enrichment; subsequently, only 10 mW / cm 2 of extremely low intensity ultraviolet light irradiation for 30 seconds can restore the crRNA conformation and activate the trans cleavage. The preferred technical scheme of the application can eliminate the target sequence limitation, realizes a detection limit of as low as 2 copies in a single reaction tube, and the result can be obtained within 15 minutes. The system is widely applicable to rapid diagnosis of infectious agents, high-specificity typing of single nucleotide polymorphism and portable intelligent molecular diagnosis terminal.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of biotechnology, intelligent sensing and molecular diagnostics, and specifically relates to a modified crRNA, a light-controlled nucleic acid detection system, a reagent kit and its applications. Background Technology

[0002] Nucleic acid detection technology based on the CRISPR-Cas12a system has become a revolutionary tool in the field of molecular diagnostics due to its high specificity, high sensitivity, and unique trans-cleavage activity. To meet the needs of point-of-care testing (POCT), researchers have developed a "one-pot" method that places isothermal amplification (such as RPA and RAA) and the CRISPR reaction in the same reaction tube. This method effectively simplifies the operation process and fundamentally solves the problem of aerosol cross-contamination that is easily caused by opening the cap and transferring products in traditional two-step methods.

[0003] However, conventional single-tube methods suffer from significant sensitivity loss. Studies have shown that in mixed reaction systems, Cas proteins non-specifically cleave the amplifying template DNA, hindering amplification efficiency and typically reducing detection sensitivity by 1-2 orders of magnitude compared to two-step methods. To address this interference, a series of time-separation strategies have been proposed in recent years, involving photocontrolled chemical modification to regulate Cas12a activity and achieve "amplification first, then photodetection."

[0004] Nevertheless, existing light-controlled CRISPR technology still suffers from significant technical biases and performance bottlenecks when moving towards industrial applications: (1) Severe sequence dependence (lack of universality): Current mainstream strategies typically block the recognition function of crRNA by introducing photosensitive protective groups (such as NPOM) into the spacer region (see Hu et al., Angew. Chem. Int. Ed., 2023, 135, e202300663). Since such modifications require the replacement of specific nucleotides, the target sequence usually needs to contain at least three discontinuous thymine (dT) in the region adjacent to the PAM. This stringent sequence dependence greatly limits the detection range. According to bioinformatics statistics, this limitation results in approximately 20.03% of key tumor genes (such as TP53) and many important viral sequences (such as respiratory syncytial virus) not being effectively covered by existing light-controlled platforms, thus disqualifying them as universal diagnostic platforms.

[0005] (2) Photoactivation has extremely high energy consumption (poor equipment compatibility and sample damage): To avoid sequence dependence, another strategy is to randomly acylate the 2'-hydroxyl group (2'-OH) of the entire crRNA chain (see Liu et al., Angew. Chem. Int. Ed., 2024, 63, e202401486). However, this strategy often requires extremely high intensity ultraviolet light irradiation to complete deprotection in order to achieve complete functional blocking (excitation intensity is often as high as 123 mW / cm). 2 This high energy consumption characteristic brings two risks: on the one hand, high-intensity ultraviolet light can easily cause ultraviolet photochemical degradation of nucleic acid samples and proteins, affecting the accuracy of detection; on the other hand, commercially available portable POCT instruments are usually powered by ordinary batteries, and their equipped miniature ultraviolet LED modules are simply unable to stably provide such high instantaneous excitation energy, making it difficult for this technology to be implemented in on-site rapid testing scenarios.

[0006] In conclusion, developing a new generation of light-controlled CRISPR detection system that is independent of specific target sequences, can start rapidly under extremely low light intensity, and has a high signal-to-noise ratio is of paramount importance for promoting the development of ultrasensitive POCT diagnostic technology. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention proposes a modified crRNA, a light-controlled nucleic acid detection system, a reagent kit, and its applications.

[0008] In a first aspect, the present invention provides a modified crRNA, the crRNA comprising a backbone region (Direct Repeat, DR) and a spacer region. At least one nucleotide residue of the crRNA is replaced by a photosensitive modified nucleotide, wherein the substitution occurs at least in the backbone region; The photosensitive modified nucleotide contains a photosensitive protecting group, which is used to inhibit the formation of a cleavage-active complex between the crRNA and the Cas12 protein by steric hindrance or by changing the secondary structure conformation of the backbone region. The photosensitive protecting group can be removed, cleaved, undergo conformational changes, or have its steric hindrance removed under light irradiation of a specific wavelength, thereby restoring the biological activity of the crRNA.

[0009] In some embodiments, the nucleotide residues substituted in the backbone region (DR) are uracil (U) nucleotide residues, and the photosensitive modified nucleotides are deoxythymidine (dT), thymidine (T), or analogues thereof with photosensitive protecting groups.

[0010] In some embodiments, the photosensitive protecting group includes 6-nitropiperyloxymethyl (NPOM), with the structural formula: (6-NO 2- C6H2-1,2-(OCH2O))CH2-O-, 4,5-dimethoxy-2-nitrobenzyl (DMNB), structural formula: (CH3O)2C6H2(NO2)CH2-, α-methyl-6-nitropiperyloxycarbonyl (MeNPOC), structural formula: [6-NO2-C6H2-1,2-(OCH2O)]-CH(CH3)-O-CO-; and at least one derivative of each of the above three groups.

[0011] Preferably, the photosensitive protective group is selected from 6-nitropiperyloxymethyl (NPOM).

[0012] In some embodiments, the original sequence of the backbone region is selected from the conserved backbone region sequence corresponding to LbCas12a, AsCas12a protein or its engineered variant, or a sequence having more than 90% homology with the conserved backbone region sequence.

[0013] In some embodiments, the original sequence length of the backbone region is 19 to 25 nucleotides, preferably 20 or 21 nucleotides.

[0014] In some embodiments, the original sequence of the skeleton region includes the sequence shown in SEQ ID NO: 2, or a sequence that has more than 90% homology with SEQ ID NO: 2 and retains the stem-loop structure.

[0015] In some embodiments, the substitution is selected from: single-site substitution, two-site substitution, and three-site substitution. Preferably, the substitution occurs at the base positions in the backbone region where a stem-loop structure is formed.

[0016] In some implementations, the substitution occurs at the 5th and 14th positions from the 3' end toward the 5' end in the skeleton region, and the sequence of the spacer region is designed based on the target sequence to be detected to complement the target sequence.

[0017] Secondly, the present invention provides a light-controlled nucleic acid detection system, comprising: (1) The modified crRNA; (2) Cas12 family proteins or their engineered variants; (3) Reagents for amplifying the target sequence (preferably isothermal amplification reagents); and (4) Signal reporter molecules; The modified crRNA, after being deactivated by photosensitivity and restored to activity under irradiation with light of a specific wavelength, can guide the Cas12 family protein or its engineered variants to target the target sequence and activate its trans-cleavage activity.

[0018] In some embodiments, the signaling molecule is a single-stranded nucleic acid reporter molecule (such as an ssDNA fluorescent reporter molecule) used to characterize the Cas12 protein cleavage activity.

[0019] In some implementations, the Cas12 family proteins include LbCas12a and AsCas12a proteins, and engineered variants of the Cas12 family proteins include LbCas12a-Ultra and AsCas12a-Ultra proteins.

[0020] In some embodiments, the final concentration of the LbCas12a protein in the light-controlled nucleic acid detection reaction system is between 0.045 μM and 0.225 μM.

[0021] Preferably, the final concentration of the LbCas12a protein is between 0.1 μM and 0.2 μM.

[0022] In some embodiments, the final concentration of the modified crRNA (NPOM-crRNA) in the light-controlled nucleic acid detection reaction system is from 3.3 fmol / μL to 400 fmol / μL.

[0023] Preferably, the final concentration of the modified crRNA is between 250 fmol / μL and 320 fmol / μL.

[0024] In some embodiments, the light-controlled nucleic acid detection system further includes: A light source module is used to provide energy to activate the photosensitive protective group; the light source module includes a light source device capable of emitting excitation light of a preset wavelength; preferably, the light source device is selected from portable light sources, handheld ultraviolet lamps, LED light-emitting diodes, laser generators, or light-emitting modules integrated in nucleic acid detection equipment.

[0025] Preferably, the wavelength range of the excitation light is 350 nm to 420 nm, and the intensity of the excitation light is 4 mW / cm². 2 ~40mW / cm 2 The irradiation time is 5~60s.

[0026] Thirdly, the present invention provides a kit for optically controlled nucleic acid detection, the kit comprising the components of the system described above; Specifically, it includes: (1) The modified crRNA; (2) Cas12 family proteins or their engineered variants; (3) Reagents for amplifying the target sequence (preferably isothermal amplification reagents); (4) Signal reporter molecules: Single-stranded nucleic acid reporter molecules (such as ssDNA fluorescent reporter molecules) used to characterize the cleavage activity of Cas12 protein.

[0027] Preferably, each component of the kit is placed in a separate container, or two or more components are premixed and placed in the same container. The kit includes light-protected packaging.

[0028] In some embodiments, the kit further includes a light source device for activating photosensitive protective groups, preferably a portable light source device.

[0029] Fourthly, the present invention provides a single-tube nucleic acid detection method, comprising the following steps: S1. The sample to be tested is mixed with any of the above-described optically controlled nucleic acid detection systems to form a reaction system, and amplified under isothermal conditions; at this time, the modified crRNA is in a closed state and does not interfere with the amplification reaction. S2. Irradiate the amplified reaction system with light of a specific wavelength to remove the photosensitive protecting group and activate the trans-cleavage activity of Cas12 family proteins or their engineered variants; S3. Detect the fluorescence signal or colorimetric signal generated after the signal reporter molecule is cleaved to determine the presence of the target nucleic acid in the sample to be tested.

[0030] In some embodiments, the amplified reaction system is irradiated with ultraviolet light in step S2, wherein the ultraviolet light has a wavelength range of 350 nm to 420 nm and an intensity of 4 mW / cm². 2 ~40mW / cm 2 The irradiation time is 5~60s.

[0031] Preferably, the intensity of the ultraviolet light is 8 mW / cm². 2 ~20mW / cm 2 The irradiation time is 25~40s.

[0032] Fifthly, the present invention provides the application of the modified crRNA, the light-controlled nucleic acid detection system, the kit, or the single-tube nucleic acid detection method in the preparation of a target nucleic acid detection product, wherein the target nucleic acid detection product is used in any of the following: In vitro detection of nucleic acids of infectious pathogens; Specific typing of single nucleotide polymorphisms (SNPs); Point-of-care testing (POCT) molecular detection.

[0033] This invention also provides the in vitro applications of the modified crRNA, the light-controlled nucleic acid detection system, the kit, or the single-tube nucleic acid detection method for non-disease diagnostic purposes in any of the following fields: Rapid analysis of nucleic acids of infectious pathogens; Specific typing of single nucleotide polymorphisms; On-site or portable nucleic acid testing.

[0034] In summary, compared with the prior art, the present invention achieves the following technical effects: 1. By modifying the conserved backbone region of crRNA rather than the variable spacer region, the ULTRAt platform can detect any target sequence (100% coverage), overcoming the limitation of existing light-controlled technologies that cannot detect key targets such as TP53 and RSV.

[0035] 2. This invention achieves deep inhibition of Cas12a activity through precise screening of synergistic modification at two sites, U+5 and U+14. Experiments show that the limit of detection (LOD) in a single tube is as low as 2 copies per reaction, which is 100 times more sensitive than the conventional one-tube method without modification, and maintains excellent stability in complex matrices such as 10% serum or saliva.

[0036] 3. In this embodiment of the invention, the ultraviolet intensity threshold required for photoactivation is reduced to 10 mW / cm. 2 It reduces the light intensity by 12 times compared to existing technologies, making it suitable for portable devices powered by low-power batteries, and the extremely low light intensity avoids damage to biological macromolecules from ultraviolet radiation.

[0037] 4. The technical solutions of the embodiments of the present invention have broad clinical application value: This system demonstrates excellent performance in screening for infectious disease pathogens and identifying single nucleotide polymorphisms (SNPs) (such as the FLT3 D835Y mutation, with a detection limit of 1%). Clinical validation with 91 samples showed that the system achieved 100% concordance with qPCR and Sanger sequencing results, indicating strong potential for industrialization. Attached Figure Description

[0038] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0039] Figure 1This is a schematic diagram comparing the real-time fluorescence curves of the ULTRAt system of this invention with those of conventional one-pot detection (CRISPR).

[0040] Figure 2 To obtain NPOM-crRNA modification sites with good CRISPR detection performance in the initial screening.

[0041] Figure 3 To screen and obtain the NPOM-crRNA modification site with the best CRISPR detection performance.

[0042] Figure 4 This study uses circular dichroism spectroscopy and gel electrophoresis (EMSA) to reveal the physical microscopic mechanism of the hindered and restored assembly of the RNP complex before and after photocontrolled activation.

[0043] Figure 5 For the core parameters of the reaction (including 10mW / cm) 2 The optimized result diagram (confirmation of extremely low light intensity threshold) is shown.

[0044] Figure 6 This is a statistical chart showing the results of applying the system of the present invention to various Cas proteins and targets. The results demonstrate that the system of the present invention has versatility.

[0045] Figure 7 This diagram shows the high sensitivity of the system of the present invention to targets with extremely low copy concentrations (2 copies) and its resistance to interference from complex biological matrices.

[0046] Figure 8 This is a ROC curve validation diagram for the application of this invention to the high-specificity typing of tumor FLT3-D835Y single nucleotide polymorphism (SNP) and real clinical cohort.

[0047] Figure 9 This is a matrix diagram comparing the diagnostic accuracy of the present invention with the gold standard method for high-risk HPV16 / 18 clinical samples. Detailed Implementation

[0048] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0049] The technical solution adopted in this application is as follows: A photosensitive, universal single-tube nucleic acid detection system based on structurally engineered crRNA, the system comprising: structurally engineered crRNA, Cas12a protein, isothermal amplification reagent kit, and ssDNA reporter probe.

[0050] Take the classic crRNA as an example: 5'-UAAUUUCUACUAAGUGUAGAUACAGUACUCAUUAAUAACGGU-3' (SEQ ID NO: 1).

[0051] 1. Characteristics of structurally engineered crRNA: The modification sites of the crRNA are located at key nodes in the crRNA scaffold that participate in maintaining the spatial topological conformation, so as to avoid the interstitial regions that pair with the target. Preferably, dual-site synergistic modification is performed at the U+5 and U+14 sites of the crRNA scaffold. The modification is to replace the uridine (U) at the above sites with deoxythymidine (NPOM-dT) modified by the photosensitive protective group 6-nitropiperidinoxymethyl (NPOM). Its mechanism of action is that by introducing a large NPOM group at the key pairing site of the scaffold, the steric hindrance and structural distortion effect are used to block the binding of crRNA with Cas12a protein to form a ribonucleoprotein (RNP) complex when not exposed to light, thereby inhibiting the activity of Cas12a.

[0052] 2. Construction and reaction process of the single-tube detection system (ULTRAt system): The system integrates the modified crRNA, Cas12a protein, isothermal amplification reagent kit (including recombinase, polymerase, primers and buffer), and ssDNA reporter probe into a single reaction tube.

[0053] The detection process consists of two stages: The first stage is the target enrichment period: the reaction system is incubated at 39°C for 10 minutes. At this time, Cas12a is in an inactive state, and the isothermal amplification reaction is carried out without interference to enrich the target nucleic acid. The second stage is the optical detection period: using a wavelength of 365 nm and an intensity of 10 mW / cm². 2 The reaction tube was irradiated with ultraviolet light for 30 seconds to photolyze and remove the NPOM group, restoring the crRNA to its native conformation and thereby activating the trans-cleavage activity of Cas12a.

[0054] Figure 1The real-time fluorescence response curves of the ULTRAt system of this invention and the conventional single-tube CRISPR / Cas12a detection system for a 2-copy / reaction monkeypox virus target are shown. The vertical gray dashed line indicates the ultraviolet (UV) activation treatment applied by the ULTRAt system at 10 minutes, while the conventional system does not have a UV activation step.

[0055] The figure shows that the fluorescence baseline of the ULTRAt system was completely stable before photoactivation (0-10 min), with no background leakage, achieving precise temporal separation of isothermal amplification and CRISPR cleavage. After photoactivation at 10 minutes, the fluorescence signal of the target at a limit concentration of only 2 copies rapidly increased within 5 minutes, and the fluorescence intensity formed at 15 minutes was significantly higher than the response signal of the conventional single-tube system for the target at 2 copies. Moreover, even at a high concentration of 200 copies, the fluorescence signal of the conventional single-tube CRISPR / Cas12a detection system increased slowly and the overall level was much lower than the signal intensity of the ULTRAt system at 2 copies. Figure 1 This directly confirms that, compared to conventional technologies, the present invention achieves stronger and faster fluorescence signal output at lower target concentrations, fully demonstrating the authenticity and superiority of the technical effect of "ultra-sensitive detection of 2 copies of the target within 15 minutes".

[0056] The definition of crRNA base positions follows the accepted CRISPR system nomenclature standard. The origin (0 point) is the junction of the backbone region (DR / Scaffold) and the spacer region. The numbers are negative if they are in the direction of transcription (towards the 3' end) and positive if they are against the direction of transcription (towards the 5' end).

[0057] The present application will be further described below with reference to the embodiments, but is not limited thereto.

[0058] Example 1: Design, preparation and underlying molecular mechanism verification of light-controlled crRNA This embodiment details the preparation process of the core component of the present invention, NPOM-crRNA, and its physicochemical mechanism for inhibiting / restoring Cas12a activity.

[0059] (1) Establishment of photosensitive modification sites: Avoid the spacer region responsible for target identification and select the scaffold region where crRNA maintains its topological conformation.

[0060] The specific stem-ring skeleton sequence is as follows: 5'-UAAUUUCUACUAAGUGUAGAUACAGUACUCAUUAAUAACGGU-3' (SEQ ID NO: 1).

[0061] Its skeletal region sequence is: 5'-UAAUUUCUACUAAGUGUAGAU-3' (SEQ ID NO:2).

[0062] To precisely pinpoint the "switch" node that regulates Cas12a activity, this embodiment first performed a full-sequence activity sensitivity scan on the crRNA. Systematic mutations were performed on all uridine (U) sites along the entire length of the crRNA (including positions +21 to +1 in the backbone region and positions -1 to -21 in the spacer region), replacing each with guanosine (G), and the effect on LbCas12a trans-cleavage activity was examined.

[0063] Experimental data show (see) Figure 2 Of the dozens of sites examined, the vast majority of mutations did not significantly alter LbCas12a activity, indicating that crRNA has high tolerance to base changes at these sites. Only a few specific sites showed a significant decrease in LbCas12a trans-cleavage activity after mutation to G. These key sites include +1, +5, +14, and +18 in the backbone region and -5, -11, and -15 in the spacer region. 6-nitropiperidinoxymethyl (NPOM-dT) was introduced at these sites in the backbone involved in Watson-Crick base pairing.

[0064] Figure 3 a shows the molecular design and modification site distribution of NPOM-dT modified crRNAs (named crRNA-1 to crRNA-9) with 9 different site combinations. Yellow squares represent the corresponding sites with NPOM-dT modification. Figure 3 b shows the light-triggered fluorescence response and signal-to-noise ratio of each NPOM-crRNA in the CRISPR detection system. The template-free control (NC) serves as the negative reference, and PC refers to the original sequence without any alterations, i.e., the positive control. Among all candidate crRNAs, crRNA-5 exhibited the highest fluorescence value and signal-to-noise ratio, significantly outperforming other crRNAs and the negative control (NC).

[0065] The other NPOM-crRNAs also showed clear light-triggered fluorescence response and target recognition capabilities. In comparison, crRNA-5 performed better in terms of overall signal intensity and signal-to-noise ratio. Figure 3 This directly confirms that crRNA-5 designed with specific NPOM-dT modification sites can achieve higher fluorescence signal output and better signal-to-noise ratio in the CRISPR detection system, fully demonstrating the authenticity and superiority of the technical effect that "precise modification site design can significantly improve CRISPR detection performance".

[0066] For NPOM-crRNAs modified with spacer sites (-15, -11, -5), such as crRNA-4, crRNA-8, and crRNA-9, although the inhibitory effect is significant, their application is highly sequence-dependent because the modification sites are located in the spacer region responsible for target differentiation. Their application is highly dependent on specific spacer sequences and lacks universality. In contrast, the preferred backbone modification scheme of this invention is sequence-independent, enabling universal light-controlled regulation for different targets.

[0067] Figure 3 c is a schematic diagram of the NPOM-crRNA backbone. The yellow parts represent the specific modification locations of the backbone region at +1, +5, +14, and +18.

[0068] The sequence of crRNA-5 is: UAAUUUC / NPOM-dT / ACUAAGUG / NPOM-dT / AGAUACAGUACUCAUUAAUAACGGU (SEQ ID NO: 3).

[0069] The backbone sequence of crRNA-5 is as follows: UAAUUUC / NPOM-dT / ACUAAGUG / NPOM-dT / AGAU (SEQ ID NO:4). The sequence of its spacer region can be designed and adjusted according to the target sequence to be detected, so as to complement the target sequence.

[0070] The sequence of crRNA-4 is: UAAUUUCUACUAAGUGUAGAUACAG / NPOM-dT / ACUCA / NPOM-dT / UAAUAACGGU (SEQ ID NO: 5).

[0071] The sequence of crRNA-8 is: UAAUUUCUACUAAGUGUAGAUACAG / NPOM-dT / ACUCA / NPOM-dT / UAA / NPOM-dT / AACGGU (SEQ ID NO: 6).

[0072] The sequence of crRNA-9 is: UAAUUUC / NPOM-dT / ACUAAGUGUAGAUACAG / NPOM-dT / ACUCA / NPOM-dT / UAAUAACGGU (SEQ ID NO: 7).

[0073] In summary, the crRNA variant with dual site modifications at both U(+5) and U(+14) (crRNA-5) exhibited the highest signal-to-noise ratio (SNR) after screening.

[0074] (2) Verification of RNP complex assembly blockade (EMSA and limited hydrolysis by trypsin): The modified NPOM-crRNA (crRNA-5), Cas12a protein, isothermal amplification reagent kit (including recombinase, polymerase, primers and buffer), and ssDNA reporter probe were integrated into a single reaction tube.

[0075] The isothermal amplification reagent kit uses a commercially available isothermal amplification kit (ERA method), which contains recombinase, polymerase, and single-stranded binding protein (SSB).

[0076] Isothermal amplification primers: Taking monkeypox virus F3L gene detection as an example, the optimal primer pair used is: F: 5'-TAGGAGAGTTACTAGGCCCCACTGATTCAATAC-3' (SEQ ID NO: 8).

[0077] R: 5'- AGAGGATCATAAGTCTTTTTGATGATGTTATTCC-3' (SEQ ID NO:9) The buffer solution mainly consisted of 50 mM potassium acetate, 20 mM Tris-acetic acid, 10 mM magnesium acetate, and 1 mM MTT. The ssDNA reporter probe sequence was FAM-TTATT-Q. In a single-tube reaction system, LbCas12a protein and NPOM-crRNA were mixed at a molar ratio of approximately 1:1.6 (final protein concentration 0.18 μM).

[0078] The experiment was divided into two groups: one group was kept in the dark, and the other group was irradiated with 365 nm ultraviolet light (intensity 10 mW / cm) for 30 seconds.

[0079] EMSA electrophoresis: Add loading buffer to the above system and perform electrophoresis using a 5% non-denaturing polyacrylamide gel (100 V, 60 min), followed by nucleic acid staining and imaging.

[0080] Limited protein hydrolysis: Trypsin (mass ratio Cas12a:Trypsin=28:1) was added to both systems, and the mixture was incubated at 37°C for 30 minutes. Samples were then taken for SDS-PAGE electrophoresis analysis.

[0081] Electrophoretic mobility assay (EMSA) confirmed that NPOM-crRNA, which was not exposed to light, could not bind to Cas12a protein to form a significant complex blocking band. Meanwhile, limited hydrolysis assays by trypsin showed that Cas12a protein was completely degraded in the unexposed system (due to the lack of structural protection from crRNA binding), proving that NPOM modification completely blocked the formation of the binary complex (RNP).

[0082] (3) Validation of optically controlled conformational recovery (circular dichroism CD analysis): CD spectral scanning was performed on NPOM-crRNA (crRNA5) before and after ultraviolet (365 nm) irradiation. The results showed that the topological constraint of NPOM before irradiation caused an abnormally enhanced positive absorption band at 265 nm in crRNA (indicating a restricted base stacking mode); after photolysis to remove NPOM, the crRNA conformation relaxed and returned to the native A-helix structure (the 265 nm peak decreased and the 240 nm negative peak deepened), thus perfectly confirming the underlying physical mechanism of ultra-low intensity ultraviolet light triggering crRNA conformational rearrangement and reactivating Cas12a trans-cleavage.

[0083] See results Figure 4 .

[0084] Figure 4 a is a circular dichroism (CD) spectrum. The black curve represents the CD spectrum of NPOM-crRNA under ultraviolet (UV) irradiation, and the red curve represents the CD spectrum of NPOM-crRNA under conditions without UV irradiation. Figure 4 This study visually demonstrates the differences in secondary structure of NPOM-crRNA under UV irradiation conditions. Changes in characteristic peaks of the CD spectrum clearly reflect the regulatory effect of UV irradiation on crRNA conformation. CD spectral scans of crRNA before and after UV (365 nm) irradiation were performed. The results show that before irradiation, the topological constraint of NPOM leads to an abnormally enhanced positive absorption band at 265 nm in crRNA (indicating a restricted base stacking pattern). After photolysis to remove NPOM, the crRNA conformation relaxes, reverting to the native A-helix structure (the 265 nm peak decreases, and the 240 nm negative peak deepens), thus perfectly confirming the underlying physical mechanism by which extremely low-intensity UV light triggers crRNA conformational rearrangement and reactivates Cas12a trans-cleavage.

[0085] Figure 4Figure b shows the electrophoresis results of the gel migration assay (EMSA). The top of the figure illustrates the binding of LbCas12a to different crRNAs. The vertical axis represents the presence of LBCas12a protein, normal crRNA (unmodified NPOM, with a stem-loop structure), NPOM-crRNA (crRNA5), and UV irradiation, respectively. The horizontal axis represents the swimming lanes. The electrophoretic bands below show the migration positions of the RNP complex and free components, with arrows indicating the RNP complex bands.

[0086] Lane 1 contained only cas12a protein, lane 2 contained only unexposed NPOM-crRNA, lane 3 contained only exposed NPOM-crRNA, and lane 4 contained only normal crRNA. The results showed that none of these lanes could form the RNP complex. Only lane 5, containing both cas12a protein and normal crRNA, and lane 6, containing both cas12a protein and exposed NPOM-crRNA, could efficiently assemble into the functional RNP complex. Lane 7 contained both cas12a protein and unexposed NPOM-crRNA, but the band was weak, suggesting that the corresponding NPOM-crRNA had low binding efficiency to LbCas12a.

[0087] Figure 4 Figure b visually illustrates the difference in the efficiency of LbCas12a in forming RNP complexes with different crRNAs: clear RNP complex bands can be observed in normal crRNAs and UV-irradiated NPOM-crRNAs (Lane5 and Lane6), indicating their good binding ability with LbCas12a; while the RNP band of unirradiated NPOM-crRNA (Lane7) is weak or absent, suggesting that the corresponding crRNA has a low binding efficiency with LbCas12a. This figure directly confirms that only UV-irradiated NPOM-crRNAs can efficiently assemble with LbCas12a to form functional RNP complexes, fully demonstrating that UV irradiation can regulate the assembly of NPOM-crRNA and LbCas12a complexes.

[0088] Example 2: A light-controlled nucleic acid detection system (ULTRAt system) The light-controlled nucleic acid detection system includes: (1) Modified crRNA (crRNA5) obtained in Example 1; (2) Cas12 family proteins or their engineered variants; (3) Reagents for amplifying the target sequence (preferably isothermal amplification reagents); (4) Signal reporter molecules: Single-stranded nucleic acid reporter molecules (such as ssDNA fluorescent reporter molecules) used to characterize the cleavage activity of Cas12 protein.

[0089] The light-controlled nucleic acid detection system also includes: A light source module is used to provide energy to activate the photosensitive protective group; the light source module includes a light source device capable of emitting excitation light of a preset wavelength; Preferably, the light source device is selected from portable light sources, handheld ultraviolet lamps, LED light-emitting diodes, laser generators, or light-emitting modules integrated into nucleic acid detection equipment; Preferably, the wavelength range of the excitation light is 350 nm to 420 nm, and the intensity of the excitation light is 4 mW / cm². 2 ~40mW / cm 2 The irradiation time is 5~60s.

[0090] Example 3: Parameter System Optimization of Ultra-Low Energy Consumption Photocontrolled Single-Tube Reaction System To enable the application of this system in portable detection devices, this embodiment systematically optimizes the key biochemical and photoelectric parameters of the ULTRAt single-tube reaction system.

[0091] (1) Optimization of ultraviolet light activation threshold: The reaction tubes, after being enriched at an isothermal temperature, were placed under portable 365nm UV LED light sources of varying powers. The results showed that only 10mW / cm² was required. 2 A light intensity sustained for 30 seconds is sufficient to bring the detection system to its maximum fluorescence activation plateau. This light intensity is significantly lower than that of existing technologies (123 mW / cm²). 2 Irradiation for 60 seconds not only avoids UV damage to the nucleic acid and Cas protein of the sample, but also provides core parameter support for the subsequent development of battery-driven on-site rapid testing terminals.

[0092] (2) Optimization of core component concentration and time: In this embodiment, LbCas12a protein final concentrations were measured in gradients from 0.045 μM to 0.225 μM. The optimized range for NPOM-crRNA concentration was set from 3.3 fmol / μL to 400 fmol / μL. To ensure ultra-high sensitivity, the pre-amplification time before UV irradiation was evaluated in this embodiment. Results are shown below. Figure 5 .

[0093] Figure 5 a is a bar graph showing the change in fluorescence intensity with ultraviolet irradiation intensity, 10 mW / cm². 2 The fluorescence intensity under ultraviolet irradiation intensity is 4 mW / cm 2 There is a significant improvement, and it has been increased to 40mW / cm 2 During the process, the fluorescence intensity did not increase significantly, indicating that 10 mW / cm 2 It is the minimum ultraviolet light intensity threshold for activating LbCas12a activity. Figure 5 b is a bar chart showing the change in fluorescence intensity with UV irradiation time. As the UV irradiation time increases from 0s to 30s, the fluorescence intensity gradually increases. However, when the time is extended to 60s, the fluorescence intensity does not increase significantly, indicating that 30s is the shortest UV irradiation time to activate LbCas12a activity. Figure 5 c is a bar graph showing the change in fluorescence intensity with protein concentration. As the protein concentration increases from 0.045 μM to 0.225 μM, the fluorescence intensity reaches a plateau at an LbCas12a protein concentration of 0.18 μM, indicating that 0.18 μM LbCas12a protein concentration is the optimal concentration for the reaction. Figure 5 d is a bar graph showing the change in fluorescence intensity with NPOM-crRNA concentration. As the NPOM-crRNA concentration increased from 3.3 fmol / μL to 400 fmol / μL, the fluorescence intensity reached a plateau at a crRNA concentration of 300 fmol / μL, indicating that 300 fmol / μL is the optimal concentration for the reaction.

[0094] In summary, using a 20 μL single-tube reaction final system, the optimal working concentration of Cas12a protein was established as 0.18 μM, and the optimal concentration of NPOM-crRNA was established as 300 fmol / μL. On the reaction timeline, a optimal detection flow was established: 39℃ isothermal amplification for 10 minutes + UV irradiation for 30 seconds + Cas12a trans-cleavage for 15 minutes.

[0095] Example 4: Verification of the system's universality for different Cas protein variants and "zero sequence restriction" targets This embodiment demonstrates that the structural engineering strategy of the present invention is not limited by target sequence characteristics and is fully compatible with various highly active Cas12a variants.

[0096] (1) Universality across the Cas protein family: The LbCas12a in the reaction system was replaced with three protein variants: LbCas12a-Ultra, AsCas12a, and AsCas12a-Ultra. The four Cas12a proteins were added to optimized single-tube reaction systems. For the purified monkeypox virus F3L gene fragment and the FLT3 / D835Y mutant fragment, the target input was set at 20 copies / reaction. Testing was performed according to the standard protocol of "10-minute pre-amplification + 30-second UV flash start + 15-minute detection".

[0097] The primer pair for detecting the monkeypox virus F3L gene fragment is as follows: F: 5'-TAGGAGAGTTACTAGGCCCCACTGATTCAATAC-3' (SEQ ID NO: 8).

[0098] R: 5'-AGAGGATCATAAGTCTTTTTGATGATGTTATTCC-3' (SEQ ID NO: 9).

[0099] The primer pair for detecting the FLT3 / D835Y mutant fragment is: F: 5'-GGTGAAGATATGTGACTTTGGATTGGCTCG-3' (SEQ ID NO: 10).

[0100] R: 5'-CACAACACAAAATAGCCGTATAAAAATAAGTAGG-3' (SEQ ID NO: 11).

[0101] See results Figure 6 .

[0102] Figure 6 This paper demonstrates the fluorescence response intensity comparison of the ULTRAt system of this invention to two different types of purified targets (monkeypox virus F3L gene and FLT3 / D835Y single nucleotide polymorphism mutation) under the action of four different Cas12a enzymes (LbCas12a, LbCas12a-Ultra, AsCas12a, and AsCas12a-Ultra), while also including a target-free negative control (NC). In all tested Cas12a enzyme and target combinations, the fluorescence intensity of the ULTRAt system was significantly higher than that of the target-free negative control (NC, gray column). This indicates that Cas12a does not undergo non-specific trans-cleavage in the absence of the target nucleic acid. The NPOM modification in the ULTRAt system completely blocks enzyme activity, with no obvious background signal. Figure 6 The results directly confirm that the ULTRAt system of this invention has wide applicability. It can be adapted to a variety of Cas12a enzymes (including LbCas12a, LbCas12a-Ultra, AsCas12a and AsCas12a-Ultra), and can be efficiently applied to different types of targets (such as viral nucleic acid detection and single nucleotide polymorphism mutation analysis), showing significant advantages in improving detection sensitivity and versatility.

[0103] The above test results for the purified nucleic acid target show that the NPOM-crRNA of the present invention can also achieve "perfect inhibition during the amplification period and instantaneous activation after light exposure" in these three highly active Cas variants, and the detection limit for the target reaches an extremely high level of less than 20 copies.

[0104] (2) Completely breaking through the target validation of sequence dependence: Addressing the critical defect of existing light control technologies (based on interstitial modification) that require the target PAM to contain three discontinuous thymine (dT) in its vicinity, this application achieves a theoretically universal coverage of 100% due to the modification site being on a conservative stem-ring framework.

[0105] This embodiment specifically selected challenging targets that did not meet the "containing 3 dT" condition (such as specific TP53 mutant sequences, respiratory syncytial virus, Mycoplasma pneumoniae, and conserved sequences of Staphylococcus aureus) for testing. The system demonstrated strong amplification and photocatalytic cleavage capabilities for all of the above challenging targets, thoroughly demonstrating the feasibility of the ULTRAt system as a universal molecular diagnostic platform.

[0106] Example 5: Ultra-sensitive single-tube POCT detection of monkeypox virus (Mpox) The ultra-sensitive single-tube POCT detection of monkeypox virus (Mpox) includes the following steps: (1) A customized crRNA sequence was designed for the F3L gene of monkeypox virus outer membrane protein, and NPOM-dT specific substitution was performed on the U(+5) and U(+14) sites in its stem-loop backbone region to obtain the optimal variant crRNA-5; (2) In a 20 μL single-tube reaction system, add the isothermal amplification reagent kit, 0.18 μM of LbCas12a protein at an optimized concentration, 300 fmol / μL of NPOM-crRNA, and FAM-quenching reporter probe; (3) The reaction tube was incubated at 39°C for 10 minutes. During this stage, Cas12a remained completely quiescent, and the target DNA was amplified isothermally for efficient enrichment. (4) Employs extremely low energy consumption (10 mW / cm²) 2 Irradiate with 365 nm ultraviolet light for 30 seconds to remove the protecting groups.

[0107] See results Figure 7 .

[0108] Figure 7 a represents the kinetic curves of fluorescence intensity changing with reaction time when different copy numbers of the target are input. As the reaction time increases from 0 min to 40 min, 2 × 10⁻⁶... 5 -2×10 0 The fluorescence intensity gradually increased with increasing copy number, while the negative control (NC) group remained at a low level, indicating that this method can effectively detect 2×10⁻⁶ copies of fluorescence. 5 -2×10 0 It enables dynamic detection of copy number targets with extremely high sensitivity.

[0109] Figure 7 b is a bar chart showing the anti-interference performance in complex biological matrices. In the three matrices of conventional buffer, 10% serum, and 10% saliva, the fluorescence intensity of the 2-copy target group was significantly higher than that of the negative control (NC) group, indicating that the method can still maintain good detection performance in complex biological matrices and has strong anti-interference ability.

[0110] The monitoring results above indicate that a strong fluorescence signal can be generated within 15 minutes for purified targets as low as 2 copies or pseudoviruses lysed at 95°C, which is 100 times more sensitive than the unmodified single-tube method. The system still maintains its limit detection capability in 10% mouse serum or human saliva matrix, demonstrating strong potential for extraction-free direct amplification.

[0111] Example 6: Precise identification and subtyping of tumor target FLT3 D835Y mutation (SNP) A custom NPOM-crRNA targeting the FLT3 D835Y site was designed, with the sequence: UAAUUUC / NPOM-dT / ACUAAGUG / NPOM-dT / AGAUGAUUGGCUCGAUACAUCAUGAGU (SEQ ID NO: 12). In addition to NPOM modification of the backbone U(+5) and U(+14) regions to cut off background leakage, additional artificial base mismatches were introduced in the spacer region, significantly improving sensitivity to single-base differences.

[0112] Using the same single-tube isothermal amplification and UV activation process as described above, test results show that this system can accurately identify mutant alleles with a frequency as low as 1% under wild-type (WT) masking.

[0113] A double-blind test was conducted on nucleic acid samples from 41 clinical oncology patients. The test, combined with lateral flow chromatography (LFA) strips for colorimetric reading, achieved 100% diagnostic specificity and accuracy, with an area under the ROC curve (AUC) of 1.000, which is in complete agreement with the gold standard of Sanger sequencing.

[0114] See results Figure 8 .

[0115] Figure 8 a is a bar chart of fluorescence intensity at different mutation allele frequencies. As the mutation allele frequency decreased from 100% to 1%, the fluorescence intensity gradually decreased, but all were significantly different from the fluorescence intensity in the WT (wild type) and NC (negative control) groups. This indicates that the method can specifically distinguish the D835Y mutation site with a mutation frequency as low as 1% and has extremely low background signal.

[0116] Figure 8b is the ROC curve for clinical SNP detection. The area under the curve (AUC) is 1.000, indicating that the detection method has perfect diagnostic efficacy in distinguishing between positive and negative samples and can achieve accurate identification of clinical SNPs.

[0117] Example 7: Transformation of a rapid intelligent screening terminal for high-risk HPV16 / 18 clinical samples To verify the efficacy and instrument compatibility of this invention for large-scale on-site screening, nucleic acid was extracted from cervical swabs of 50 patients and directly added to the reaction system, incubated at 39°C, and activated by low-radiation ultraviolet light. Results are shown below. Figure 9 .

[0118] Figure 9 The comparison matrix for HPV clinical testing shows that the ULTRAt method is highly consistent with the qPCR / FGS gold standard test results: 14 positive samples were accurately detected (true positives), with no false positives; 36 negative samples were accurately detected (true negatives), with no false negatives. This indicates that this method has 100% sensitivity and 100% specificity in HPV clinical testing, enabling accurate and unbiased identification of HPV infection status.

[0119] Due to the extremely low photoactivation energy requirement of this invention (10 mW / cm) 2 The instrument exhibits good freeze-drying tolerance, and its core reagents (primers, modified crRNA, and Cas12a) can be pre-prepared as freeze-dried microspheres. In remote areas or primary healthcare facilities, these microspheres are placed in handheld smart diagnostic terminals powered by ordinary batteries and equipped with miniature UV LED modules and photoelectric sensors. Upon one-button start, the instrument automatically maintains a 39°C temperature and performs a 30-second flash activation, visually presenting the photoelectric conversion voltage signal to the operator via built-in sensors. This not only completely eliminates the limitations of large PCR instruments but also significantly expands the system's application boundaries across various fields, such as rapid on-site testing in agriculture and disease monitoring in deep-sea aquaculture.

[0120] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A modified crRNA, characterized in that, The crRNA comprises a backbone region and a spacer region; At least one nucleotide residue of the crRNA is replaced by a photosensitive modified nucleotide, wherein the substitution occurs at least in the backbone region; The photosensitive modified nucleotide contains a photosensitive protecting group, which is used to inhibit the formation of a cleavage-active complex between the crRNA and the Cas12 protein by steric hindrance or by changing the secondary structure conformation of the backbone region. The photosensitive protecting group can be removed, cleaved, undergo conformational changes, or have its steric hindrance removed under light irradiation of a specific wavelength, thereby restoring the biological activity of the crRNA.

2. The crRNA according to claim 1, characterized in that, The nucleotide residues substituted in the backbone region are uracil nucleotide residues, and the photosensitive modified nucleotides are deoxythymidine, thymidine, or their analogues with photosensitive protecting groups.

3. The crRNA according to claim 1, characterized in that, The photosensitive protective group includes 6-nitropiperyloxymethyl (NPOM), 4,5-dimethoxy-2-nitrobenzyl (DMNB), α-methyl-6-nitropiperyloxycarbonyl (MeNPOC); and at least one derivative of each of the above three groups; preferably 6-nitropiperyloxymethyl.

4. The crRNA according to claim 1, characterized in that, The original sequence of the backbone region is selected from the conserved backbone region sequence corresponding to LbCas12a, AsCas12a protein or its engineered variant, or a sequence that has more than 90% homology with the conserved backbone region sequence.

5. The crRNA according to claim 1, characterized in that, The original sequence length of the backbone region is 19 to 25 nucleotides, preferably 20 or 21 nucleotides.

6. The crRNA according to claim 1, characterized in that, The original sequence of the skeleton region includes the sequence shown in SEQ ID NO: 2, or a sequence that has more than 90% homology with SEQ ID NO: 2 and retains the stem-loop structure.

7. The crRNA according to claim 5, characterized in that, The substitution occurs at the 5th and 14th positions from the 3' end to the 5' end in the skeleton region. The sequence of the interval region is designed based on the target sequence to be detected, and is used to complement the target sequence.

8. A light-controlled nucleic acid detection system, characterized in that, include: The modified crRNA according to any one of claims 1-7; Cas12 family proteins or their engineered variants; Reagents used for amplifying the target sequence; and Signal reporting molecules; The modified crRNA, after being deactivated by photosensitivity and restored to activity under light of a specific wavelength, can guide the Cas12 family protein or its engineered variants to target the target sequence and activate its trans-cleavage activity.

9. A reagent kit for light-controlled nucleic acid detection, characterized in that, The kit comprises the components of the system as described in claim 8; Preferably, each component in the kit is placed in a separate container, or two or more components are premixed and placed in the same container.

10. A single-tube nucleic acid detection method, characterized in that, Includes the following steps: S1. The sample to be tested is mixed with the light-controlled nucleic acid detection system described in claim 8 to form a reaction system, and amplification is carried out under isothermal conditions; at this time, the modified crRNA is in a closed state and does not interfere with the amplification reaction. S2. Irradiate the amplified reaction system with light of a specific wavelength to remove the photosensitive protecting group and activate the trans-cleavage activity of Cas12 family proteins or their engineered variants; S3. Detect the fluorescence signal or colorimetric signal generated after the signal reporter molecule is cleaved to determine the presence of the target nucleic acid in the sample to be tested.

11. The application of the modified crRNA according to any one of claims 1-7, the light-controlled nucleic acid detection system according to claim 8, the kit according to claim 9, or the single-tube nucleic acid detection method according to claim 10 in the preparation of a target nucleic acid detection product, characterized in that, The target nucleic acid detection product is used for any of the following: In vitro detection of nucleic acids of infectious pathogens; Specific typing of single nucleotide polymorphisms; Immediate molecular detection.

12. The in vitro application of the modified crRNA according to any one of claims 1-7, the light-controlled nucleic acid detection system according to claim 8, the kit according to claim 9, or the single-tube nucleic acid detection method according to claim 10 for non-disease diagnostic purposes in any of the following fields: Rapid analysis of nucleic acids of infectious pathogens; Specific typing of single nucleotide polymorphisms; On-site or portable nucleic acid testing.