A leptospira rapid detection kit based on crisper-cas12a

Abstract

The application relates to the technical field of molecular biology detection, and specifically discloses a Leptospira rapid detection kit based on CRISPR-Cas12a, which comprises an amplification module reagent, a CRISPR detection module reagent, a sample pretreatment module reagent and a quality control module reagent; the double-target strategy can realize the following advantages through complementary identification information: on one hand, a pathogenic gene directly indicates a potential pathogenic strain, and the direct indication can enhance the directionality of disease correlation; on the other hand, a 16S variable region provides lineage or close strain identification, and can distinguish environmental / non-pathogenic background noise from a real pathogenic threat. The design reduces the risk of false positive or false negative caused by a single target in molecular recognition, improves the reliability and availability of detection results in clinical interpretation and epidemiological explanation, and provides more definite information support for subsequent diagnosis and treatment or prevention and control decision-making after rapid screening.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, specifically relating to a rapid detection kit for Leptospira based on CRISPR-Cas12a. Background Technology

[0002] Leptospirosis is a global zoonotic disease caused by pathogenic leptospires (primarily Leptospira questionmarkii), prevalent in tropical, subtropical, and temperate regions. In my country, it is classified as a Class B infectious disease. This pathogen can enter the human body through contaminated water and soil via the skin and mucous membranes, causing symptoms such as high fever, jaundice, and liver and kidney damage. In severe cases, it can lead to death due to pulmonary hemorrhage and multiple organ failure. Meanwhile, non-pathogenic leptospires widely present in the environment (such as Leptospira hyperbolica) may not be pathogenic, but they can easily interfere with test results, increasing the difficulty of clinical interpretation. Therefore, rapidly distinguishing between "whether it is a leptospira" and "whether it is pathogenic" is a core requirement for early diagnosis, timely treatment, and precise epidemic control.

[0003] Traditional microbial culture is the basic method for detecting Leptospira. However, this pathogen is a strict anaerobe, requiring special culture media (such as Korthof medium) for cultivation. The logarithmic growth phase lasts for 5-7 days, and the entire process from sample inoculation to strain identification takes 4-7 days, which is completely unacceptable for "rapid diagnosis". At the same time, the culture process is easily contaminated by environmental bacteria, and it is impossible to directly distinguish between pathogenic and non-pathogenic strains, requiring additional experimental verification. The operation is cumbersome and inefficient.

[0004] While serological methods (such as the microscopic agglutination test MAT) were once considered the "gold standard" for pathogen identification, they have significant limitations: First, they require the preservation of a large number of international and domestic Leptospira reference strains, resulting in high maintenance costs; second, they require the preparation of specific antiserum through immunization of animals, which demands stringent operational techniques, and antibody titers are prone to rapid decreases due to fluctuations in storage conditions and preparation processes, leading to misinterpretations; third, this method can only be carried out by a few reference laboratories, making it completely unsuitable for primary healthcare institutions and on-site emergency testing scenarios, severely restricting the efficiency of daily epidemic monitoring and emergency response.

[0005] In response to this problem, this application proposes a rapid detection kit for Leptospira based on CRISPR-Cas12a to solve the aforementioned issues. Summary of the Invention

[0006] The purpose of this invention is to provide a rapid detection kit for Leptospira based on CRISPR-Cas12a to solve the problems mentioned in the background art.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] A rapid detection kit for Leptospira based on CRISPR-Cas12a, comprising:

[0009] The amplification module reagent comprises an isothermal amplification mixture (preferably RPA), a dual-target specific primer pair for dual-target amplification, and an amplification buffer; the dual targets include a pathogenic target against the Leptospira pathogenicity marker gene lipL32 and a non-pathogenic target against the Leptospira 16S rRNA variant region.

[0010] CRISPR detection module reagent, wherein the CRISPR detection module reagent comprises LbCas12a protein or its engineered bifunctional variant, bispecific crRNA and a reporter molecule system compatible with Cas12a activity;

[0011] The sample pretreatment module reagent includes a lysis buffer for rapid lysis and a mini silica membrane purification column for purifying nucleic acids from small-volume samples.

[0012] The quality control module reagent comprises a target nucleic acid vector for a positive control and a buffer solution for a negative control;

[0013] The kit is configured to allow for single-tube freezing under ambient temperature transport conditions, storage at room temperature or 4°C, and completion of the detection process from sample to interpretation within ≤30 minutes under constant temperature conditions of 37°C.

[0014] Preferably, the sequence of the dual-target specific primer pair is:

[0015] Forward primers for pathogenic targets: as shown in SEQ ID NO.1;

[0016] Downstream primers for pathogenic targets: as shown in SEQ ID NO.2;

[0017] Forward primers for non-pathogenic targets: as shown in SEQ ID NO.3;

[0018] Non-pathogenic target downstream primers: as shown in SEQ ID NO.4;

[0019] The sequence of the bispecific crRNA is as follows:

[0020] Pathogenic crRNAs targeting the lipL32 gene: as shown in SEQ ID NO.5;

[0021] Non-pathogenic crRNAs targeting 16S rRNA-specific fragments: as shown in SEQ ID NO.6;

[0022] The pathogenic primer pair is used to amplify the lipL32 fragment, and the non-pathogenic primer pair is used to amplify the 16S rRNA variant region. The bispecific crRNAs target specific regions of the corresponding amplified fragments.

[0023] Preferably, the reporter molecule system is a dual-channel composite reporter system, comprising:

[0024] A set of fluorescent reporter molecules (preferably FAM-TTATT-BHQ1 for pathogenicity detection; HEX-TTATT-BHQ2 or equivalent fluorescent pairs for non-pathogenicity detection) and a set of colorimetric reporter molecules (preferably azobenzene-modified single-stranded DNA, which produces color changes that can be read by the naked eye or a colorimetric card after colorimetric cutting) can be used in parallel or individually as needed to achieve dual-mode interpretation of fluorescence quantification and visual detection.

[0025] Preferably, the amplification module reagent and the CRISPR detection module reagent are pre-packaged in a lyophilized form in a single reaction tube or a multi-compartment reaction strip, using an integrated formulation (including RPA mixture, bifunctional LbCas12a, dual crRNA, dual reporter molecules, and stabilizer). When used, the pretreated sample and reconstitution buffer are added to complete the amplification-CRISPR combined reaction in a single tube, significantly shortening the operation steps and improving the on-site portable detection capability.

[0026] Preferably, the rapid lysis buffer contains lysozyme (final concentration 10-20 U / μL), EDTA (final concentration 5-10 mM), and a nonionic surfactant (Triton X-100, final concentration 0.5%-1%). The lysis step is performed by incubating at 37°C for about 5-15 minutes to release bacterial nucleic acid. The mini silica membrane nucleic acid purification column is suitable for sample volumes of 20-200 μL and can obtain purified nucleic acid that meets the requirements for subsequent isothermal amplification without the need for phenol-chloroform organic extraction.

[0027] Preferably, the reagents for the quality control module include:

[0028] A positive plasmid containing the lipL32 fragment, with a concentration of 1×10⁻⁶. 4 Copies / μL, along with a positive plasmid containing a 16S rRNA-specific fragment, and a negative control containing no target nucleic acid;

[0029] The positive control sample is used in conjunction with the test reagent to verify the integrity of amplification, Cas12a activity, and the report system.

[0030] In another aspect, the present invention also provides the application of the kit in the detection of Leptospira.

[0031] Preferably, the method for detecting Leptospira using the kit includes the following steps:

[0032] S1. Sample pretreatment: Mix the sample to be tested with the rapid lysis buffer, incubate at 37°C for 5-15 minutes, take the supernatant and purify it through a mini silica membrane nucleic acid purification column to obtain purified nucleic acid;

[0033] S2. Single-tube amplification-detection experiment: Add the purified nucleic acid to the frozen preparation reaction tube and rehydrate it. Perform isothermal amplification at 37°C for 10-20 minutes to amplify the dual targets simultaneously and initiate the Cas12a-mediated transcleavage reaction.

[0034] S3. Reading and interpretation: Read the FAM or HEX signal using a handheld fluorescence detector or portable fluorescence module, or directly compare the colorimetric report of the colorimetric report to determine whether leptospires are present and whether they are pathogenic or non-pathogenic.

[0035] The total detection time (from lysis to interpretation) is ≤30 minutes, and the kit design allows for a minimum detection limit of 10 copies per reaction volume.

[0036] Preferably, the method further includes:

[0037] Internal control measures: The internal amplification control (IAC) sequence and corresponding primers or probes are added to the amplification system simultaneously to determine whether there is inhibition or operational error in the event of a negative result; when the IAC signal is abnormal, a retest is prompted or the process is handled according to the QC procedure.

[0038] Compared with the prior art, the beneficial effects of the present invention are:

[0039] (1) The dual-target strategy in this invention achieves the following advantages through complementary identification information: on the one hand, it directly indicates potential pathogenic strains with pathogenic genes, enhancing the indicativeness of disease relevance; on the other hand, it provides lineage or closely related strain identification with the 16S variant region, which can distinguish between environmental / non-pathogenic background noise and real pathogenic threats. This design reduces the risk of false positives or false negatives caused by a single target in molecular recognition, and improves the credibility and usability of the test results in clinical interpretation and epidemiological explanation, thereby providing clearer information support for subsequent diagnosis and treatment or prevention and control decisions after rapid screening.

[0040] (2) The composite reporting system in this invention combines the complementary advantages of two types of reports: fluorescence readings provide highly sensitive and quantifiable data output, suitable for scenarios with equipment support or as a confirmatory means; colorimetric readings enable "instant visualization" judgment under resource-constrained or emergency on-site conditions, facilitating rapid decision-making by grassroots personnel or first responders on-site. The parallel or tiered use of dual channels can greatly broaden the applicable scenarios and lower the threshold for on-site equipment dependence while ensuring detection reliability, and improve the robustness and interpretability of the results through cross-judgment. Detailed Implementation

[0041] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0042] Example 1:

[0043] A rapid detection kit for Leptospira based on CRISPR-Cas12a, comprising:

[0044] The amplification module reagent comprises isothermal amplification mixture RPA, dual-target specific primer pairs for dual-target amplification, and amplification buffer; the dual targets include a pathogenic target against the Leptospira pathogenicity marker gene lipL32 and a non-pathogenic target against the Leptospira 16S rRNA variant region.

[0045] CRISPR detection module reagent, wherein the CRISPR detection module reagent comprises LbCas12a protein or its engineered bifunctional variant, bispecific crRNA and a reporter molecule system compatible with Cas12a activity;

[0046] The sample pretreatment module reagent includes a lysis buffer for rapid lysis and a mini silica membrane purification column for purifying nucleic acids from small-volume samples.

[0047] The quality control module reagent comprises a target nucleic acid vector for a positive control and a buffer solution for a negative control;

[0048] The kit is configured to allow for single-tube freezing under ambient temperature transport conditions, storage at room temperature or 4°C, and completion of the detection process from sample to interpretation within ≤30 minutes under constant temperature conditions of 37°C.

[0049] Specifically, the sequences of the dual-target specific primer pair are as follows:

[0050] Forward primers for pathogenic targets: as shown in SEQ ID NO.1;

[0051] SEQ ID NO.1 is the pathogenic upstream primer for lipL32:

[0052] Molecular type: DNA;

[0053] Length: 24 nt;

[0054] Sequence (5'→3'): CTATCTTAGCTTCTATTCTTGTC

[0055] Downstream primers for pathogenic targets: as shown in SEQ ID NO.2;

[0056] SEQ ID NO.2 is the pathogenic downstream primer for lipL32:

[0057] Molecular type: DNA;

[0058] Length: 26 nt;

[0059] Sequence (5'→3'): CTGGTTTAAAATACTATTACAGATGC

[0060] Forward primers for non-pathogenic targets: as shown in SEQ ID NO.3;

[0061] Among them, SEQ ID NO.3 is the pathogenic crRNA of lipL32 (Cas12a crRNA, overall sequence contains repeats + spacers, RNA representation):

[0062] Molecular type: RNA (represented by U);

[0063] Length: 41 nt;

[0064] Sequence (5'→3'): UAAUUUCUACUAAGUGUAGAUAUCUAAUGCAGUUGAUACUA

[0065] Non-pathogenic target downstream primers: as shown in SEQ ID NO.4;

[0066] Among them, SEQ ID NO.4 — lipL32 gene fragment (positive control insert fragment):

[0067] Molecular type: DNA;

[0068] Length: 293 nt;

[0069] Sequence (5'→3', 293 nt):

[0070] TTACTGCCATTAACCTATCTTAGCTCTATTCTTGTTCTAATAATGGGTCACTTGTTTCACTTAGCTCTTTGATTGCTGCACCTAAACTTACACCATCTATGATAGTTGCAATTAAGGGTAATCTTCAGATAATGTAGGAAGTA ATCTATAGTTTCATCTAATGCAGTTGATACTAATTCACACACTTTGGCTGCATCTGTAATAGTATTTAAACCAGTACTAAATAATTGAGCATAAACTTGAACTTTCATTGCTACACTTAAATACTAAGAGATTTCTTTAAGACTA

[0071] The sequence of the bispecific crRNA is as follows:

[0072] Pathogenic crRNAs targeting the lipL32 gene: as shown in SEQ ID NO.5;

[0073] Among them, SEQ ID NO.5 — 16S rRNA non-pathogenic upstream primer:

[0074] Molecular type: DNA;

[0075] Length: 22 nt;

[0076] Sequence (5'→3'): GGTTAAGTGCTTTCAGTTGGTG

[0077] Non-pathogenic crRNAs targeting 16S rRNA-specific fragments: as shown in SEQ ID NO.6;

[0078] Among them, SEQ ID NO.6 is the non-pathogenic downstream primer for 16S rRNA:

[0079] Molecular type: DNA;

[0080] Length: 24 nt;

[0081] Sequence (5'→3'): CCTGCTGCCTCCCGTAGGAGTTA

[0082] The pathogenic primer pair is used to amplify the lipL32 fragment, and the non-pathogenic primer pair is used to amplify the 16S rRNA variant region. The bispecific crRNAs target specific regions of the corresponding amplified fragments.

[0083] Specifically, the reporter molecule system is a dual-channel composite reporter system, comprising:

[0084] A set of fluorescent reporter molecules (preferably FAM-TTATT-BHQ1 for pathogenicity detection; HEX-TTATT-BHQ2 or equivalent fluorescent pairs for non-pathogenicity detection) and a set of colorimetric reporter molecules (preferably azobenzene-modified single-stranded DNA, which produces color changes that can be read by the naked eye or a colorimetric card after colorimetric cutting) can be used in parallel or individually as needed to achieve dual-mode interpretation of fluorescence quantification and visual detection.

[0085] Specifically, the amplification module reagent and the CRISPR detection module reagent are pre-packaged in lyophilized form in a single reaction tube or multi-compartment reaction strip, using an integrated formulation (including RPA mixture, bifunctional LbCas12a, dual crRNA, dual reporter molecules, and stabilizer). When used, pretreated sample and reconstitution buffer are added to complete the amplification-CRISPR combined reaction in a single tube, significantly shortening the operation steps and improving on-site portable detection capability.

[0086] Specifically, the rapid lysis buffer contains lysozyme (final concentration 10-20 U / μL), EDTA (final concentration 5-10 mM), and a nonionic surfactant (Triton X-100, final concentration 0.5%-1%). The lysis step is performed at 37°C for approximately 5-15 minutes to release bacterial nucleic acid. The mini silica membrane nucleic acid purification column is suitable for sample volumes of 20-200 μL and can obtain purified nucleic acid that meets the requirements for subsequent isothermal amplification without the need for phenol-chloroform organic extraction.

[0087] Specifically, the reagents for the quality control module include:

[0088] A positive plasmid containing the lipL32 fragment, with a concentration of 1×10⁻⁶. 4 Copies / μL, along with a positive plasmid containing a 16S rRNA-specific fragment, and a negative control containing no target nucleic acid;

[0089] The positive control sample is used in conjunction with the test reagent to verify the integrity of amplification, Cas12a activity, and the report system.

[0090] As can be seen from the above, a dual-target design is adopted, which simultaneously targets pathogenic marker genes (such as lipL32) and 16S rRNA variant regions (non-pathogenic or closely related strain-specific regions), and amplifies and recognizes them in parallel in the same reaction system.

[0091] The dual-target strategy achieves the following advantages through complementary discriminative information: on the one hand, it directly indicates potential pathogenic strains with pathogenic genes, enhancing the targeting of disease relevance; on the other hand, it provides lineage or closely related strain identification through the 16S variant region, distinguishing environmental / non-pathogenic background noise from true pathogenic threats. This design reduces the risk of false positives or false negatives caused by single-target molecular recognition, improving the reliability and usability of test results in clinical interpretation and epidemiological explanation, thereby providing clearer information support for subsequent diagnosis, treatment, or prevention and control decisions after rapid screening.

[0092] Example 2:

[0093] In another aspect, the present invention also provides the application of the kit in the detection of Leptospira.

[0094] Preferably, the method for detecting Leptospira using the kit includes the following steps:

[0095] S1. Sample pretreatment: Mix the sample to be tested with the rapid lysis buffer, incubate at 37°C for 5-15 minutes, take the supernatant and purify it through a mini silica membrane nucleic acid purification column to obtain purified nucleic acid;

[0096] S2. Single-tube amplification-detection experiment: Add the purified nucleic acid to the frozen preparation reaction tube and rehydrate it. Perform isothermal amplification at 37°C for 10-20 minutes to amplify the dual targets simultaneously and initiate the Cas12a-mediated transcleavage reaction.

[0097] S3. Reading and interpretation: Read the FAM or HEX signal using a handheld fluorescence detector or portable fluorescence module, or directly compare the colorimetric report of the colorimetric report to determine whether leptospires are present and whether they are pathogenic or non-pathogenic.

[0098] The total detection time (from lysis to interpretation) is ≤30 minutes, and the kit design allows for a minimum detection limit of 10 copies per reaction volume.

[0099] Specifically, the method further includes:

[0100] Internal control measures: The internal amplification control (IAC) sequence and corresponding primers or probes are added to the amplification system simultaneously to determine whether there is inhibition or operational error in the event of a negative result; when the IAC signal is abnormal, a retest is prompted or the process is handled according to the QC procedure.

[0101] Example 3:

[0102] Laboratory fluorescence detection scenario (clinical urine sample):

[0103] I. Experimental Materials:

[0104] Kit components: Rapid lysis buffer (containing 15 U / μL lysozyme, 8 mM EDTA, and 0.8% Triton X-100), mini silica membrane nucleic acid purification column, cryo-intervention reaction tubes (premixed RPA amplification mixture, bifunctional LbCas12a protein, bispecific crRNA, and dual reporter molecules), reconstitution buffer, and double positive control (containing 1×10^6 lipL32 gene plasmid). 4 Copies / μL, 1×10⁻⁶ 16S rRNA specific plasmid 4 Copies / μL, negative control (Tris-HCl buffer pH 8.0).

[0105] Samples: Urine samples (5 samples, numbered U1-U5) from patients clinically suspected of having leptospirosis, obtained with ethical approval.

[0106] Instruments: Quantitative fluorescence detector (capable of simultaneously detecting FAM / HEX channels, temperature accuracy ±0.1℃), miniature centrifuge (speed ≥10000 rpm), 37℃ constant temperature incubator.

[0107] II. Experimental Methods:

[0108] (1) Sample pretreatment (total time 12 minutes):

[0109] Take 50 μL of urine sample and add it to a 1.5 mL centrifuge tube. Then add 100 μL of rapid lysis buffer, vortex to mix, and incubate at 37 °C for 10 minutes (to lyse Leptospira cells and release nucleic acid).

[0110] After incubation, centrifuge at 10,000 rpm for 5 minutes, and take 80 μL of the supernatant to add to a mini silica membrane purification column, following the instructions in the kit:

[0111] Add 200 μL of washing solution A, centrifuge at 10,000 rpm for 30 seconds, and discard the waste liquid;

[0112] Add 200 μL of washing buffer B, centrifuge at 10,000 rpm for 30 seconds, and discard the waste liquid;

[0113] Centrifuge the empty column at 10,000 rpm for 1 minute to remove residual washing liquid;

[0114] Add 20 μL of elution buffer to the purification column, let it stand at room temperature for 2 minutes, then centrifuge at 10,000 rpm for 1 minute and collect the elution buffer (i.e., the purified Leptospira nucleic acid).

[0115] (2) Isothermal amplification and CRISPR detection (total time 15 minutes):

[0116] Remove the frozen intervention reaction tube (single tube specification: premixed RPA enzyme, LbCas12a protein, SEQ ID NO.5 / 6crRNA, FAM / HEX reporter molecule), add 20μL of purified nucleic acid + 30μL of reconstitution buffer, vortex to mix and then briefly centrifuge (to remove air bubbles from the tube wall).

[0117] Place the reaction tube in a 37°C incubator and react for 15 minutes (the first 5 minutes are for RPA to amplify the lipL32 / 16S rRNA target gene, and the next 10 minutes are for the Cas12a-crRNA complex to recognize the target gene and cleave the reporter molecule).

[0118] After the reaction is complete, place the reaction tube into a quantitative fluorescence detector and read the fluorescence intensity of the FAM (excitation wavelength 494nm, emission wavelength 518nm) and HEX (excitation wavelength 535nm, emission wavelength 556nm) channels. Set the fluorescence threshold to 1000 RFU.

[0119] (3) Result interpretation criteria:

[0120] Pathogenic Leptospira: FAM channel fluorescence intensity ≥1000 RFU, HEX channel <1000 RFU;

[0121] Non-pathogenic Leptospira: HEX channel fluorescence intensity ≥1000 RFU, FAM channel <1000 RFU;

[0122] Negative: Both channels showed fluorescence intensities <1000 RFU;

[0123] Quality control verification: Double positive control samples must have a combined RFU level of ≥1000 in both channels, and negative control samples must have a combined RFU level of <1000 in both channels; otherwise, the experiment is invalid.

[0124] III. Experimental Results:

[0125] The sample test results are shown in Table 1 below:

[0126] Table 1

[0127]

[0128] Sensitivity verification: Double-positive control samples (lipL32 gene plasmid) were serially diluted (1×10⁻⁶). 4 1×10 3 1×10 2 The test was performed using the method described above. The results showed that the FAM channel fluorescence value was still detected at ≥1000 RFU at 10 Copies / reaction, proving that the kit's lowest detection limit is 10 Copies / reaction, which meets the performance specifications.

[0129] Specificity verification: Nucleic acid samples of Escherichia coli (ATCC 25922), Salmonella (ATCC 14028), and a closely related strain of Leptospira biflexa (ATCC 700520) were taken and tested according to the above method. The results showed that the dual-channel fluorescence value was <1000 RFU, indicating no cross-reactivity and 100% specificity.

[0130] As can be seen from the above, the present invention constructs parallel fluorescence and colorimetric reporting channels: the fluorescence channel is used for high-sensitivity, real-time or semi-quantitative reading; the colorimetric channel is used for rapid visual interpretation without the need for special instruments.

[0131] The composite reporting system combines the complementary advantages of two reporting formats: fluorescence readings provide highly sensitive and quantifiable data output, suitable for scenarios with equipment support or as a confirmatory measure; colorimetric readings enable "instantaneous" judgment under resource-constrained or emergency on-site conditions, facilitating rapid decision-making by frontline personnel or first responders. The parallel or tiered use of dual channels greatly expands the applicable scenarios and lowers the barrier to on-site equipment dependence while ensuring detection reliability, and improves the robustness and interpretability of results through cross-judgment.

[0132] Example 4:

[0133] Basic-level colorimetric testing scenario (environmental water samples):

[0134] I. Experimental Materials

[0135] Kit components: rapid lysis buffer (same as in Example 3), mini silica membrane nucleic acid purification column, colorimetric frozen section reaction tubes (premixed RPA amplification mixture, LbCas12a protein, bispecific crRNA, azobenzene-modified colorimetric reporter molecule), reconstitution buffer, colorimetric control card (red: negative; yellow: pathogenic; orange: non-pathogenic), double positive control, negative control.

[0136] Samples: Water samples collected by the grassroots disease control center (4 samples, numbered W1-W4, from paddy field water, river water, well water, and pond water respectively).

[0137] Instruments: Miniature centrifuge (standard equipment in primary laboratories), 37℃ constant temperature water bath (replaces incubator, readily available in primary laboratories), no fluorescence detector required.

[0138] II. Experimental Methods:

[0139] (1) Sample pretreatment (total time 15 minutes):

[0140] Take 100 μL of environmental water sample and add it to a 1.5 mL centrifuge tube. Add 150 μL of rapid lysis buffer (environmental samples contain a lot of impurities, so increase the amount of lysis buffer appropriately). Vortex to mix and incubate in a constant temperature water bath at 37°C for 12 minutes.

[0141] Centrifuge at 10,000 rpm for 5 minutes, take 100 μL of supernatant and add it to a mini silica membrane purification column. Follow the instructions (same as in Example 3) and finally collect 25 μL of purified nucleic acid (the nucleic acid concentration of the environmental sample is low, so increase the volume of elution buffer to improve the recovery rate).

[0142] (2) Isothermal amplification and CRISPR colorimetric detection (total time 15 minutes):

[0143] Take out the colorimetric frozen section reaction tube, add 25 μL of purified nucleic acid + 25 μL of reconstitution buffer, mix well, and react in a 37°C constant temperature water bath for 15 minutes.

[0144] After the reaction is complete, remove the reaction tube and compare the color change of the solution in the tube directly with the colorimetric control card (observe at room temperature and avoid direct sunlight).

[0145] (3) Result interpretation criteria:

[0146] Pathogenic Leptospira: The solution changed from initial red to yellow, consistent with the "Pathogenicity" color block on the control card;

[0147] Non-pathogenic Leptospira: The solution changed from initial red to orange, consistent with the "non-pathogenic" color block on the control card;

[0148] Negative: The solution remains red, consistent with the "negative" color block on the control card;

[0149] Quality control verification: The double-positive quality control samples were yellow (pathogenic plasmids) and orange (non-pathogenic plasmids), respectively, and the negative quality control sample was red, indicating that the experiment was valid.

[0150] III. Experimental Results:

[0151] The sample test results are shown in Table 2 below:

[0152] Table 2

[0153]

[0154] On-site applicability verification:

[0155] Operation time: The total time from sample collection to result interpretation is ≤45 minutes, which is significantly shorter than the traditional culture method (4-7 days);

[0156] Equipment dependence: Only a mini centrifuge and a constant temperature water tank are required, no expensive instruments are needed, which is suitable for basic laboratories;

[0157] Stability: After the kit was stored at room temperature for 3 months, the test results for W1 positive samples were still clearly yellow, with no false negatives, and the stability met the standard.

[0158] Consistency verification: Samples W1-W4 were simultaneously sent to the superior laboratory for verification using the fluorescence detection method in Example 1. The results were completely consistent (W1 / W2 pathogenic, W3 negative, W4 non-pathogenic), proving that the colorimetric method and the fluorescence method have comparable reliability and can meet the needs of rapid screening at the grassroots level.

[0159] As can be seen from the above, the present invention pre-prepares and stably encapsulates the amplification components, engineered Cas12a, double crRNA and reporter molecules in lyophilized form, and provides rapid pretreatment reagents and a mini nucleic acid purification device, and includes built-in positive / negative controls and internal amplification control (IAC).

[0160] First, the freeze-drying and stabilization formulations significantly improve the stability of reagents under normal transportation and storage conditions, facilitating large-scale distribution and long-term storage.

[0161] Secondly, the accompanying portable pretreatment module and small-volume purification solution reduce the reliance on complex pretreatment equipment, making the process from sampling to interpretation feasible and easy to operate on-site, thereby shortening the detection link and reducing the variation caused by human operation differences.

[0162] Finally, the built-in quality control (positive / negative control and IAC) combined with automatic interpretation via mobile terminals / software allows for real-time on-site assessment of system integrity and suppression of potential problems, improving the controllability and traceability of results. In summary, the entire solution theoretically achieves the ability to quickly provide usable interpretations while maintaining high reliability across multiple scenarios (primary clinical settings, livestock / environmental monitoring, and emergency public health responses).

[0163] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A rapid detection kit for Leptospira based on CRISPR-Cas12a, characterized in that, include: The amplification module reagent comprises an isothermal amplification mixture, a dual-target specific primer pair for dual-target amplification, and an amplification buffer; the dual targets include a pathogenic target against the Leptospira pathogenicity marker gene lipL32 and a non-pathogenic target against the variant region of Leptospira 16S rRNA. CRISPR detection module reagent, wherein the CRISPR detection module reagent comprises LbCas12a protein or its engineered bifunctional variant, bispecific crRNA and a reporter molecule system compatible with Cas12a activity; The sample pretreatment module reagent includes a lysis buffer for rapid lysis and a mini silica membrane purification column for purifying nucleic acids from small-volume samples. The quality control module reagent comprises a target nucleic acid vector for a positive control and a buffer solution for a negative control; The kit is configured to allow for single-tube freezing under ambient temperature transport conditions, storage at room temperature or 4°C, and completion of the detection process from sample to interpretation within ≤30 minutes under constant temperature conditions of 37°C.

2. The rapid detection kit for Leptospira based on CRISPR-Cas12a according to claim 1, characterized in that: The sequences of the dual-target specific primer pair are as follows: Forward primers for pathogenic targets: as shown in SEQ ID NO.1; Downstream primers for pathogenic targets: as shown in SEQ ID NO.2; Forward primers for non-pathogenic targets: as shown in SEQ ID NO.3; Non-pathogenic target downstream primers: as shown in SEQ ID NO.4; The sequence of the bispecific crRNA is as follows: Pathogenic crRNAs targeting the lipL32 gene: as shown in SEQ ID NO.5; Non-pathogenic crRNAs targeting 16S rRNA-specific fragments: as shown in SEQ ID NO.6; The pathogenic primer pair is used to amplify the lipL32 fragment, and the non-pathogenic primer pair is used to amplify the 16S rRNA variant region. The bispecific crRNAs target specific regions of the corresponding amplified fragments.

3. The rapid detection kit for Leptospira based on CRISPR-Cas12a according to claim 1, characterized in that, The reporter molecular system is a dual-channel composite reporter system, comprising: One set of fluorescent reporter molecules and one set of colorimetric reporter molecules are provided. The two types of reports can be used in parallel or individually as needed to achieve dual-mode interpretation of fluorescence quantification and visual measurement.

4. The rapid detection kit for Leptospira based on CRISPR-Cas12a according to claim 1, characterized in that, The amplification module reagents and the CRISPR detection module reagents are pre-packaged in lyophilized form in a single reaction tube or multi-compartment reaction strip, using an integrated formulation. When used, the pretreated sample and reconstitution buffer are added to complete the amplification-CRISPR combined reaction in a single tube.

5. A rapid detection kit for Leptospira based on CRISPR-Cas12a according to claim 1, characterized in that, The rapid lysis buffer contains lysozyme, EDTA, and a nonionic surfactant. The lysis step releases bacterial nucleic acid by incubating at 37°C for about 5-15 minutes. The mini silica membrane nucleic acid purification column is suitable for sample volumes of 20-200 μL and can obtain purified nucleic acid that meets the requirements for subsequent isothermal amplification without the need for phenol-chloroform organic extraction.

6. The rapid detection kit for Leptospira based on CRISPR-Cas12a according to claim 1, characterized in that, The reagents included in the quality control module are: A positive plasmid containing the lipL32 fragment, with a concentration of 1×10⁻⁶. 4 Copies / μL, along with a positive plasmid containing a 16S rRNA-specific fragment, and a negative control containing no target nucleic acid; The positive control sample is used in conjunction with the test reagent to verify the integrity of amplification, Cas12a activity, and the report system.

7. The application of the kit according to any one of claims 1-6 in the detection of Leptospira.

8. The application according to claim 7, characterized in that, The method for detecting Leptospira using the kit includes the following steps: S1. Sample pretreatment: Mix the sample to be tested with the rapid lysis buffer, incubate at 37°C for 5-15 minutes, take the supernatant and purify it through a mini silica membrane nucleic acid purification column to obtain purified nucleic acid; S2. Single-tube amplification-detection experiment: Add the purified nucleic acid to the frozen preparation reaction tube and rehydrate it. Perform isothermal amplification at 37°C for 10-20 minutes to amplify the dual targets simultaneously and initiate the Cas12a-mediated transcleavage reaction. S3. Reading and interpretation: Read the FAM or HEX signal using a handheld fluorescence detector or portable fluorescence module, or directly compare the colorimetric report of the colorimetric report to determine whether leptospires are present and whether they are pathogenic or non-pathogenic. The total detection time is ≤30 minutes, and the kit design allows for a minimum detection limit of 10 copies per reaction volume.

9. A rapid detection kit for Leptospira based on CRISPR-Cas12a according to claim 7, characterized in that, The method further includes: Internal control measures: Add internal amplification control sequences and corresponding primers or probes to the amplification system simultaneously to determine whether there is inhibition or operational error in the event of a negative result; when the IAC signal is abnormal, prompt for retesting or handle according to the QC procedure.

Images