A molecular marker for detecting anti- powdery mildew qtl qpmlaas-4bl and application thereof

Abstract

This invention discloses a method for detecting QTLs of resistance to powdery mildew. QPm.jaas-4BL This invention relates to a molecular marker and its application. The SNP molecular marker comprises the nucleotide sequence shown in SEQ ID NO:1, which contains the SNP site AX-111039690 located at position 151 bp and exhibiting G / C polymorphism. Furthermore, this invention discovered a powdery mildew resistance locus located on the long arm of wheat chromosome 4B through DH population mapping analysis of the wheat hybrids Shanhongmai and Yangmai 15. QPm.jaas-4BL Furthermore, the associated SNP locus AX-111039690 was converted into a PCR marker, which can be used to detect powdery mildew resistance QTLs. QPm.jaas-4BL QPm.jaas-4BL QPm.jaas-4BL QPm.jaas-4BL QPm The genotype was determined and used for molecular breeding to resist powdery mildew.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a molecular marker for detecting the powdery mildew resistance QTL QPm.jaas-4BL and its application. Background Technology

[0002] As a vital food crop globally, wheat is the staple food for approximately 40% of the world's population. In my country, wheat is the second largest food crop after rice, and its yield directly impacts the country's food security. Wheat powdery mildew, an airborne fungal disease caused by *Powdery mildew graminearum*, has occurred extensively in many wheat-growing areas of my country, causing yield losses of up to 20% and seriously threatening wheat production. Wheat resistance to powdery mildew is categorized into vertical resistance and horizontal resistance: vertical resistance is generally controlled by one or a few major genes, exhibiting resistance throughout the entire growth period and exhibiting race-specificity, but is susceptible to loss of resistance due to variations in powdery mildew races; horizontal resistance, also known as "adult resistance," is generally controlled by multiple minor genes, showing susceptibility in the seedling stage but resistance in the adult stage. Years of research have revealed a large number of disease resistance genes / QTLs in wheat and its closely related species. More than 100 powdery mildew resistance genes have been mapped, the vast majority of which are race-specific resistance genes, and a small number are adult-specific resistance genes. Only a small number of genes have been cloned, mostly using methods such as mutant sequencing, map-based cloning, and homologous cloning.

[0003] Most cloned genes possess a coiled-helical nucleotide-leucine repeat sequence structure. Wheat uses this structure to recognize effector factors of powdery mildew and activate an immune response, thereby resisting pathogen infection. Currently, in production, especially in the wheat-growing areas of the middle and lower reaches of the Yangtze River, most disease-resistant varieties contain the Pm21 gene from chromosome 6VS of *Triticum aestivum*, which exhibits strong resistance to almost all powdery mildew strains in Chinese wheat. Breeding disease-resistant varieties is an effective way to reduce powdery mildew damage, but with the rapid evolution of powdery mildew races, many resistance genes have lost their resistance. Therefore, identifying and cloning new powdery mildew resistance genes, developing corresponding molecular-assisted selection markers, and introducing them into main cultivated varieties through backcrossing are of great significance for delaying the loss of existing resistance genes and reducing powdery mildew damage. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for detecting the powdery mildew resistance QTL QPm.jaas-4BL and its application.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] In a first aspect, the present invention seeks to protect a SNP molecular marker associated with resistance to wheat powdery mildew, the SNP molecular marker comprising a nucleotide sequence as shown in SEQ ID NO:1, wherein the nucleotide sequence contains an SNP site AX-111039690 located at 151 bp and exhibiting G / C polymorphism.

[0007] Furthermore, the SNP site AX-111039690 corresponds to base position 422,916,258 on chromosome 4B of the wheat reference genome Chinese SpringRefSeq v1.0 (accession number: GCA_900519105.1).

[0008] Furthermore, the powdery mildew resistance of the tested wheat with the genotype GG at the SNP site AX-111039690 was higher than that of the tested wheat with the genotype CC.

[0009] Secondly, the present invention claims protection for primer pairs for detecting the aforementioned SNP molecular markers, said primer pairs consisting of the upstream primer SSR891F shown in SEQ ID NO:2 and the downstream primer SSR891R shown in SEQ ID NO:3.

[0010] Furthermore, the primer pairs were used to perform PCR amplification of the wheat genomic DNA to be tested:

[0011] If the amplification product contains a 171 bp fragment, then the genotype of the wheat SNP site AX-111039690 to be tested is GG;

[0012] If the amplification product contains a 164 bp fragment, then the genotype of the wheat SNP site AX-111039690 to be tested is CC.

[0013] Thirdly, the present invention claims protection for a kit for detecting wheat powdery mildew resistance, the kit comprising the aforementioned primer pairs.

[0014] Fourthly, this invention claims protection for a method for identifying or assisting in the identification of wheat powdery mildew resistance, comprising the following steps:

[0015] (1) Extract genomic DNA from the wheat to be tested;

[0016] (2) Detect the genotype of the aforementioned SNP locus AX-111039690;

[0017] (3) Determine resistance based on genotype: If the genotype of the SNP site AX-111039690 is GG, the wheat to be tested is determined to be resistant to powdery mildew; if it is CC, the wheat to be tested is determined to be susceptible to powdery mildew.

[0018] Furthermore, the method for detecting the SNP site AX-111039690 in step (2) is selected from:

[0019] (a) Perform PCR amplification using the primer pair, and detect the product length by agarose gel electrophoresis; or

[0020] (b) Sequencing the SNP site AX-111039690 of the nucleotide sequence shown in SEQ ID NO:1; or

[0021] (c) 55K SNP chip analysis.

[0022] Fifthly, the present invention claims protection for a method for breeding wheat resistant to powdery mildew, comprising: detecting the genotype of the SNP locus AX-111039690 during the breeding process, and selecting individuals carrying the G allele and having the genotype GG for subsequent breeding.

[0023] Sixthly, the present invention claims protection for the use of the aforementioned SNP molecular marker or the aforementioned primer pair in any of the following:

[0024] (a) To identify or assist in the identification of wheat powdery mildew resistance;

[0025] (b) Screening or assisted screening of wheat germplasm resources resistant to powdery mildew;

[0026] (c) Prepare products for testing wheat powdery mildew resistance;

[0027] (d) Molecular marker-assisted breeding for wheat resistance to powdery mildew.

[0028] In the technical solution of this invention, the wheat can be any wheat variety.

[0029] The beneficial effects of this invention are:

[0030] This invention, through genetic analysis, discovered the powdery mildew resistance locus QPm.jaas-4BL located on the long arm of wheat chromosome 4B, explaining 10.3% of phenotypic variation. Materials containing the resistance allele showed approximately 83.3% lower powdery mildew disease index under three different environments compared to materials containing the susceptible allele. Furthermore, this invention transformed the associated SNP locus AX-111039690 into the common PCR marker M-4BL-PM, achieving a 98.7% concordance rate in genotyping of 224 materials. This marker can be used to detect the genotype of powdery mildew resistance QTLs and for molecular breeding in powdery mildew resistance. Attached Figure Description

[0031] Figure 1 The difference in powdery mildew disease index among different genotype materials.

[0032] Figure 2 The results of M-4BL-PM amplification of some varieties are shown. Detailed Implementation

[0033] The following examples provide a better understanding of the invention, but do not limit it. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials used were purchased from conventional biochemical reagent stores. Each of the following experiments was performed in triplicate, and the results were averaged.

[0034] Powdery mildew pathogens are a mixture of fungi under natural conditions.

[0035] Test materials: DH population consisting of 224 accessions of Shanhongmai × Yangmai 15.

[0036] Example 1: Discovery of the powdery mildew resistance locus QPm.jaas-4BL and its associated SNP markers

[0037] 1. Identification of powdery mildew resistance

[0038] Material Cultivation: Field trials were conducted at the Wanfu Experimental Base of the Jiangsu Lixiahe Regional Agricultural Science Research Institute from 2021 to 2024. A completely randomized block design was used, with three replicates per year. Each replicate consisted of one family planted in three rows, with rows 1.2 meters long and 0.3 meters wide, and 60 seeds sown per row. Fifteen parents of *Triticum aestivum* and *Triticum yangnanensis* were planted every 50 rows as resistance / susceptibility controls. To ensure sufficient disease development, infected susceptible materials were intercropped in the experimental area as inducing sources of disease.

[0039] Field survey: When the disease severity of the susceptible control Yangmai 15 reaches its maximum, i.e., when powdery mildew begins to appear on the awns of Yangmai 15, a powdery mildew disease severity survey is conducted on this population. The typical timeframe is about 60 days after inoculation. Disease severity is assessed using the "Cobb's Scale" standard, scored based on the proportion of leaf area infected. Asymptomatic cases are recorded as "0", with the highest severity being "100".

[0040] Table 1. Genotypes and resistance to powdery mildew in the DH population

[0041] Number <![CDATA[Powdery mildew severity (%) a > <![CDATA[AX-111039690 genotype b > <![CDATA[M-4BL-PM Detection c > 1 0.00 GG 171bp 2 97.00 CC 164bp 3 0.00 GG 171bp 4 15.33 GG 171bp 5 53.00 CC 164bp 6 0.00 GG 171bp 7 0.00 GG 171bp 8 7.33 GG 171bp 9 97.00 CC 164bp 10 0.00 GG 171bp 11 96.67 CC 164bp 12 12.00 GG 171bp 13 0.00 GG 171bp 14 0.00 GG 171bp 15 0.00 GG 171bp 16 97.33 CC 164bp 17 11.67 GG 171bp 18 96.33 CC 164bp 19 13.00 GG 171bp 20 36.33 GG 171bp 21 0.00 GG 171bp 22 14.00 GG 171bp 23 9.33 GG 171bp 24 57.00 CC 164bp 25 0.00 GG 171bp 26 0.00 GG 171bp 27 12.33 GG 171bp 28 53.33 CC 164bp 29 58.00 CC 164bp 30 0.00 GG 171bp 31 10.00 GG 171bp 32 61.33 CC 164bp 33 12.00 GG 171bp 34 0.00 GG 171bp 35 0.00 GG 171bp 36 63.00 CC 164bp 37 58.00 CC 164bp 38 95.00 CC 164bp 39 0.00 GG 171bp 40 9.00 GG 171bp 41 0.00 GG 171bp 42 0.00 GG 171bp 43 13.33 GG 171bp 44 13.33 GG 171bp 45 0.00 GG 171bp 46 14.33 GG 171bp 47 53.67 CC 164bp 48 95.67 CC 164bp 49 95.67 CC 164bp 50 12.67 GG 171bp 51 11.00 GG 171bp 52 0.00 GG 171bp 53 0.00 GG 171bp 54 8.00 GG 171bp 55 0.00 GG 171bp 56 0.00 GG 171bp 57 0.00 GG 171bp 58 35.00 GG 171bp 59 95.33 CC 164bp 60 63.67 CC 164bp 61 94.00 CC 164bp 62 95.67 CC 164bp 63 53.67 CC 164bp 64 12.00 GG 171bp 65 6.67 GG 171bp 66 0.00 GG 171bp 67 40.33 GG 171bp 68 0.00 GG 171bp 69 0.00 GG 171bp 70 13.67 GG 171bp 71 35.67 GG 171bp 72 96.67 CC 164bp 73 0.00 GG 171bp 74 44.33 CC 164bp 75 42.33 CC 164bp 76 8.33 GG 171bp 77 0.00 GG 171bp 78 99.00 CC 164bp 79 0.00 GG 171bp 80 96.67 CC 164bp 81 12.67 GG 171bp 82 13.00 GG 171bp 83 43.67 CC 164bp 84 65.33 CC 164bp 85 13.33 GG 171bp 86 0.00 GG 171bp 87 37.00 GG 171bp 88 97.33 CC 164bp 89 100.00 CC 164bp 90 0.00 GG 171bp 91 43.00 CC 164bp 92 42.67 CC 164bp 93 60.67 CC 164bp 94 98.33 CC 164bp 95 100.00 CC 164bp 96 0.00 GG 171bp 97 50.67 CC 164bp 98 0.00 GG 171bp 99 12.67 GG 171bp 100 100.00 CC 164bp 101 0.00 GG 171bp 102 97.33 CC 164bp 103 96.00 CC 164bp 104 0.00 GG 171bp 105 12.33 GG 171bp 106 7.33 GG 171bp 107 34.33 GG 171bp 108 12.33 GG 171bp 109 0.00 GG 171bp 110 98.33 CC 164bp 111 0.00 GG 171bp 112 0.00 GG 171bp 113 33.67 GG 171bp 114 94.33 CC 164bp 115 13.00 GG 171bp 116 35.33 GG 171bp 117 96.67 CC 164bp 118 0.00 GG 171bp 119 100.00 CC 164bp 120 100.00 CC 164bp 121 10.00 GG 171bp 122 8.67 GG 171bp 123 35.33 GG 171bp 124 48.00 CC 164bp 125 100.00 CC 164bp 126 34.67 GG 171bp 127 100.00 CC 164bp 128 100.00 CC 164bp 129 13.33 GG 171bp 130 0.00 GG 171bp 131 0.00 GG 171bp 132 0.00 GG 171bp 133 0.00 GG 171bp 134 0.00 GG 171bp 135 6.00 GG 171bp 136 0.00 GG 171bp 137 0.00 GG 171bp 138 0.00 GG 171bp 139 96.67 CC 164bp 140 32.33 GG 171bp 141 0.00 GG 171bp 142 12.33 GG 171bp 143 100.00 CC 164bp 144 38.33 GG 171bp 145 40.67 GG 171bp 146 93.67 CC 164bp 147 24.67 GG 171bp 148 47.67 GG 171bp 149 31.67 GG 171bp 150 29.33 GG 171bp 151 100.00 CC 164bp 152 44.00 GG 171bp 153 0.00 GG 171bp 154 22.33 GG 171bp 155 100.00 CC 164bp 156 0.00 GG 171bp 157 6.00 GG 171bp 158 55.00 CC 164bp 159 11.67 GG 171bp 160 56.33 CC 164bp 161 0.00 GG 171bp 162 55.33 CC 164bp 163 60.67 CC 164bp 164 0.00 GG 171bp 165 0.00 GG 171bp 166 47.00 GG 171bp 167 35.33 GG 171bp 168 98.33 CC 164bp 169 57.33 CC 164bp 170 61.00 CC 164bp 171 32.33 GG 171bp 172 95.33 CC 164bp 173 58.67 CC 164bp 171 97.67 CC 164bp 175 34.33 GG 171bp 176 100.00 CC 164bp 177 93.33 CC 164bp 178 100.00 CC 164bp 179 55.67 CC 164bp 180 100.00 CC 164bp 181 0.00 GG 171bp 182 0.00 GG 171bp 183 0.00 GG 171bp 184 0.00 GG 171bp 185 0.00 GG 171bp 186 97.33 CC 164bp 187 0.00 GG 171bp 188 12.00 GG 171bp 189 61.67 CC 164bp 190 62.33 CC 164bp 191 10.33 GG 171bp 192 0.00 GG 171bp 193 0.00 GG 171bp 194 11.00 GG 171bp 195 65.33 CC 164bp 196 67.33 CC 164bp 197 0.00 GG 171bp 198 10.33 GG 171bp 199 67.33 CC 164bp 200 0.00 GG 171bp 201 0.00 GG 171bp 202 0.00 GG 171bp 203 75.33 CC 164bp 204 75.33 CC 164bp 205 0.00 GG 171bp 206 67.33 CC 164bp 207 0.00 GG 171bp 208 0.00 GG 171bp 209 0.00 GG 171bp 210 0.00 GG 171bp 211 70.33 CC 164bp 212 68.33 CC 164bp 213 67.33 CC 164bp 214 0.00 GG 171bp 215 100.00 CC 164bp 216 100.00 CC 164bp 217 44.33 GG 171bp 218 0.00 GG 171bp 219 48.33 CC 164bp 220 12.67 GG 171bp 221 100.00 CC 164bp 222 8.00 GG 171bp 223 13.33 GG 171bp 224 12.00 GG 171bp

[0042] a This represents the average severity of powdery mildew over 9 repeated trials over 3 years. b 55K SNP chip typing results; c The detection results are for the marker M-4BL-PM.

[0043] 2. Genotype analysis

[0044] Seed samples from the population were sent to Zhongyu Jin Marker (Beijing) Biotechnology Co., Ltd., where a whole-genome scan of the DH population was performed using a wheat 55K SNP chip. QTL detection against powdery mildew was conducted using QTL IciMapping software, with a LOD threshold set to 2.5. R 2 This indicates the percentage of phenotypic variation explained by individual QTLs and interacting QTLs, and analyzes the epistatic interaction effects between QTLs. The specific locations of QTLs on wheat chromosomes are mapped based on the currently published Chinese spring reference genome (https: / / graingenes.org / GG3 / ).

[0045] 3. QPm.jaas-4BL and its linked SNP markers

[0046] The genetic linkage map constructed based on the 55K chip used 9791 polymorphic markers. After removing redundant markers, 2075 markers were retained, belonging to 24 linkage groups, corresponding to 2029 bin loci, with a total length of 4119.515 cM, covering 21 chromosomes (chromosomes 1B, 3B, and 6A were divided into two linkage groups). Combined with 3 years of phenotypic data, a resistance QTL located on the long arm of chromosome 4B was identified and named QPm.jaas-4BL. The representative associated SNP molecular marker included the flanking sequence shown in SEQ ID NO:1, where a G / C polymorphism exists at base position 151, and the SNP locus is named AX-111039690.

[0047] 5'-CATACCATCAATTTTGTACGTGAAACAGTGAAAGGATCTTCGAATGATATAATT TTCTATTTTTATAAAATCTTATCAATAGTCAAAGGAAACCTCGAAGAATACATTAGGCCCTATATATAAGGATGAAGAGAGTAGTATTAATCGCAA[G / C]ACATGCATGCGTGAGGAGTACTACAATAAACAAGAATGTCTTGTCGTAGGTGCTTAACTTGTTGGTGCTAAGCACCCTGCATTTAATGTTTTTGCAACTCCGTGGCCCTCCGTCCTTCGGAGTGTAAATAGTTAAGCCAATGACATGTGG-3' (SEQ ID NO:1). Its physical location on the Chinese Spring reference genome sequence is 423 Mb.

[0048] SNP locus AX-111039690 is located at a physical location of 423Mb on chromosome 4BL, with a polymorphism of G / C. The genotype of this SNP locus is GG or CC.

[0049] After the above SNP locus genotyping and powdery mildew resistance identification, the powdery mildew disease index of the material with the SNP locus genotype GG was 83.3% lower than that of the material with the genotype CC under three environmental conditions (e.g., Figure 1 (As shown).

[0050] Example 2: Design and establishment of a method for M-4BL-PM labeled primers

[0051] 1. Design of genome-specific primers

[0052] Using the flanking sequences of the SNP, homologous sequences were obtained by alignment in the EnsemblPlants database. A 4BL chromosome-specific primer, SSR891, was designed and named the M-4BL-PM marker, which was synthesized by Shanghai Qingke Biotechnology Co., Ltd.

[0053] SSR891F: 5'-CCATCTGCTGCAACGTGTAT-3' (SEQ ID NO: 2)

[0054] SSR891R: 5'-AAAGGAGGGAGTAGGTGTGC-3' (SEQ ID NO: 3)

[0055] 2. Establishment of detection methods

[0056] Test materials: 224 DH populations consisting of Shanhongmai and Yangmai 15.

[0057] PCR amplification: Genomic DNA was extracted from the wheat to be tested, diluted to 30 ng / µl with ddH2O as a template, and PCR amplification was performed using primer pair consisting of primers SSR891F and SSR891R.

[0058] The PCR amplification system described above is shown in Table 2:

[0059] Table 2. PCR system for primer SSR891

[0060] Components Volume (µl) DNA template (30 ng / µl) 2 SNP233F and SNP233R primers (10 µmol / L) 0.5 each <![CDATA[2×PCR Mix (0.1 U / µl Taq enzyme, 500 µmol / L dNTPs, 20 mmol / L Tri-HCl, 10 mmol / L KCl, 10 mmol / L KCl, 3 mmol / L MgCl2)]]> 10 <![CDATA[ddH2O]]> 7 total 20

[0061] PCR program: 95℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 35 cycles, 72℃ for 5 minutes, and store at 4℃.

[0062] The PCR products were detected by 3% agarose gel electrophoresis. If the product was a 171bp fragment, the genotype of the SNP site was GG; if the product was 164bp, the genotype of the SNP site was CC.

[0063] like Figure 2As shown, the larger fragment represents the GG genotype, and the smaller fragment represents the CC genotype. This indicates that the marker can distinguish the SNP locus AX-111039690 genotype and further differentiate the allele of the powdery mildew resistance QTL QPm.jaas-4BL. This marker is named M-4BL-PM. The concordance rate between this marker and the SNP AX-111039690 genotyping results in natural population testing was 99.7%, indicating successful marker transformation.

[0064] Therefore, SNP markers can be used to assist in the detection of whether wheat is resistant to powdery mildew, and can be used for molecular breeding of powdery mildew resistance. The specific methods are at least one of the following ①-③:

[0065] ① Analysis of 55K SNP chip;

[0066] ② Perform PCR analysis using the molecular marker SSR891. If the product is a 171bp fragment, the genotype of the wheat SNP site to be tested is GG; if the product is 164bp, the genotype of the wheat SNP site to be tested is CC.

[0067] ③ Perform PCR using SSR891 and directly sequence the amplified products.

[0068] Example 3: Actual Sample Detection

[0069] Test materials: 113 RIL populations of Yangmai 17 and Yangmai 15

[0070] 1. Identification of powdery mildew resistance

[0071] Same as Example 1.

[0072] 2. M-4BL-PM Marker Detection

[0073] Using the M-4BL-PM label, PCR amplification was performed on 113 lines according to the method in Example 1. If the PCR product was a 171bp fragment (as shown in SEQ ID NO:4), the genotype of the wheat SNP site to be tested was GG; if the product was 164bp (as shown in SEQ ID NO:5), the genotype of the wheat SNP site to be tested was CC.

[0074] The results of marker testing for 113 wheat varieties and the average severity of powdery mildew are shown in Table 3. Statistical analysis of the results yielded the results in Table 4.

[0075] Table 3. Powdery mildew severity and genotype of Yangmai 17 × Yangmai 15 recombinant inbred lines

[0076] serial number Powdery mildew severity (%) <![CDATA[M-4BL-PM Detection c > 3081 24.57% 171bp 3082 27.78% 171bp 3083 31.36% 171bp 3084 29.55% 171bp 3085 54.71% 164bp 3086 41.96% 171bp 3087 36.60% 171bp 3088 39.47% 171bp 3089 45.08% 171bp 3090 44.12% 171bp 3091 42.22% 171bp 3092 64.29% 164bp 3093 70.83% 164bp 3094 42.50% 171bp 3095 76.00% 164bp 3096 41.50% 171bp 3097 65.45% 164bp 3098 62.13% 164bp 3099 37.89% 171bp 3100 39.57% 171bp 3101 30.00% 171bp 3102 42.35% 164bp 3103 47.50% 164bp 3104 51.20% 164bp 3105 24.21% 171bp 3106 70.00% 164bp 3107 59.09% 164bp 3108 36.33% 171bp 3109 51.43% 164bp 3110 69.23% 164bp 3111 54.38% 164bp 3112 70.29% 164bp 3113 54.89% 164bp 3114 66.67% 164bp 3115 71.16% 164bp 3116 52.63% 164bp 3117 79.20% 164bp 3118 62.93% 164bp 3119 29.27% 171bp 3120 32.90% 171bp 3121 66.09% 164bp 3122 54.17% 164bp 3123 46.67% 164bp 3124 48.72% 164bp 3125 80.00% 164bp 3126 54.40% 164bp 3127 40.91% 164bp 3128 54.15% 164bp 3129 67.33% 164bp 3130 60.61% 164bp 3131 63.64% 164bp 3132 63.03% 164bp 3133 46.49% 164bp 3134 66.67% 164bp 3135 52.00% 164bp 3136 79.26% 164bp 3137 80.00% 164bp 3138 38.05% 164bp 3139 70.81% 164bp 3140 53.47% 164bp 3141 72.17% 164bp 3142 68.00% 164bp 3143 64.17% 164bp 3144 38.13% 171bp 3145 40.00% 171bp 3146 34.12% 171bp 3147 47.59% 164bp 3148 30.19% 171bp 3149 36.50% 171bp 3150 27.14% 171bp 3151 25.33% 171bp 3152 73.79% 164bp 3153 29.37% 171bp 3154 32.63% 171bp 3155 59.05% 164bp 3156 34.29% 171bp 3157 50.67% 164bp 3158 26.36% 171bp 3159 55.50% 164bp 3160 43.48% 164bp 3161 29.17% 171bp 3162 54.04% 164bp 3163 44.44% 171bp 3164 32.44% 171bp 3165 33.06% 171bp 3166 25.45% 171bp 3167 43.81% 171bp 3168 39.95% 164bp 3169 38.27% 164bp 3170 35.91% 164bp 3171 49.87% 164bp 3172 53.94% 164bp 3173 42.97% 164bp 3171 39.54% 171bp 3175 40.98% 171bp 3176 49.05% 171bp 3177 34.92% 171bp 3178 51.56% 164bp 3179 48.11% 171bp 3180 44.84% 171bp 3181 35.70% 171bp 3182 48.75% 171bp 3183 31.32% 171bp 3184 42.50% 171bp 3185 34.27% 171bp 3186 49.28% 171bp 3187 47.13% 171bp 3188 40.23% 171bp 3189 44.40% 171bp 3190 57.53% 164bp 3191 61.04% 164bp 3192 45.14% 171bp 3193 49.86% 164bp

[0077] Table 4. Differences in powdery mildew resistance among different genotypes of M-4BL-PM varieties.

[0078] M-4BL-PM genotype Number of varieties Powdery mildew severity (%) 171bp 53 36.84 164bp 60 58.23

[0079] As can be seen from the above, wheat with the SNP locus AX-111039690 and the GG genotype has higher or higher powdery mildew resistance than wheat with the SNP locus AX-111039690 and the CC genotype.

[0080] sequence list

[0081] SEQ ID NO:1:

[0082] CATACCATCAATTTTGTACGTGAAACAGTGAAAGGATCTTCGAATGATATAATT TTCTATTTTTATAAAATCTTATCAATAGTCAAAGGAAACCTCGAAGAATACATTAGGCCCTATATATAAGGATGAAGAGAGTAGTATTAATCGCAA[G / C]ACATGCATGCGTGAGGAGTACTACA ATAAACAAGAATGTCTTGTCGTAGGTGCTTAACTTGTTGGTGCTAAGCACCCTGCATTTAATGTTTTTGCAACTCCGTGGCCCTCCGTCCTTCGGAGTGTAAATAGTTAAGCCAATGACATGTGG.

[0083] SEQ ID NO:2:5'-CCATCTGCTGCAACGTGTAT-3'

[0084] SEQ ID NO:3:5'-AAAGGAGGGAGTAGGTGTGC-3'

[0085] SEQ ID NO:4 (171bp product sequence): CCATCTGCTGCAACGTGTATTGTCACTTCACTGACTAGGTGAATAAAAGTAGTTCTCTTTGACCGAGATGGGGAATAATGGATCGCCAAGACTTCCTATCTACAGTATGCCTCTACTCTCATCCTGTCCAACAACAAGAACCATTGGCCAAGGCACACCTACTCCCTCCTTT

[0086] SEQ ID NO:5 (164bp product sequence):

[0087] CCATCTGCTGCAACGTGTATTGTCACTTCACTGACTAGGTGAATAAAGTAGTTCTCTTTGACCGAGATGGGGAATAATGGATCGCCAAGACTTACAGTATGCCTCTACTCTCATCCTGTCCAACAACAAGAACCATTGGCCAAGGCACACCTACTCCCTCCTTT。

Claims

1. A SNP molecular marker associated with resistance to wheat powdery mildew, characterized in that, The SNP molecular marker contains a nucleotide sequence as shown in SEQ ID NO:1, which contains the SNP site AX-111039690 located at 151 bp and exhibits G / C polymorphism.

2. The SNP molecular marker of claim 1, wherein, The SNP site AX-111039690 corresponds to base position 422,916,258 on chromosome 4B of the wheat reference genome Chinese Spring RefSeq v1.

0.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, The powdery mildew resistance of the tested wheat with the genotype GG at the SNP locus AX-111039690 was higher than that of the tested wheat with the genotype CC.

4. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The primer pair consists of the upstream primer SSR891F shown in SEQ ID NO:2 and the downstream primer SSR891R shown in SEQ ID NO:

3.

5. The primer pair according to claim 4, characterized in that, The primer pairs were used to perform PCR amplification of the wheat genomic DNA to be tested: If the amplification product contains a 171 bp fragment, then the genotype of the wheat SNP site AX-111039690 to be tested is GG; If the amplification product contains a 164 bp fragment, then the genotype of the wheat SNP site AX-111039690 to be tested is CC.

6. A kit for detecting resistance to wheat powdery mildew, characterized by, It contains the primer pair as described in claim 4 or 5.

7. A method of identifying or assisting in the identification of resistance to powdery mildew in wheat, characterised in that, Includes the following steps: (1) Extract genomic DNA from the wheat to be tested; (2) Detect the genotype of the SNP locus AX-111039690 described in claim 1; (3) Determine resistance based on genotype: If the genotype of the SNP site AX-111039690 is GG, the wheat to be tested is determined to be resistant to powdery mildew; if it is CC, the wheat to be tested is determined to be susceptible to powdery mildew.

8. The method according to claim 7, characterized in that, The method for detecting the SNP site AX-111039690 in step (2) is selected from: (a) Perform PCR amplification using the primer pair described in claim 4, and detect the product length by agarose gel electrophoresis; or (b) Sequencing the SNP site AX-111039690 of the nucleotide sequence shown in SEQ ID NO:1; or (c) 55K SNP chip analysis.

9. A method for breeding wheat resistant to powdery mildew, characterized in that, include: During the breeding process, the genotype of the SNP locus AX-111039690 described in claim 1 is detected, and individuals carrying the G allele and with the genotype GG are selected for subsequent breeding.

10. The use of the SNP molecular marker of claim 1 or the primer pair of claim 4 in any of the following: (a) To identify or assist in the identification of wheat powdery mildew resistance; (b) Screening or assisted screening of wheat germplasm resources resistant to powdery mildew; (c) Prepare products for testing wheat powdery mildew resistance; (d) Molecular marker-assisted breeding for wheat resistance to powdery mildew.

Images