A SNP site related to the oil content of camellia oleifera abel seed and application thereof

CN122279074APending Publication Date: 2026-06-26RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
Filing Date
2026-03-13
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently screening high-oil-content germplasm resources in Hainan camellia oleifera breeding. Traditional methods rely on field analysis, which is inefficient.

Method used

By screening the whole genome of Camellia oleifera in Hainan, we identified SNP loci (located at position 61836543 on chromosome 7, with a polymorphism of G/T) that are highly associated with the oil content of the kernel, and developed corresponding molecular markers and primer pairs for assisted selection breeding.

Benefits of technology

It enables accurate and rapid detection of the oil content trait in the kernels of Hainan Camellia oleifera, allowing for the identification of individuals with high oil content during the breeding process and significantly accelerating the selection and breeding of high-oil varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention relates to the field of plant breeding technology, and more particularly to a SNP locus related to the kernel oil content trait of *Camellia oleifera* var. *hainanensis* and its application. The SNP locus is located at position 61836543 on chromosome 7, with a polymorphism of G / T. The application includes: detecting the polymorphism of the SNP locus in a *Camellia oleifera* var. *hainanensis* sample; determining the kernel oil content of the sample based on genotype detection results; if the genotype detection result is TT, the sample is identified as having a high kernel oil content; if the genotype detection result is GG, the sample is identified as a candidate for high oil content; and if the genotype detection result is GT, the sample is identified as having a low oil content. This invention has screened and obtained an SNP locus that can be used to breed *Camellia oleifera* var. *hainanensis* varieties with high kernel oil content, and has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to a SNP site related to the oil content trait of the kernel of Camellia oleifera in Hainan and its application. Background Technology

[0002] Hainan camellia oil ( Camellia hainanica ), also known as mountain pomelo, belongs to the genus Camellia in the family Theaceae. Camellia Camellia oleifera (L.) is a perennial woody oil-bearing tree species endemic to tropical regions. Compared to common Camellia oleifera, Hainan Camellia oleifera not only has larger fruits and a more intense aroma of tea oil, but also exhibits higher economic value for food and medicinal purposes. Furthermore, as a typical cross-pollinated plant, driven by both genetic mechanisms and environmental factors, the germplasm resources of Hainan Camellia oleifera demonstrate rich and unique variations.

[0003] Kernel oil content is one of the key indicators for evaluating the quality of Camellia oleifera seeds. In the breeding practice of superior Camellia oleifera varieties in Hainan, traditional methods often rely on phenotypic analysis of massive amounts of Camellia oleifera seed samples. In recent years, with the continuous development of Camellia oleifera genetic breeding, multiple Camellia oleifera genome sequencing and mapping projects have been completed, and significant progress has been made in analyzing the mechanisms of seed oil synthesis and accumulation. Based on the above research foundation, in-depth exploration and screening of molecular markers that can be used for early identification of high-oil-content germplasm, and the construction of a corresponding detection system, have become an effective way to accelerate the breeding process of high-oil-content varieties.

[0004] Compared with traditional breeding methods, molecular marker-assisted selection (MMR) technology can significantly shorten the breeding cycle, an advantage that is particularly prominent in the breeding of economic forests where fruit is the main harvest. Given that precise and efficient molecular markers are the prerequisite and core of MMR-assisted breeding, actively developing molecular markers closely related to the oil content of Camellia oleifera kernels in Hainan is of great practical significance for advancing MMR-assisted breeding for high-oil yields in Hainan Camellia oleifera and for achieving genetic improvement of its germplasm resources. Summary of the Invention

[0005] To address the technical problems existing in the prior art, this invention provides an SNP site related to the oil content trait of Camellia oleifera kernels and its application.

[0006] Camellia oleifera of Hainan is a typical outcrossing species, and linkage disequilibrium (LD) usually decreases rapidly within a small range. This invention conducts LD mapping for important traits. Under the premise of having a natural population of Camellia oleifera of Hainan that has produced a large number of obvious genetic variations, the whole genome of Camellia oleifera of Hainan is used as a marker to develop regions. SNP loci related to its kernel oil content are screened and corresponding molecular markers are developed.

[0007] In a first aspect, the present invention provides a SNP site based on the genome version Changlin 40 V1.0, wherein the SNP site is located at position 61836543 on chromosome 7 and has a polymorphism of G / T.

[0008] This invention developed a SNP locus highly associated with the oil content of Camellia oleifera kernels in Hainan, which can explain 4.88% of the variance in the oil content phenotype. Using this marker, auxiliary selection was performed on a sexually occurring Camellia oleifera population. The results showed that among individuals with the high oil content genotype at this locus, 100% of the individuals had an oil content in their kernels higher than the population average; among individuals with the candidate high oil content genotype at this marker, 62.58% of the individuals had an oil content in their kernels higher than the population average; and among individuals with the low oil content genotype, only 10.71% of the individuals had an oil content in their kernels higher than the population average. This indicates that this SNP locus can be used to breed Camellia oleifera varieties with high kernel oil content in Hainan.

[0009] Secondly, the present invention provides a molecular marker comprising a nucleotide sequence as shown in SEQ ID NO.1, wherein the 123rd position exhibits a polymorphism of G / T.

[0010] The nucleotide sequence shown in SEQ ID NO.1: CTCCCAAAGGGGAAGACACACACAACATATAAGGCAAGTTTTCTTCAGTTCTATCTAAATTAGGAGCGAATAATTTTGACACAAAAGAGTGAGTGGAGCCAGAATCAAACAATACATGAGCAGAATGGCCTTGAACAATAAATGTACCTG ACACTACTGTAGCTTCATTCTGTACATCTCCTGGAACCAATGCGAACACCCTACCTTGCTTTTTAGTATCTTTATTTGAAGGTTTAGCAGCTGCCTTTGTGTTGGGGGTTGGTGTAGACCCCGCAGAACTTGTAGCAGTCCTAGCGC.

[0011] Thirdly, the present invention provides primer pairs for amplifying the aforementioned SNP sites or the aforementioned molecular markers.

[0012] The primer pair design method described in this invention can be a conventional method of this invention. Technicians can design primer pairs (including primer pairs or KASP primer combinations) of different lengths based on existing primer design rules and primer design software (such as Primer) to amplify the aforementioned molecular markers.

[0013] Furthermore, the primer pairs include primers as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] The nucleotide sequence shown in SEQ ID NO.2: CTCCCAAAGGGGAAGACACACAC.

[0015] The nucleotide sequence shown in SEQ ID NO.3: CTACACCAACCCCCAACACAAA.

[0016] Furthermore, the primer pair described in this invention carries a fluorescent tag, which may be one or more of the following: FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC, or Texas Red.

[0017] For example, GAAGGTGACCAAGTTCATGCT (FAM fluorescent tag sequence), GAAGGTCGGAGTCAACGGATT (HEX fluorescent tag sequence).

[0018] Fourthly, the present invention provides a kit comprising the aforementioned molecular markers or the aforementioned primer pairs.

[0019] Fifthly, the present invention provides the application of the aforementioned SNP sites as targets in any of the following: (1) Predict or detect the oil content of the kernels of Camellia oleifera in Hainan; (2) Identify or cultivate Hainan camellia varieties with high kernel oil content; (3) Molecular marker-assisted breeding of Camellia oleifera in Hainan; (4) Improvement of Hainan Camellia oleifera varieties related to kernel oil content; (5) Germplasm resource improvement of Hainan Camellia oleifera.

[0020] In a sixth aspect, the present invention provides the use of the aforementioned molecular markers, or the aforementioned primer pairs, or the aforementioned kits in any of the following: (1) Predict or detect the oil content of the kernels of Camellia oleifera in Hainan, or prepare reagents for predicting or detecting the oil content of the kernels of Camellia oleifera in Hainan; (2) To identify or cultivate Hainan Camellia oleifera varieties with high kernel oil content, or to prepare reagents for identifying or cultivating Hainan Camellia oleifera varieties with high kernel oil content; (3) Molecular marker-assisted breeding of Camellia oleifera in Hainan; (4) Improvement of Hainan Camellia oleifera varieties related to kernel oil content; (5) Germplasm resource improvement of Hainan Camellia oleifera.

[0021] Seventhly, the present invention provides a method for detecting the oil content of the kernels of Hainan camellia, comprising: The Hainan Camellia oleifera samples to be tested were examined for SNP sites or molecular marker polymorphisms as described above; the kernel oil content of the Hainan Camellia oleifera samples to be tested was determined based on the genotype test results.

[0022] Furthermore, the detection method includes one or more of the following: PCR amplification, probe hybridization, gene chip, gene sequencing, or mass spectrometry.

[0023] Further, the PCR amplification includes: (1) Extract genomic DNA from the Hainan camellia oil sample to be tested; (2) Using genomic DNA as a template, perform PCR amplification using the primer pairs described above; (3) Analyze the genotypes of the SNP sites in the PCR amplification products as described above, and determine the oil content of the kernels of the Hainan camellia oil sample to be tested based on the genotype detection results.

[0024] Furthermore, the PCR amplification reaction procedure includes: 94~95℃, 3~5min; 94~95℃, 15~30s, 65~69℃, 40~60s, 38~45 cycles; 67~70℃, 3~6min.

[0025] Preferred methods include: 95°C, 3 min, 1 cycle for pre-denaturation; 95°C, 15 s for denaturation, 68°C, 45 s for extension, 40 cycles; 68°C, 5 min, 1 cycle for complete extension.

[0026] Furthermore, after the PCR amplification, the obtained PCR products were detected and recovered by agarose gel electrophoresis.

[0027] Preferably, in the agarose gel electrophoresis, the concentration of agarose gel is 1%-2%.

[0028] Furthermore, the determination of the kernel oil content of the Hainan camellia oleifera sample based on the genotype detection results includes: If the genotype test result is TT, the Hainan camellia oil sample to be tested is identified as having a high kernel oil content; if the genotype test result is GG, the Hainan camellia oil sample to be tested is identified as a candidate for high kernel oil content; if the genotype test result is GT, the Hainan camellia oil sample to be tested is identified as having a low kernel oil content.

[0029] Furthermore, the Hainan Camellia oleifera samples identified by this invention can be any breeding material, including individuals from natural populations and individuals from sexually occurring populations.

[0030] The present invention has the following beneficial effects: This invention provides a SNP locus related to the kernel oil content of Camellia oleifera in Hainan. By detecting the polymorphism of this SNP locus, the kernel oil content trait of Camellia oleifera in Hainan can be detected. The SNP locus provided by this invention can be used to accurately and rapidly identify the kernel oil content trait of offspring during the breeding process, and to cultivate Camellia oleifera varieties with high kernel oil content in Hainan, which has important application value. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0032] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0033] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0034] The 189 clones of natural population materials used in the following examples were all collected and evaluated by the Camellia oleifera team of the Coconut Research Institute of the Chinese Academy of Tropical Agricultural Sciences and are preserved in the Hainan Wenchang Germplasm Resource Nursery of the Coconut Research Institute.

[0035] Example 1: Construction and trait determination of a segregating population of oil content in the kernels of Camellia oleifera from Hainan. In this embodiment, 189 natural populations of camellia oleifera germplasm resources from a collection garden were used, with their origins covering the entire Hainan province. Seeds were collected from all 189 individuals after the fruits were fully mature (5% of the fruits had split open), and the oil content of the kernels was determined using Soxhlet extraction. The operational steps are as follows: (1) Prepare medium-speed filter paper packs and place them in an aluminum box. Dry them at 105°C until constant weight is achieved. Record the weight of the aluminum box and the filter paper packs. W 1 ).

[0036] (2) Remove the hard seed coat from an appropriate amount of Hainan camellia seeds, dry them at 105℃ to constant weight, crush them with a pulverizer, pack them into a filter paper bag and wrap them up, and record the total mass of the aluminum box, filter paper bag and sample. W 2 ).

[0037] (3) Using a Swiss Buchi Soxhlet extractor B-811LSV, the weighed sample filter paper package was placed in an extraction flask, and about 100 ml of petroleum ether was added. Extraction was carried out for 6 hours, and the petroleum ether was recovered. The filter paper package (containing residue) was placed in an aluminum box and dried at 105°C until constant weight was achieved. The weights of the aluminum box, filter paper package, and residue were recorded. W 3 ).

[0038] Kernel oil content = [( W 2 - W 3 ) / ( W 2 - W 1 )]×100% The results of the oil content determination of Camellia oleifera seeds from Hainan showed that the oil content of the seeds in the natural population exhibited a normal distribution, indicating that this trait has quantitative characteristics.

[0039] Example 2: Simplified Genome Sequencing and Polymorphic Site Identification 1. Genomic DNA extraction from young leaves of 189 Hainan Camellia oleifera clones: Total genomic DNA was extracted from young leaves of each clone using the TaKaRa MiniBEST Plant Genomic DNA Extraction Kit (TaKaRa, Dalian, China).

[0040] 2. Simplified genome sequencing: Total DNA from each sample was tested for purity and concentration to ensure an OD260 / 280 ratio between 1.8 and 2.0, with no significant degradation. The DNA concentration was adjusted to 50-100 ng / μL. Genomic DNA was digested with restriction endonucleases PstI and MspI. After ligating barcode sequences and sequencing primer adapters, the ligation products from each sample were mixed in equimolar ratios to form two pooled samples. After PCR amplification to enrich the target fragment, the PCR products were purified using magnetic beads to remove impurities such as primers, dNTPs, and polymerase. Target fragments of 250-550 bp were screened using agarose gel electrophoresis to construct a simplified genome sequencing library. The constructed library was then analyzed using Illumina HiSeq. TM 4000 platform sequencing.

[0041] 3. Polymorphic site identification: To ensure data quality, the clean reads obtained after initial filtering are further filtered more rigorously to obtain high-quality clean reads for subsequent information analysis. The filtering steps are as follows: (1) Remove reads containing connectors; (2) Remove reads that are all A bases; (3) Remove reads containing more than 10% N; (4) Remove low-quality reads (the number of bases with a quality value of Q≤20 accounts for more than 50% of the total reads).

[0042] Tophat v2.1.1 software was used to align high-quality reads from each sample to the hexaploid reference genome sequence. Unaligned sequences were removed, and the remaining sequences were used to identify SNP sites using bcftools v1.9 software. The identified SNP sites underwent rigorous filtering to obtain high-quality SNP data. The filtering criteria are as follows: (1) There are only 2 alleles at the locus; (2) Genotype deletion rate ≤ 20%; (3) Minimum allele frequency (MAF) ≥ 5%; (4) SNP quality value ≥ 100; (5) The number of homozygous genotype samples is greater than 10; (6) The heterozygous genotype sample rate is ≤70%.

[0043] Example 3: Screening of SNP sites related to oil content in Hainan Camellia oleifera kernels 1. Group structure analysis: Principal component analysis (PCA) was performed on the natural population of Camellia oleifera in Hainan using GCTA v1.25.2 software. The first 10 principal components (PCs) were used as fixed effects for subsequent association analysis (Table 1).

[0044] Table 1. Top 10 PC values ​​of 189 individuals in the natural population

[0045] 2. Association Analysis: All SNP locus data, top 10 PC values, phenotypic data (see Example 1), and Kinship matrix data were imported into IIIVmrMLM software. MLM analysis was used to analyze the linkage disequilibrium between SNPs and kernel oil content. Molecular markers significantly associated with kernel oil content were screened. After multiple validation corrections, one locus with a highly significant association with kernel oil content was detected. P <10 -5 (Table 2) This locus is located in the intergenic region of chromosome 7 and contributes 4.88% to the difference in oil content (Table 2).

[0046] Table 2 SNP molecular marker information

[0047] Example 4: Application of the molecular markers of the present invention in high-oil-content breeding of Camellia oleifera in Hainan This invention further applies the aforementioned molecular markers to the breeding of Camellia oleifera in Hainan, including the following process: (1) Select a Hainan Camellia oleifera hybrid F1 generation family as material (maternal parent is 'Reyan 2', paternal parent is 'HN88'), collect young leaves to extract total DNA (see Example 2).

[0048] (2) Genomic DNA was amplified by PCR using the primer pairs shown in SEQ ID NO.2-3. The reaction system is shown in Table 3. Table 3 PCR reaction system

[0049] The PCR amplification procedure is as follows: Table 4 PCR Amplification Program

[0050] (3) PCR amplification products were subjected to gel detection, purification, recovery, sequencing, and genotyping. Gel detection and purification were performed according to the instructions of the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50). DNA was recovered from the gel, and the corresponding amplification primers were used as sequencing primers. The nucleotide sequence of the amplification products was determined by Sanger sequencing, and the genotype of each SNP site on the sequencing peak map was interpreted using Chromas software.

[0051] (4) Identify the genotype of the Chr07_61836543 locus in all individuals. Compare the relationship between the genotype of this locus and the oil content. If the genotype is T / T, the individual is a high-oil-content Camellia oleifera; if the genotype is G / G, the individual is a candidate for high-oil-content Camellia oleifera; if the genotype is G / T, the individual is a low-oil-content Camellia oleifera.

[0052] (5) Collect fully mature seeds from all F1 generation individuals and determine the oil content of their kernels (see Example 1).

[0053] The results (Table 5) showed that among the individual plants (TT) with the high oil content genotype at the Chr07_61836543 locus, 100% of the individuals had a higher kernel oil content than the average kernel oil content of the population (47.57%).

[0054] Among the individuals with the candidate high oil content genotype (GG), 62.58% of the individuals had an oil content in their kernels that was higher than the population average (47.57%).

[0055] Among individuals with the low oil content genotype (GT), only 10.71% of the individuals had an oil content in their kernels that was higher than the population average.

[0056] The results above indicate that the SNP loci provided by this invention can be used to identify the oil content of the kernels of Camellia oleifera in Hainan, and then applied to assisted breeding. By selecting the high oil content genotype (TT) in the offspring, the breeding of Camellia oleifera varieties with high kernel oil content can be accelerated.

[0057] Table 5. Kernel oil content and genotype data of F1 individual plants

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP site, characterized in that, Based on the genome version Changlin 40 V1.0, the SNP site is located at position 61836543 on chromosome 7, with a polymorphism of G / T.

2. A molecular marker characterized in that, The molecular marker includes a nucleotide sequence as shown in SEQ ID NO.1, with a polymorphism at position 123, which is G / T.

3. A pair of primers, characterized in that, The primer pair is used to amplify the SNP site of claim 1 or the molecular marker of claim 2.

4. The primer pair according to claim 3, characterized in that, The primer pairs include primers as shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. A kit characterized in that, Includes the molecular marker described in claim 2, or the primer pair described in claim 3 or 4.

6. The application of the SNP site of claim 1 as a target in any of the following: (1) Predict or detect the oil content of the kernels of Camellia oleifera in Hainan; (2) Identify or cultivate Hainan camellia varieties with high kernel oil content; (3) Molecular marker-assisted breeding of Camellia oleifera in Hainan; (4) Improvement of Hainan Camellia oleifera varieties related to kernel oil content; (5) Germplasm resource improvement of Hainan Camellia oleifera.

7. The use of the molecular marker of claim 2, or the primer pair of claim 3 or 4, or the kit of claim 5, in any of the following: (1) Predict or detect the oil content of the kernels of Camellia oleifera in Hainan, or prepare reagents for predicting or detecting the oil content of the kernels of Camellia oleifera in Hainan; (2) To identify or cultivate Hainan Camellia oleifera varieties with high kernel oil content, or to prepare reagents for identifying or cultivating Hainan Camellia oleifera varieties with high kernel oil content; (3) Molecular marker-assisted breeding of Camellia oleifera in Hainan; (4) Improvement of Hainan Camellia oleifera varieties related to kernel oil content; (5) Germplasm resource improvement of Hainan Camellia oleifera.

8. A method for detecting the seed kernel oil content trait of Camellia reticulata, characterized in that, include: The polymorphism of the SNP site as described in claim 1 or the molecular marker as described in claim 2 is detected in the Hainan camellia oil sample to be tested; The oil content of the kernels of the Hainan camellia oleifera samples to be tested was determined based on the genotype test results.

9. The method of claim 8, wherein, The detection methods include one or more of the following: PCR amplification, probe hybridization, gene chip, gene sequencing, or mass spectrometry.

10. The method according to claim 8 or 9, characterized in that, The determination of the kernel oil content of the Hainan camellia oleifera sample based on the genotype detection results includes: If the genotype test result is TT, the Hainan camellia oil sample to be tested is identified as having a high kernel oil content; if the genotype test result is GG, the Hainan camellia oil sample to be tested is identified as a candidate for high kernel oil content; if the genotype test result is GT, the Hainan camellia oil sample to be tested is identified as having a low kernel oil content.