Application of succinate compounds with PRL2 enzyme activity inhibition and targeted degradation functions in the preparation of antitumor drugs
By screening Blestriarene C from the traditional Chinese medicine Bletilla striata as a PRL2-targeting molecular gel, the dual functions of inhibiting enzyme activity and targeting degradation of the PRL2 target were achieved. This solves the problems of target lack and low drug efficiency in the treatment of ovarian cancer in the existing technology, and provides a simple and efficient anti-ovarian cancer treatment plan.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE
- Filing Date
- 2026-06-01
- Publication Date
- 2026-06-30
AI Technical Summary
Current treatments for ovarian cancer lack effective targets, PRL2-targeting degradation agents have not been successfully introduced into clinical practice, and traditional PRL2 inhibitors have drawbacks such as large molecular weight, poor tissue specificity, and easy drug resistance. Molecular glue technology faces bottlenecks such as a limited variety of E3 ligases and a lack of systematic discovery strategies.
Blestriarene C was screened and identified from the traditional Chinese medicine Bletilla striata as a potential PRL2-targeting molecular gel. By inducing or stabilizing the protein-protein interaction between the target protein and E3 ubiquitin ligase, a ternary complex is formed and the target protein is degraded, thus achieving the dual functions of PRL2 enzyme activity inhibition and targeted degradation.
Overcoming the shortcomings of traditional PROTACs, such as large molecular weight and poor membrane permeability, this study provides a simple PRL2-targeting drug option, achieving dual functional regulation of the PRL2 target, significantly inhibiting the proliferation and migration of ovarian cancer cells, and exhibiting highly efficient and low-toxicity anti-ovarian cancer activity in in vivo and in vitro models.
Smart Images

Figure CN122297447A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of zirconia compounds with PRL2 enzyme activity inhibition and targeted degradation functions in the preparation of antitumor drugs. Background Technology
[0002] Ovarian cancer is the leading cause of death among malignant tumors of the female reproductive system. Due to the lack of effective early screening methods, most patients are diagnosed at an advanced stage, with a five-year survival rate of less than 50%. Although surgery combined with platinum-based chemotherapy is the standard treatment, chemotherapy resistance and tumor recurrence remain major clinical challenges. Therefore, the development of novel targeted therapies is of significant clinical need.
[0003] PRL2, a member of the protein tyrosine phosphatase family, is abnormally overexpressed in various malignant tumors, particularly showing significant upregulation in ovarian cancer. PRL2 promotes tumor progression by regulating biological processes such as cell proliferation, migration, and invasion, and its expression level is negatively correlated with patient prognosis, suggesting that PRL2 is a potential therapeutic target for ovarian cancer. Current intervention strategies targeting PRL2 mainly focus on traditional small-molecule enzyme activity inhibitors, such as thienopyridone compounds and molecules like JMS-053. However, these inhibitors face multiple translational bottlenecks: the flat, hydrophobic structure of the PRL2 enzyme active site makes the development of high-affinity inhibitors difficult; inhibitors need to continuously occupy the enzyme active site to maintain efficacy, requiring stringent pharmacokinetic properties; long-term inhibition may trigger compensatory pathway activation or target mutations, leading to acquired resistance; furthermore, some inhibitors have shown potential off-target toxicity in animal models, limiting their clinical application prospects.
[0004] In recent years, the rise of protein-targeted degradation technology has provided new insights into overcoming the limitations of traditional inhibitors. This technology utilizes the cell's inherent ubiquitin-proteasome system to selectively eliminate pathogenic proteins, simultaneously eliminating both the enzymatic catalytic function and the non-enzyme-dependent scaffold function of the target protein, and also holds promise for circumventing drug resistance caused by target mutations. Protein-targeted chimeric technology is a representative strategy, which uses bifunctional molecules to simultaneously bind to the target protein and E3 ubiquitin ligase, forming a ternary complex and mediating the ubiquitination and degradation of the target protein. Although this technology has made progress on some targets, its molecular weight typically exceeds 800 Daltons, leading to poor cell membrane permeability and oral bioavailability; at high concentrations, it easily forms inactive binary complexes, producing a hook effect; dependence on specific E3 ligases may result in uneven degradation efficiency due to differences in tissue expression; furthermore, mutations or downregulation of E3 ligases may induce drug resistance. These inherent drawbacks have prompted researchers to explore simpler and more efficient targeted degradation strategies.
[0005] Molecular glues are a class of compounds with small molecular weights and relatively simple structures, and their mechanism of action differs from the bifunctional molecular design of protein-targeting chimeras. Molecular glues mediate the degradation of target proteins by inducing or stabilizing protein-protein interactions between target proteins and E3 ubiquitin ligases, forming ternary complexes. Due to their generally better drug-like properties and simpler mechanisms of action, molecular glues have attracted widespread attention in recent years. However, currently reported molecular glue degraders are mostly concentrated on a few E3 ligases such as CRBN, and most were obtained through accidental discovery or high-throughput screening, lacking systematic and rational design strategies. Discovering novel molecular glues from natural products, especially those targeting specific sites with well-defined mechanisms of action, remains a significant challenge in this field.
[0006] Natural products, due to their structural diversity and rich biological activities, have long been an important source for drug discovery. Traditional Chinese medicine (TCM), as a significant treasure trove of natural products, contains a large number of structurally unique active ingredients; however, research combining these ingredients with modern targeted protein degradation technologies is still in its early stages. How to systematically screen active ingredients with targeted protein degradation functions from TCM and elucidate their molecular mechanisms of action are pressing technical problems that need to be solved.
[0007] In summary, ovarian cancer lacks effective therapeutic targets and drugs. While PRL2 is a potential target for ovarian cancer, no successful targeted degradation agents have yet entered clinical trials. Existing protein-targeted degradation technologies suffer from drawbacks such as large molecular weight (typically >800 Da), poor tissue specificity, and susceptibility to drug resistance. Although molecular gel technology has advantages, it faces bottlenecks due to the limited variety of E3 ligases and a lack of systematic discovery strategies. Therefore, developing novel PRL2-targeted degradation strategies, especially discovering molecular gels with unique mechanisms of action from natural products, is of great significance for the precision treatment of ovarian cancer. Summary of the Invention
[0008] To address the problems existing in the prior art, the present invention aims to provide the application of succinate compounds with PRL2 enzyme activity inhibition and targeted degradation functions in the preparation of antitumor drugs. To achieve the above objective, the specific technical solution of the present invention is as follows: This invention provides the use of compounds of Formula I, or their stereoisomers, structural analogs, derivatives, or pharmaceutically acceptable salts thereof, in the preparation of medicaments for the prevention and / or treatment of ovarian cancer: Formula I in, In the diagram, when there is no dashed line, it represents a single bond; when there is a dashed line, it represents a double bond. R 1 R 2 R 3 R4 R 5 R 6 R 7 R 8 R 9 R 10 Each is independently selected from hydrogen, hydroxyl, and C. 1~5 Alkoxy, -L 1 L 2 R A Or be 0~3 R e Substituted 5-15 aryl groups; L 1 L 2 Each is independently selected from none, O, and C. 1~5 Alkylene or -CR b R c -; R b R c Each is independently selected from hydrogen or by 0 to 3 R groups. a Substituted 5-8 aryl groups; R A C selected from carboxyl-substituted C 1~5 Alkyl groups or those with 0 to 3 Rs a Substituted 5-8 aryl groups; R a Selected from hydroxyl, C 1~5 alkoxy or -L 3 L 4 R B L 3 L 4 Each was independently selected from C 1~5 Alkylene; R B Selected from 0 to 3 R d Substituted 5-8 aryl groups; R d Selected from hydroxyl or C 1~5 Alkoxy; R e Selected from hydroxyl or C 1~5 Alkoxy; Or, R 1 and R 10 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-8 membered saturated cycloalkyl or 6-8 membered unsaturated cycloalkyl; or, R 5 and R 6 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-8 membered saturated cycloalkyl or 6-8 membered unsaturated cycloalkyl; R f Selected from 5-8 aryl groups substituted with 0-3 R's; Or, R 2 and R 3 R 3 and R 4 R 7 and R 8 R 8 and R 9 Any pair of adjacent substituents, together with the atoms connecting these adjacent substituents, form a group consisting of 0 to 3 R groups. g Substituted 5- to 8-membered saturated heterocycles; R g C selected from oxo- and hydroxy-substituted C 1~5 Alkyl groups, 5-8 aryl groups substituted with 0-3 R's; R' is selected from hydroxyl, C 1~5 Alkoxy; R 11 and R 12 Each is independently selected from hydrogen and C. 1~5 Alkyl or C 1~5 Alkyl group.
[0009] Furthermore, the R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 Each is independently selected from hydrogen, hydroxyl, and C. 1~3 Alkoxy, -L 1 L 2 R A Or be 0~3 R e Substituted 5-15 aryl groups; L 1 L 2 Each is independently selected from none, O, and C. 1~3 Alkylene or -CR b R c -; R b R c Each is independently selected from hydrogen or by 0 to 3 R groups. a Substituted 5-6 aryl groups; R A C selected from carboxyl-substituted C 1~3 Alkyl groups or those with 0 to 3 Rs a Substituted 5-6 aryl groups; R a Selected from hydroxyl, C 1~3 alkoxy or -L3 L 4 R B L 3 L 4 Each was independently selected from C 1~3 Alkylene; R B Selected from 0 to 3 R d Substituted 5-6 aryl groups; R d Selected from hydroxyl or C 1~3 Alkoxy; R e Selected from hydroxyl or C 1~3 Alkoxy; Or, R 1 and R 10 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-7 membered saturated cycloalkyl or 6-7 membered unsaturated cycloalkyl; or, R 5 and R 6 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-7 membered saturated cycloalkyl or 6-7 membered unsaturated cycloalkyl; R f Selected from 5-6 aryl groups substituted with 0-3 R'; Or, R 2 and R 3 R 3 and R 4 R 7 and R 8 R 8 and R 9 Any pair of adjacent substituents, together with the atoms connecting these adjacent substituents, form a group consisting of 0 to 3 R groups. g Substituted 5-6 member saturated heterocycles; R g C selected from oxo- and hydroxy-substituted C 1~3 Alkyl groups, 5-6 aryl groups substituted with 0-3 R's; R' is selected from hydroxyl, C 1~3 Alkoxy; R 11 and R 12 Each is independently selected from hydrogen and C. 1~3 Alkyl or C 1~3 Alkyl group.
[0010] Furthermore, the R 1 R 2 R 3 R 4 R 5 R 6 R 7 R8 R 9 R 10 Each is independently selected from hydrogen, hydroxyl, and C. 1~3 Alkoxy, , , , , , , , , ; Or, R 2 R 3 and R 4 Together with the atoms of the three, they form oxygenated atoms. hydroxyl-substituted C 1~3 alkyl, or The following groups are substituted: , .
[0011] Furthermore, the structure of the compound is shown in Formula II: Formula II Among them, R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 11 R 12 As stated above.
[0012] Furthermore, the structure of the compound is shown in Formula III: Formula III Among them, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 As mentioned above, and R 1 R 2 R 3 R 4 R 5 R 6 R 7 R8 R 9 R 10 One or more of the following are .
[0013] Furthermore, the compound is selected from one of the following compounds: .
[0014] Furthermore, the drug is a drug that inhibits the proliferation and / or migration of ovarian cancer cells.
[0015] The compounds and derivatives provided in this invention can be named according to the IUPAC (International Union of Pure and Applied Chemistry) or CAS (Chemical Abstracts Service, Columbus, OH) nomenclature system.
[0016] Regarding the definition of terms used in this invention: Unless otherwise stated, the initial definitions provided for groups or terms herein apply to the groups or terms used throughout this specification; for terms not specifically defined herein, the meanings that a person skilled in the art would give them should be given based on the disclosure and context.
[0017] "Aryl" refers to an all-carbon monocyclic or polycyclic ring (including fused rings, spirocyclic or bridged rings) with a conjugated π-electron system, such as, but not limited to: phenyl, naphthyl, phenanthryl, anthraceneyl, fluorenyl and indene. The aromatic ring may be fused to other cyclic groups (including saturated and unsaturated rings), but cannot contain heteroatoms such as O, N or S, and the point of connection to the parent group must be on a carbon atom of a ring with a conjugated π-electron system.
[0018] The minimum and maximum carbon atom content in hydrocarbon groups are indicated by a prefix, for example, the prefix C. a~b Alkyl indicates any alkyl group containing "a" to "b" carbon atoms. Therefore, for example, "C 1~6 "Alkyl" refers to an alkyl group containing 1 to 6 carbon atoms.
[0019] "Alkyl" refers to a saturated hydrocarbon chain having a specified number of member atoms. For example, C1-6 alkyl refers to an alkyl group having 1 to 6 member atoms, such as 1 to 4 member atoms. Alkyl groups can be straight-chain or branched. Representative branched alkyl groups have one, two, or three branches. Alkyl groups may optionally be substituted by one or more substituents as defined herein. Alkyl groups include methyl, ethyl, propyl (n-propyl and isopropyl), butyl (n-butyl, isobutyl, and tert-butyl), pentyl (n-pentyl, isopentyl, and neopentyl), and hexyl. Alkyl groups may also be part of other groups, such as C1-6 alkoxy groups.
[0020] "Heterocycle" refers to a saturated ring or a non-aromatic unsaturated ring containing at least one heteroatom and having a single ring; where heteroatoms refer to nitrogen, oxygen, sulfur, and boron atoms.
[0021] "Alkoxy" refers to an alkyl group that is connected to a bonding site through an oxygen atom. Its alkane chain can be a saturated alkane chain or a non-aromatic unsaturated alkane chain containing at least one double bond. For example, methoxy refers to -OCH3.
[0022] "Oxygenation" indicates that an oxygen atom is attached to a carbon atom at a certain position in a group, forming a carbonyl (C=O) structure.
[0023] Compared with the prior art, the present invention has achieved the following beneficial effects: (1) This invention provides a highly effective PRL2-targeting degrader that can serve as a potential molecular glue to overcome the limitations of traditional PROTAC technology. Addressing the technical shortcomings of existing protein degradation-targeting chimeras (PROTACs), such as large molecular weight, poor membrane permeability, and low bioavailability, this invention, for the first time, screened and identified Blestriarene C from the traditional Chinese medicine Bletilla striata as a potential PRL2-targeting molecular glue. This compound features a simple structure and small molecular weight, avoiding the complex structure caused by linker connections in PROTAC molecules, thus providing a new option for the development of PRL2-targeting drugs.
[0024] (2) This invention achieves dual functional regulation of the PRL2 target (enzyme inhibition and protein degradation), solving the problem of acquired resistance easily generated by single-function drugs. Addressing the technical deficiency of existing PRL2 inhibitors, which can only block its enzyme activity and cannot intervene in its non-enzyme-dependent functions, leading to acquired resistance in clinical treatment, this invention provides Blestriarene C, which possesses dual functions: on the one hand, this compound can directly inhibit the phosphatase activity of PRL2, blocking its pro-cancer signaling pathway; on the other hand, this invention reveals that Blestriarene C recruits the E3 ubiquitin ligase TRIM25, enhancing the protein-protein interaction between PRL2 and TRIM25, thereby mediating the degradation of PRL2 through the ubiquitin-proteasome pathway. This dual mechanism of action, "enzyme inhibition + target degradation," can comprehensively block the biological function of PRL2 at the functional expression level, effectively overcoming acquired resistance caused by target mutations or compensatory mechanisms.
[0025] (3) The mechanism of action of potential molecular glues has been clarified, providing a basis for E3 ligase TRIM25 as a new target for ovarian cancer treatment: Addressing the issue that existing molecular glue drugs are mostly concentrated on a few E3 ligases such as CRBN, and their mechanisms of action are unclear, this invention, through immunoprecipitation and mass spectrometry, has for the first time identified and verified that the E3 ubiquitin ligase TRIM25 is a key enzyme mediating PRL2 degradation. This invention confirms that Blestriarene C can act as a molecular glue, specifically enhancing the interaction between PRL2 and TRIM25, revealing the molecular mechanism of this compound's action. This not only provides a new target (TRIM25) for the design of PRL2 degrading agents but also expands the possibility of molecular glue drugs acting on novel E3 ligases.
[0026] (4) It exhibited significant and specific anti-ovarian cancer activity in both in vivo and in vitro models. Addressing the limitations of existing ovarian cancer treatments in efficacy and significant side effects, this invention experimentally verified the anti-tumor effect of Blestriarene C: In vitro effects: Cell experiments confirmed that Blestriarene C significantly inhibited the proliferation and migration of ovarian cancer cells. In vivo effects: By constructing a nude mouse ovarian cancer subcutaneous tumor model and administering the drug intraperitoneally, the results showed that the high-dose group of Blestriarene C significantly inhibited the growth of ovarian cancer subcutaneous tumors.
[0027] The above results demonstrate that the compound exhibits high efficacy and low toxicity in the treatment of ovarian cancer at low doses, providing an innovative candidate drug with independent intellectual property rights for the treatment of ovarian cancer.
[0028] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0029] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0030] Figure 1 To screen the activity of PRL2 enzyme based on mixtures of traditional Chinese medicines that promote blood circulation and remove blood stasis, and the large amount of monomeric components. (A) Superdex 75 gel filtration chromatography pattern of PRL2 protein, showing the elution peak during protein purification. (B) SDS-PAGE of PRL2 protein purity with Coomassie brilliant blue staining. (C) The significant inhibitory effect of Bletilla striata and strychnine derivatives on PRL2 enzyme activity.
[0031] Figure 2 This study focuses on the isolation, purification, and PRL2 enzyme activity screening of Blestriarene C, an active monomer derived from Bletilla striata. (A) The isolation and purification process of Bletilla striata components. (B) Bibenzyl and phenanthrene monomers isolated and identified from Bletilla striata; the red-marked components are the main monomers of Bletilla striata. (C) The significant inhibitory effect of Blestriarene C on PRL2 enzyme activity. (D) The chemical structural formula of Blestriarene C.
[0032] Figure 3 Blestriarene C promotes PRL2 degradation via the ubiquitination-proteasome pathway. (A) Blestriarene C significantly reduces PRL2 protein expression. (B) Blestriarene C significantly shortens the half-life of PRL2 protein. (C) Blestriarene C's degradation of PRL2 is independent of the lysosomal pathway. (D) Blestriarene C mediates PRL2 degradation via the ubiquitination-proteasome pathway. Blestriarene C (10 μM) significantly enhances the ubiquitination level of PRL2 in (E) ES2, (F) SKOV3, and (G) A2780 cells.
[0033] Figure 4Verification of the direct interaction between Blestriarene C and PRL2. (A) Molecular docking analysis of Blestriarene C and PRL2. (BC) Molecular dynamics analysis of the Blestriarene C and PRL2 complex. (D) Surface plasmon resonance analysis of the binding affinity of Blestriarene C and PRL2. (E) Microthermophoresis analysis of the binding affinity of Blestriarene C and PRL2. (FG) Cell thermal migration assay to verify the intracellular interaction between Blestriarene C and PRL2.
[0034] Figure 5 Mass spectrometry identification of TRIM25. (A) SDS-PAGE of proteomic samples precipitated with PRL2 antibody after Blestriarene C treatment of ES2 ovarian cancer cells, stained with Coomassie Brilliant Blue. (B) Secondary mass spectrometry pattern of TRIM25.
[0035] Figure 6 TRIM25 regulates the ubiquitination and degradation of PRL2. (A) Forward and reverse IP verification of PRL2 binding to TRIM25. (B) Changes in PRL2 protein expression after TRIM25 knockdown and overexpression, respectively. (CD) Detection of the TRIM25 degradation pathway. (E) IP detection of PRL2 ubiquitination after TRIM25 knockdown and overexpression, respectively.
[0036] Figure 7 Blestriarene C was investigated as a potential molecular glue to promote the binding of PRL2 to TRIM25 and regulate the ubiquitination and degradation of PRL2. (AB) IP verification of Blestriarene C enhancing the interaction between PRL2 and TRIM25. (C) Knockdown of TRIM25 alleviated the intensity of TRIM25 ubiquitination and degradation of PRL2 protein.
[0037] Figure 8 Blestriarene C inhibits the proliferation and migration of ovarian cancer cells. (A) Killing activity of Blestriarene C against four ovarian cancer cell lines (IC50). 50 Detection. (B) Effect of Blestriarene C on colony formation of four ovarian cancer cell lines. (C) Flow cytometry detection of the effect of Blestriarene C on apoptosis of ovarian cancer cells. (D) Transwell assay detection of the effect of Blestriarene C on migration and invasion of ovarian cancer cells.
[0038] Figure 9To investigate the effect of Blestriarene C on tumor growth in a mouse model of ovarian cancer subcutaneous tumors. (A) Schematic diagram of the treatment protocol for the mouse model of ovarian cancer subcutaneous tumors with Blestriarene C. (B) Photographs of subcutaneous tumors in each group after treatment. (CD) Body weight of mice in each subcutaneous tumor model group after treatment. (E) Monitoring and recording of tumor volume in each group during treatment. (FG) Tumor weight and volume of mice in each subcutaneous tumor model group after treatment. (HJ) Detection of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) levels in each group after treatment. (K) Immunohistochemistry of Ki67 and cleaved-capasase 3 in tumor tissues in each group after treatment. (L) HE staining of major organs in each group after treatment. Detailed Implementation
[0039] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.
[0040] Example 1: Discovery and Validation of Blestriarene C as a PRL2-Targeting Molecular Gel 1. Establishment of natural product screening strategy and discovery of active components of Bletilla striata and Scutellaria baicalensis 1.1 Expression and purification of PRL2 recombinant protein The full-length sequence of PRL2 (SEQ ID No. 1) was cloned into the pET-28a prokaryotic expression vector to construct the recombinant plasmid pET-28a-PRL2(WT). The correctly sequenced plasmid was then transformed into... E. coli BL21(DE3) competent cells, seeded in a K-containing environment + In the culture medium, incubate at 37°C with shaking for 6-7 hours. When the bacterial OD of the culture solution... 600 When the β-hydroxyl content (nm) reached 0.6-0.8, 500 μL of isopropyl-β-D-thiogalactopyranoside (IPTG) was added, and the mixture was induced overnight at 16°C to express the target protein. After induction, the bacterial cells were collected, homogenized under high pressure, and purified sequentially by nickel affinity chromatography and size exclusion chromatography to finally obtain PRL2 protein with a molecular weight of approximately 20 kDa, a purity >95%, and high enzymatic activity. Figure 1 AB).
[0041] The full-length sequence of PRL2 (SEQ ID No. 1): ATGAACCGTCCAGCCCCTGTGGAGATCTCCTATGAGAACATGCGTTTTCTGATAACTCAACAACCCTACCAATGCTACTCTCAACAAGTTCACAGAGGAACTTAAGAAGACTTTGGTTCGAGTTTGTGATGCTACATATGATAAAGCTCCAGTTGAAAAAGAAGGAATCCACGTTCTAGATTGGCCATTTGATGATGGAGCTCCACCCCCTAATCAGATAGTAGATGATTGGTTAAAACCTG TTAAAAACCAAATTTCGTGAAGAGCCAGGTTGCTGTGTTGCAGTGCATTGTGTTGCAGGATTGGGAAGGGCACCTGTGCTGGTTGCACTTGCTTTGATTGAATGTGGAATGAAGTACGAAGATGCA GTTCAGTTTATAAGACAAAAAAGAAGGGGAGCGTTCAATTCCAAACAGCTGCTTTATTTGGAGAAATACCGACCTAAGATGCGATTACGCTTCAGAGATACCAATGGGCATTGCTGTGTTCAGTAG.
[0042] 1.2 Screening of PRL2 enzyme activity by extracts and major components of traditional Chinese medicine for promoting blood circulation and removing blood stasis. Establish a PRL2 phosphatase activity detection system: Purified PRL2 protein (1 μM) and the herbal extracts and monomeric compounds to be screened (Chuanxiong oil (10 μg / mL), turmeric oil (10 μg / mL), zedoaryturmeric oil (10 μg / mL), betilla striatastilbene (10 μg / mL), and Chuanxiong extract (10 μg / mL) were added to the reaction buffer (20 mM HEPES, 100 mM NacI, 10 mM M DTT). The extracts, germacrone (10 μM), curzerenone (10 μM), curcumenol (10 μM), and curcumene (10 μM) were incubated at 37 °C for 30 min. Then, 6,8-difluoro-4-methylumbelliferone phosphate (DiFMUP) (10 μM) was added in the dark, and the fluorescence intensity was detected at 460 nm using a microplate reader.
[0043] The results showed that among the commonly used blood-activating and stasis-removing Chinese herbal extracts and numerous components screened, the Chinese herb Bletilla striata was the most effective. Bletilla striata The succinate components of (Thunb.) Reichb.f. exhibit significant PRL2 enzyme activity inhibition. Figure 1 C), with a better inhibition rate than other tested Chinese herbal extracts, suggests that the components of Bletilla striata contain PRL2 phosphatase inhibitors.
[0044] 2. Isolation, purification, and structural identification of active monomers from Bletilla striata. 2.1 Extraction, Separation and Purification To elucidate the chemical components and their material basis that inhibit PRL2 enzyme activity in Bletilla striata extract, the following separation and purification process was adopted: (1) Extraction: Bletilla striata was extracted with 80% ethanol by reflux three times for 1 hour each time. The extracts were combined and concentrated under reduced pressure to obtain crude extract. (2) Extraction: The crude extract was suspended in water and extracted sequentially with petroleum ether, ethyl acetate and n-butanol to obtain four fractions: petroleum ether fraction, ethyl acetate fraction, n-butanol fraction and water fraction. (3) Crude fractionation: The ethyl acetate fraction was crudely separated using polyamide column chromatography to obtain 25 fractions (Fr.1-Fr.25). (4) Directional separation: UPLC-Q / Tof-HRMS (ultra-high performance liquid chromatography-quadrupole / time-of-flight high-resolution mass spectrometry) technology was used, combined with the unsaturation characteristics (4n for bibenzyl, 4n+1 for dihydrophenanthrene, and 4n+2 for phenanthrene) and the colorimetric characteristics of thin-layer chromatography (bibenzyl and phenanthrene are orange-red or dark green under sulfuric acid-ethanol colorimetric conditions) to perform directional separation of arsenic compounds; (5) Fine separation: Through various chromatographic separation methods such as silica gel column chromatography, gel column chromatography, polyamide column chromatography, C18 reversed-phase medium-pressure column chromatography, thin-layer preparative chromatography, and semi-preparative high-performance liquid chromatography, 51 compounds were finally separated and purified from the ethyl acetate extract of Bletilla striata. Figure 2 A).
[0045] 2.2 Structural Assessment The structures of the obtained monomers were identified using modern spectroscopic techniques such as ultraviolet light, infrared spectroscopy, one-dimensional nuclear magnetic resonance (NMR), two-dimensional NMR, and mass spectrometry. A total of 51 arsenic compounds were identified, including 26 bibenzyl compounds and 25 phenanthrene compounds. The bibenzyl compounds were mainly classified into four types: polybibenzyl, simple bibenzyl, bibenzyl sesquiomer, and bisbenzyl. Figure 2 B).
[0046] 2.3 Screening for PRL2 enzyme activity inhibition Eight representative components with high yields were selected (as shown in the figure below, denoted as compounds 1, 2, 3, 4, 5, 6, 7 and Blestriarene C), and enzyme activity inhibition screening was performed using the PRL2 phosphatase activity detection method established in section 1.2 above.
[0047] The results showed that Blestriarene C, a monomer of Bletilla striata, exhibited a significant inhibitory effect on PRL2 enzyme activity. Figure 2 CD) indicates that Blestriarene C is a potential PRL2 enzyme activity inhibitor. Other tested succinate monomers also showed varying degrees of PRL2 enzyme activity inhibition. Figure 2 (C), indicating that the zirconia structure is the active framework for inhibiting PRL2 enzyme activity, and BlestriareneC is a representative compound with strong activity among this class of components.
[0048] 3. Detection of Blestriarene C's ubiquitination and degradation activity against PRL2 protein 3.1 Effect of Blestriarene C on PRL2 protein expression in four ovarian cancer cell lines (ES2, SKOV3, A2780, and OVCAR3) Total protein was extracted from the four ovarian cancer cell lines, lysed by sonication on ice, and quantified by BCA protein. Western blot was used for electrophoresis, with a loading volume of 30 μg, and electrophoresis was performed at a constant voltage of 70 V. After electrophoresis, the membrane was transferred at 300 mA for 3 h, blocked with 5% skim milk at room temperature for 1 h, and incubated overnight at 4 °C with PRL2 antibody. The next day, the membrane was washed three times with TBST, incubated with anti-mouse secondary antibody at room temperature for 1 h, washed three times with TBST, and then developed. The results showed that Blestriarene C significantly downregulated the expression of PRL2 protein in the four ovarian cancer cell lines. Figure 3 A).
[0049] 3.2 Detection of the effect of Blestriarene C on the half-life of PRL2 protein Ovarian cancer cells were seeded into 6-well plates and divided into a control group and a Blestriarene C treatment group. Actinomycin C (CHX, 20 μM) was added to inhibit the synthesis of new proteins. Cell lysates were collected at 0, 3, 6, 9, and 12 h. Western blot was used to detect PRL2 protein expression. The relative expression level of PRL2 at each time point was analyzed by grayscale, and the protein decay curve was calculated with 0 h as the baseline to fit the half-life. The difference in half-life between the treatment group and the control group was compared to evaluate the effect of Blestriarene C on PRL2 protein stability. The protein half-life results showed that Blestriarene C significantly shortened the half-life of PRL2 protein, indicating that Blestriarene C downregulates PRL2 expression by promoting PRL2 degradation. Figure 3 B).
[0050] 3.3 Detection of PRL2 protein degradation pathway by Blestriarene C Ovarian cancer cells were divided into a control group, a Blestriarene C group (treatment group), and a group treated with either the proteasome inhibitor MG132 (30 μM) or the lysosomal inhibitor chloroquine (30 μM), respectively. Cell lysates were collected after 8 hours of treatment, and PRL2 protein expression was detected by Western blot. If MG132 reversed the Blestriarene C-induced downregulation of PRL2, it indicated a proteasome pathway; if chloroquine was reversible, it indicated a lysosomal pathway. The grayscale values of PRL2 in each group were analyzed to clarify the degradation pathway. This invention reveals that Blestriarene C-mediated PRL2 degradation does not depend on the lysosomal pathway. Figure 3 C) depends on the ubiquitination-proteasome pathway ( Figure 3 D).
[0051] 3.4 Detection of PRL2 protein degradation pathway by Blestriarene C Ovarian cancer cells were divided into a control group and a Blestriarene C treatment group. Cells were plated in 6-well plates, transiently transfected with ub plasmid, and stimulated with Blestriarene C for 48 h. Before cell harvesting, the proteasome inhibitor MG132 (30 µM) was added to block ubiquitinated protein degradation. After 8 h of treatment, cell lysates were collected and immunoprecipitated (IP) with PRL2 antibody. The cells were incubated overnight with Protein A / G agarose beads. After elution, Western blot was performed to detect ubiquitin (Ub) expression. To verify whether Blestriarene C promotes PRL2 ubiquitination, ubiquitination IP experiments showed that Blestriarene C significantly increased the ubiquitination level of PRL2 in ES2, SKOV3, and A2780 cells. Figure 3(E~G). In summary, Blestriarene C is a potential PRL2 degrader derived from the traditional Chinese medicine Bletilla striata, possessing both enzyme activity inhibition and protein degradation functions.
[0052] 3.5 Verification of the direct interaction between Blestriarene C and PRL2 protein To further verify that Blestriarene C is a targeted degrader of PRL2, this invention investigated the direct interaction between Blestriarene C and the PRL2 protein. This invention explored the interaction relationship through molecular docking, molecular dynamics simulations, SPR, and MST experiments.
[0053] Molecular docking: Autodock Vina was used to perform molecular docking between the drug molecule and the PRL2 protein structure, and PyMOL was used to annotate the protein structure. The PRL2 protein structure (5K22) was downloaded from the PDB database, and water molecules were removed and hydrogen bonds were added using PyMOL. The drug molecule structure was plotted, optimized, and saved as ligand.PDB. Both were converted to pdbqt format using Open Babel (nonpolar hydrogens were combined, and charges were calculated). The active sites of PRL2 (such as Cys278 residues) were displayed in PyMOL, the coordinate centers were recorded, and the docking box was set. The molecular docking program was run to obtain all binding modes and sorted by affinity (kcal / mol). PRL2.PDB and optimal out.PDBqt were opened in PyMOL. Key residues were annotated, and interactions were displayed. The molecular docking results showed that the optimal docking conformation binding energy of Blestriarene C with PRL2 protein was -7.5 kcal / mol. Figure 4 A) indicates that there is a strong direct interaction between the two.
[0054] Molecular dynamics simulation analysis: Small molecule and wild-type protein complexes, as well as the small molecule and wild-type protein complexes, were obtained from Boltz2 (https: / / github.com / jwohlwend / boltz) simulations and used as initial structures for all-atom molecular dynamics simulations. The simulations were performed using AMBER 24 software. Before the simulation, the AM1-BCC charge of the small molecule was calculated using the antechamber module. Subsequently, the small molecule and protein were described using the GAFF2 small molecule force field and ff14SB protein force field, respectively. Hydrogen atoms were added to each system using the LEaP module, a truncated octahedral TIP3P solvent box was added at a distance of 10 Å, and Na was added to the system. + / Cl - Used to balance the system charge, and finally output the topology and parameter files for simulation.
[0055] First, the system's energy was optimized using both the steepest descent method (2500 steps) and the conjugate gradient method (2500 steps). After energy optimization, the system was slowly heated from 0 K to 298.15 K by 200 ps at a constant volume and heating rate. While maintaining the system at 298.15 K, a 500 ps NVT (isothermal-isovolute) ensemble simulation was performed to further homogenize the solvent molecules within the solvent box. Finally, a 500 ps equilibrium simulation was conducted on the entire system under NPT (isothermal-isobaric) conditions. Finally, a 100 ns NPT ensemble simulation was performed on the composite system under periodic boundary conditions. During the simulation, the nonbonded cutoff distance was set to 10 Å. The Particle Mesh Ewald (PME) method was used to calculate long-range electrostatic interactions, the SHAKE method was used to constrain hydrogen bond lengths, and the Langevin algorithm was used for temperature control, with the collision frequency γ set to 2 ps. -1 The system pressure was 1 atm, the integration step size was 2 fs, and the trajectory was saved every 10 ps for subsequent analysis.
[0056] The binding free energies between proteins and ligands in all systems were calculated using the MM / GBSA method. In this invention, the MD trajectory of 90-100 ns was used for calculation, and the specific formula is as follows: In the above formula, Indicates the total free energy of the protein-ligand complex in solution. Indicates the total free energy of a free protein in solution. Represents the total free energy of the free ligand in solution. Indicates internal energy, Indicates the role of van der Waals and This represents electrostatic interaction. Internal energy includes bond energy (E). bond ), angular energy (E angle ), and torsional energy (E) torsion ); and Collectively referred to as solvation free energy. Among them, G GB For polar solvation free energy, G SA This is the nonpolar solvation free energy. For This paper uses the GB model developed by Nguyen et al. for calculation ( IGB = 2). Nonpolar solvation free energy ( The value is calculated based on the product of surface tension (γ) and solvent-accessible surface area (SA). = 0.0072 × SASA. Entropy change is neglected in this invention due to its high computational cost and low precision. The dynamic behavior of the complex is evaluated by calculating the root mean square deviation (RMSD) and root mean square fluctuation (RMSF) through molecular dynamics simulations. The results show that Blestriarene C and PRL2 exhibit strong interaction stability within the predicted binding region. Figure 4 BC).
[0057] Surface plasmon resonance (SPR): Chip preparation: The activator was prepared immediately before use by mixing 400 mM EDC and 100 mM NHS. The CM5 sensor chip was activated with this mixture at a flow rate of 10 μL / min for 420 seconds. Ligand immobilization: PRL2 protein was diluted to 45 μg / mL with immobilization buffer and then injected into the sample channel (Fc2) at a flow rate of 10 μL / min, typically achieving a immobilization level of 9500 RU. The reference channel (Fc1) did not require ligand immobilization. The chip was blocked with 1 M ethanolamine hydrochloride at a flow rate of 10 μL / min for 420 seconds. Analytes were run using a multi-cycle method, diluting the analyte to seven concentrations (25, 12.5, 6.25, 3.125, 1.5625, 0.78, and 0 μM) with analysis buffer. The compound was injected into the Fc1-Fc2 channels at a flow rate of 30 μL / min for a binding time of 120 seconds, followed by a dissociation time of 300 seconds. Both binding and dissociation processes were performed in the analysis buffer. The analyte injections were repeated for seven cycles, following an increasing order of analyte concentration. After each interaction analysis cycle, the analyte dissociated naturally, requiring no chip regeneration.
[0058] Micro-thermophoresis: Protein labeling. Add 8 mL of ddH2O to a tube containing 5×PBST to obtain 1×PBST. Dissolve the dye in 25 μL of PBST to obtain a 5 μM dye solution. Mix 2 μL of dye (5 μM) with 98 μL of PBST to prepare a 100 nM dye solution. Adjust the protein concentration to 200 nM using target buffer, for a total volume of 100 μL. Mix 90 μL of protein (200 nM) with 90 μL of dye (100 nM). Incubate at room temperature for 30 minutes. Centrifuge at 15000 g for 10 minutes at 4°C, and transfer the supernatant to a new tube. Protein labeling is complete and ready for binding experiments. Binding experiments: Prepare 25 μL of 2× ligand using the selected ligand buffer. Add 10 μL of ligand buffer to each well (2–16) of the PCR tube. Add 20 μL of ligand to well 1 of the PCR tube. Using a pipette, transfer 10 μL of ligand from well 1 to well 2 of the PCR tube and mix thoroughly by pipetting. Then, transfer another 10 μL of ligand from well 1 to well 3 of the PCR tube and mix thoroughly. Repeat this process up to well 16 of the PCR tube. Discard the excess 10 μL from well 16 of the PCR tube. Add 10 μL of the labeled protein to each of wells 1–16 and mix thoroughly by pipetting. The final concentration of the target protein in this experiment is 50 nM, which will be used to calculate the KD value. Load the sample into a capillary and perform the detection. MST power: medium, LED power: 60%, temperature: 25°C. Ligand concentration range: 100 μM–3.05 nM.
[0059] Cell thermal migration assay: Ovarian cancer cells were collected and divided into a control group and a Blestriarene C treatment group (40 µM, 20 min). After washing with PBS, the cells were resuspended and aliquoted into PCR tubes, and incubated at 45-78℃ (e.g., 45-78℃). Figure 4 Heating was performed for 3 min using the temperature gradient shown in F, followed by cooling to room temperature. Cells were lysed, and the supernatant was collected by centrifugation. PRL2 protein was detected by Western blot. A heating temperature-residual protein content curve was plotted to compare the melting temperatures of the treatment group and the control group. The changes clearly demonstrate the direct binding of Blestriarene C to PRL2.
[0060] Surface plasmon resonance, micro-thermophoresis, and cell thermal migration experiments all confirmed the direct interaction between the two within cells. Figure 4 DG).
[0061] 4. Blestriarene C exerts its molecular glue effect by recruiting TRIM25 to ubiquitinate and degrade PRL2. 4.1 Mass spectrometry identification of Blestriarene C recruiting TRIM25 Blestriarene C acts as a PRL2-targeting degrader, ubiquitinizing and degrading PRL2. However, the E3 ubiquitin ligase mediating this degradation remains unclear. In this invention, ES2 cells were treated with Blestriarene C (10 μM) for 48 h. Protein samples precipitated by PRL2 antibody co-precipitation (Co-IP) were then fixed in an SDS-PAGE gel with a fixative (methanol:water:glacial acetic acid = 5:4:1). The mixture was then stained with Coomassie Brilliant Blue (0.5 g Coomassie Brilliant Blue dissolved in 500 ml fixative) for 20 min. Destaining was performed with a destaining solution (875 ml water, 50 ml methanol, 75 ml glacial acetic acid) until the background was clean and the bands were clear. Differential bands were excised and cut into 1 mm sections. 3 The sample was in block form and was sent for LC-MS / MS mass spectrometry identification. Figure 5 (AB). Of the 396 differentially expressed proteins identified, TRIM25 was the only known E3 ubiquitin ligase.
[0062] 4.2 TRIM25 regulates the ubiquitination and degradation of PRL2 ES2 ovarian cancer cells were collected and lysed on ice for 30 min using NP-40 lysis buffer (containing protease inhibitor). The supernatant was collected by centrifugation at 4°C, with a small amount reserved as an input control. The lysate supernatant was divided into two groups, with anti-PRL2 antibody and isotype control IgG added to one group, and incubated at 4°C for 2 h. Protein A / G agarose beads were added and incubated for another 2 h. The agarose beads were washed three times, and the cells were eluted by boiling with SDS loading buffer. Western blotting was performed, and detection was performed using anti-TRIM25 antibody. Following the same procedure, immunoprecipitation was performed using anti-TRIM25 antibody, with isotype IgG as a negative control. Western blotting using anti-PRL2 antibody confirmed the specific binding of PRL2 to TRIM25. Figure 6 A). Stable ovarian cancer cell lines with TRIM25 overexpression and knockdown were constructed. Western blotting was used to detect changes in PRL2 protein expression after TRIM25 overexpression and knockdown. The results showed that TRIM25 overexpression decreased PRL2 protein expression, while TRIM25 knockdown increased PRL2 protein expression. Figure 6 B). Furthermore, stable ES2 TRIM25-overexpressing cell lines were treated with chloroquine and MG132, respectively, and Western blot analysis was performed to detect changes in PRL2 protein expression. The results showed that TRIM25 overexpression followed by chloroquine treatment did not alter the downregulation trend of PRL2 protein, while treatment with MG132 weakened the downregulation trend. Figure 6CD. TRIM25 overexpression and knockdown of stable cell lines were subjected to ubiquitination IP assays. The results showed that TRIM25 overexpression promoted PRL2 ubiquitination and degradation, while TRIM25 knockdown inhibited PRL2 ubiquitination and degradation. Figure 6 E), indicating that TRIM25 mediates the degradation of PRL2 via the proteasome pathway.
[0063] 4.3 Blestriarene C promotes the binding of PRL2 and TRIM25. To further confirm whether Blestriarene C possesses molecular gel activity, promotes the binding of PRL2 and TRIM25, and mediates the ubiquitination and degradation of PRL2, ES2 and A2780 cells were treated with Blestriarene C (10 μM) (48 h). Protein samples precipitated by PRL2 antibody co-immunoprecipitation (Co-IP) were then subjected to Western blotting to detect the enrichment intensity of TRIM25. The results showed that Blestriarene C treatment significantly enhanced TRIM25 enrichment, confirming that Blestriarene C can enhance the interaction between PRL2 and TRIM25. Figure 7 AB). Furthermore, after treatment with Blestriarene C, TRIM25 knockdown stable cell lines underwent ubiquitination IP assays. The results showed that Blestriarene C, after TRIM25 knockdown, alleviated the intensity of TRIM25 ubiquitination degradation of PRL2 protein. Figure 7 (C), indicating that Blestriarene C can act as a molecular glue to recruit the E3 ubiquitin ligase TRIM25 to ubiquitinate and degrade PRL2.
[0064] 5. Evaluation of the anti-ovarian cancer activity of Blestriarene C, a PRL2-targeting degrader 5.1 Experimental Methods 5.1.1 Blestriarene C on IC50 of 4 ovarian cancer cell lines 50 Detection: Ovarian cancer cells in the logarithmic growth phase were collected, digested with trypsin, and a single-cell suspension was prepared. The cells were counted and the density was adjusted to 3-5 × 10⁻⁵. 4Cells were seeded at 100 µL per well (1000 cells / well) in 96-well plates, with sterile PBS or culture medium added to the edge wells to reduce evaporation. Cells were incubated overnight at 37°C with 5% CO2. Blestriarene C was serially diluted with medium containing 10% FBS to create nine concentration gradients (200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125 µM), with a solvent control group containing 0.1% DMSO and a blank medium control group. Each concentration was used in triplicate. The old medium was discarded, and 100 µL of fresh medium containing different drug concentrations was added to each well. Cells were incubated at 37°C with 5% CO2 for 48 hours. 20 µL of MTT solution (5 mg / mL) was added to each well, and the cells were incubated for another 4 hours. Carefully aspirate the supernatant, add 150 µL of DMSO to each well, and shake for 10 minutes to fully dissolve the crystals. Measure the absorbance (OD value) at 570 nm using a microplate reader. Calculate the cell viability for each concentration group: Viability (%) = (OD of drug group - OD of zeroing well) / (OD of control group - OD of zeroing well) × 100%. Fit the dose-response curve using GraphPad Prism software and calculate the IC50. 50 value.
[0065] 5.1.2 Colony formation assay: Four ovarian cancer cell lines in logarithmic growth phase were seeded at 500 cells per well in a 6-well plate and cultured overnight. Different concentrations of Blestriarene C (e.g., 0, 5 µM) were added. The cells were cultured for 10-14 days until visible colonies were observed. The supernatant was discarded, the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 15 minutes, stained with 0.1% crystal violet for 30 minutes, rinsed with running water, dried, and photographed.
[0066] 5.1.3 Apoptosis Assay: Four ovarian cancer cell lines in the logarithmic growth phase were seeded into 6-well plates and cultured overnight. Blestriarene C (concentrations of 0, 5, and 10 µM) was added for 48 hours, respectively. Cells were collected, washed with PBS, and stained with the Annexin V-FITC / PI apoptosis kit: cells were resuspended in 100 µL binding buffer, and 5 µL of Annexin V-FITC and 5 µL of PI were added. The cells were incubated at room temperature in the dark for 15 minutes. Flow cytometry was used to detect the apoptosis, and the early (Annexin V⁺ / PI⁻) and late (Annexin V⁺ / PI⁺) apoptosis rates were calculated. GraphPad analysis was performed.
[0067] 5.1.4 Transwell Assay: Cells were resuspended in serum-free medium, counted, and added to the upper chamber, followed by Blestriarene C. The lower chamber was added with medium containing 10% FBS. After 24 hours of culture, unmigrated cells were wiped from the upper chamber, fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and photographed and counted under a microscope. Invasion Assay: The upper chamber was pre-coated with Matrigel, and the remaining steps were the same as the migration assay. The number of cells that penetrated the membrane was counted and analyzed using GraphPad.
[0068] 5.1.5 Serum ALT, AST, and Total Bilirubin Detection: Blood was collected from the orbital sinus after the last administration, and serum was separated by centrifugation at 3000 rpm for 15 min. The levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using a fully automated biochemical analyzer. Three mice were included in each group, and the differences between the treatment group and the model group were compared to assess the effect of the drug on liver function.
[0069] 5.1.6 Immunohistochemistry of tumor tissue with Ki-67 and Cleaved-caspasase 3: Tumor tissue was fixed, embedded, and sectioned (4 μm). After dewaxing and hydration, antigen retrieval was performed (sodium citrate buffer, microwave heating). Endogenous peroxidase was blocked with 3% H2O2 and goat serum for 30 min. Ki-67 (1:200) and Cleaved-caspasase 3 (1:400) primary antibodies were added separately and incubated overnight at 4℃. The next day, HRP-labeled secondary antibody was added, DAB staining was performed, hematoxylin counterstaining was performed, and the slides were mounted for microscopic examination.
[0070] 5.1.7 HE Pathological Staining: Mice were sacrificed after the last administration, and heart, liver, spleen, lung, and kidney tissues were dissected and fixed in 4% paraformaldehyde for 24 h. After routine dehydration, paraffin embedding, and sectioning (4 μm), sections were dewaxed to water, stained with hematoxylin for 5 min, allowed to return to blue under running water, differentiated with 1% hydrochloric acid-ethanol, and stained with eosin for 2 min. The sections were dehydrated with graded ethanol, cleared with xylene, and mounted with neutral resin. The integrity of the tissue structure, cell morphology, inflammatory infiltration, and necrosis were observed under a microscope to assess the in vivo safety of Blestriarene C.
[0071] 5.2 Experimental Results (1) Blestriarene C inhibits the proliferation and migration of ovarian cancer cells. In vitro cell experiments showed that Blestriarene C had a significant killing effect on four ovarian cancer cell lines, and its IC50 activity against A2780, SKOV3, and OVCAR3 cells was significantly higher. 50 Approximately 2μM, superior to the clinical chemotherapy drug olaparib ( Figure 8A). Clonogenesis experiments confirmed that Blestriarene C has significant proliferative inhibitory activity ( ). Figure 8 B). Flow cytometry results showed that Blestriarene C induced apoptosis in ovarian cancer cells (B). Figure 8 C). Transwell assay results showed that Blestriarene C inhibited the migration and invasion of ovarian cancer cells (C). Figure 8 D).
[0072] (2) Blestriarene C inhibits tumor growth in a mouse model of ovarian cancer subcutaneous tumors. A Balb / c-nu subcutaneous tumor model was established in nude mice using ES2 ovarian cancer cells. Mice were divided into a control group, a low-dose Blestriarene C group (5 mg / kg), a high-dose Blestriarene C group (15 mg / kg), and a cisplatin-positive control group (4 mg / kg), with 6 Balb / c-nu mice in each group. Blestriarene C was administered intraperitoneally daily, and cisplatin was administered intraperitoneally every 3 days. Mice were weighed and tumor volume was measured every 3 days. On day 22, mice were euthanized, tumor tissue was isolated and weighed, serum was collected to detect liver function indicators, and heart, liver, spleen, lung, and kidney sections were collected for histopathological examination and HE staining. Figure 9 A). The results showed that Blestriarene C (15 mg / kg) significantly inhibited the proliferation of ovarian cancer cells. Figure 9 B,EG), inhibiting ki-67 expression and promoting Cleaved-caspasase 3 expression ( Figure 9 K), with no significant hepatotoxicity (K). Figure 9 HJ), with good safety ( Figure 9 CD,L).
[0073] In this embodiment, Blestriarene C, a zirconia compound isolated from the traditional Chinese medicine Bletilla striata, was used as a representative compound. Its enzymatic inhibition function, protein degradation function, molecular mechanism of action (recruiting E3 ubiquitin ligase TRIM25), and anti-ovarian cancer activity as a PRL2 targeted degrader were systematically verified.
[0074] In the isolation and purification of Blestriarene active monomers in Example 1, a total of 51 stilbene compounds were isolated and identified from the ethyl acetate extract of Blestriarene, including 26 bibenzyl compounds and 25 phenanthrene compounds. These compounds share a common stilbene core structure (stilbene skeleton) with Blestriarene C, differing only in the type, number, position, or linkage of substituents. In the screening for PRL2 enzyme activity inhibition, eight representative stilbene monomers (covering both bibenzyl and phenanthrene structural types) all exhibited varying degrees of PRL2 enzyme activity inhibition activity. Figure 2 CD), indicating that the zirconia nucleus structure is the active backbone for PRL2 enzyme activity inhibition.
[0075] Based on the above structural commonalities and preliminary screening results, those skilled in the art have reason to expect that other Blestriarene monomeric compounds with zirconia nucleus structures may also interact with PRL2 protein through the same or similar mechanisms as Blestriarene C, thereby exerting PRL2 enzyme activity inhibition and subsequent protein degradation functions.
Claims
1. Use of the compound of Formula I, or its stereoisomers, structural analogs, derivatives, or pharmaceutically acceptable salts thereof, in the preparation of medicaments for the prevention and / or treatment of ovarian cancer: Formula I in, In the diagram, when there is no dashed line, it represents a single bond; when there is a dashed line, it represents a double bond. R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 Each is independently selected from hydrogen, hydroxyl, and C. 1~5 Alkoxy, -L 1 L 2 R A Or be 0~3 R e Substituted 5-15 aryl groups; L 1 L 2 Each is independently selected from none, O, and C. 1~5 Alkylene or -CR b R c -; R b R c Each is independently selected from hydrogen or by 0 to 3 R groups. a Substituted 5-8 aryl groups; R A C selected from carboxyl-substituted C 1~5 Alkyl groups or those with 0 to 3 Rs a Substituted 5-8 aryl groups; R a Selected from hydroxyl, C 1~5 alkoxy or -L 3 L 4 R B L 3 L 4 Each was independently selected from C 1~5 Alkylene; R B Selected from 0 to 3 R d Substituted 5-8 aryl groups; R d Selected from hydroxyl or C 1~5 Alkoxy; R e Selected from hydroxyl or C 1~5 Alkoxy; Or, R 1 and R 10 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-8 membered saturated cycloalkyl or 6-8 membered unsaturated cycloalkyl; or, R 5 and R 6 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-8 membered saturated cycloalkyl or 6-8 membered unsaturated cycloalkyl; R f Selected from 5-8 aryl groups substituted with 0-3 R's; Or, R 2 and R 3 R 3 and R 4 R 7 and R 8 R 8 and R 9 Any pair of adjacent substituents, together with the atoms connecting these adjacent substituents, form a group consisting of 0 to 3 R groups. g Substituted 5- to 8-membered saturated heterocycles; R g C selected from oxo- and hydroxyl-substituted C 1~5 Alkyl groups, 5-8 aryl groups substituted with 0-3 R's; R' is selected from hydroxyl, C 1~5 Alkoxy; R 11 and R 12 Each is independently selected from hydrogen and C. 1~5 Alkyl or C 1~5 Alkyl group.
2. The use according to claim 1, characterized in that: The R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 Each is independently selected from hydrogen, hydroxyl, and C. 1~3 Alkoxy, -L 1 L 2 R A Or be 0~3 R e Substituted 5-15 aryl groups; L 1 L 2 Each is independently selected from none, O, and C. 1~3 Alkylene or -CR b R c -; R b R c Each is independently selected from hydrogen or by 0 to 3 R groups. a Substituted 5-6 aryl groups; R A C selected from carboxyl-substituted C 1~3 Alkyl groups or those with 0 to 3 Rs a Substituted 5-6 aryl groups; R a Selected from hydroxyl, C 1~3 alkoxy or -L 3 L 4 R B L 3 L 4 Each was independently selected from C 1~3 Alkylene; R B Selected from 0 to 3 R d Substituted 5-6 aryl groups; R d Selected from hydroxyl or C 1~3 Alkoxy; R e Selected from hydroxyl or C 1~3 Alkoxy; Or, R 1 and R 10 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-7 membered saturated cycloalkyl or 6-7 membered unsaturated cycloalkyl; or, R 5 and R 6 Together with the atoms between the two, they form a group of 0 to 3 R atoms. f The following groups are substituted: 6-7 membered saturated cycloalkyl or 6-7 membered unsaturated cycloalkyl; R f Selected from 5-6 aryl groups substituted with 0-3 R'; Or, R 2 and R 3 R 3 and R 4 R 7 and R 8 R 8 and R 9 Any pair of adjacent substituents, together with the atoms connecting these adjacent substituents, form a group consisting of 0 to 3 R groups. g Substituted 5-6 member saturated heterocycles; R g C selected from oxo- and hydroxyl-substituted C 1~3 Alkyl groups, 5-6 aryl groups substituted with 0-3 R's; R' is selected from hydroxyl, C 1~3 Alkoxy; R 11 and R 12 Each is independently selected from hydrogen and C. 1~3 Alkyl or C 1~3 Alkyl group.
3. The use according to claim 2, characterized in that: The structure of the compound is shown in Formula II: Formula II Among them, R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 11 R 12 As described in claim 2.
4. The use according to claim 2, characterized in that: The structure of the compound is shown in Formula III: Formula III Among them, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 As described in claim 2, and R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 One or more of the following are .
5. The use according to claim 1, characterized in that: The compound is selected from one of the following compounds: 。