Preparation method and application of high-bioactivity type I recombinant humanized collagen

Abstract

This invention discloses a method for preparing highly bioactive type I recombinant humanized collagen and its applications. The nucleotide sequence of the type I recombinant collagen is obtained by repeating the nucleotide sequence of the repeating unit shown in SEQ ID NO: 1 n times; where n is an integer greater than or equal to 1. The type I recombinant collagen of this invention has good stability, cell proliferation, cell adhesion, cell migration and differentiation capabilities, and can be widely used in cosmetics, medical and other fields.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biotechnology, specifically relating to a method for preparing highly bioactive type I recombinant humanized collagen and its application. Background Technology

[0002] Collagen is one of the most abundant proteins in the human body. It is widely distributed in connective tissues such as skin, bone, cartilage, tendons, and ligaments, accounting for approximately 30% of total body protein, about 75% of skin protein, and about 85% of tendon protein. Collagen is hailed as the "soft gold" for youthful skin, playing a vital role in maintaining tissue stability and integrity, and promoting tissue regeneration. Its unique triple helix structure gives it excellent mechanical strength and biomechanical stability, making it crucial in physiological processes such as cell proliferation, differentiation, adhesion, migration, and tissue repair and regeneration. Therefore, it has wide applications in wound healing, medical aesthetics, and tissue engineering.

[0003] Collagen sources are mainly divided into traditional animal-derived extraction and recombinant preparation via genetic engineering. Due to numerous issues associated with animal-derived collagen extraction, including immunogenicity risks, potential viral and pathogen contamination, poor quality stability, and ethical and environmental concerns, recombinant collagen technology has emerged to address these problems. Recombinant collagen involves introducing the gene encoding human collagen into host cells using genetic engineering techniques, followed by expression, separation, and purification to obtain the collagen product. Compared to animal-derived collagen, recombinant collagen offers advantages such as lower immunogenicity, higher safety, and controllable quality.

[0004] To date, scientists have identified 29 different subtypes of collagen, among which type I collagen (COLI) is the most widely distributed and abundant subtype in the human body, extensively found in various tissues such as skin, blood vessels, tendons, bones, fascia, and cornea. Type I collagen typically consists of a heterotrimer composed of two α1 chains and one α2 chain, tightly intertwined by hydrogen bonds to form a stable triple helix structure. Specific amino acids on the peptide chain, such as proline (Pro), glycine (Gly), and hydroxyproline (Hyp), lay the foundation for the formation and stability of the triple helix structure. In the extracellular environment, the triple helix structure of type I collagen molecules further spontaneously assembles and arranges to form a fibrous supramolecular structure, thereby endowing tissues with good mechanical properties and maintaining the stability of structures such as bones and skin. Summary of the Invention

[0005] The purpose of this section is to outline some aspects of the embodiments of the present invention and to briefly describe some preferred embodiments.

[0006] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0007] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a highly bioactive type I recombinant humanized collagen.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a highly bioactive type I recombinant humanized collagen, wherein the nucleotide sequence of the type I recombinant collagen is obtained by repeating the nucleotide sequence of the repeating unit shown in SEQ ID NO: 1 n times; wherein n is an integer greater than or equal to 1.

[0009] As a preferred embodiment of the type I recombinant humanized collagen of the present invention, wherein the amino acid sequence of the repeating unit is shown in SEQ ID NO: 2.

[0010] In a preferred embodiment of the type I recombinant humanized collagen of the present invention, n is 8.

[0011] Another objective of this invention is to overcome the shortcomings of the prior art and provide a method for preparing type I recombinant humanized collagen, comprising: The target gene fragment obtained by repeatedly repeating the gene sequence shown in SEQ ID NO. 1 was cloned into the pET-32M-3C vector using BamHI and XhoI restriction sites to obtain the pET-32M-3C-COL1-1 recombinant plasmid. The obtained pET-32M-3C-COL1-1 recombinant plasmid was digested with NdeI enzyme to remove the TRX tag, resulting in pET-M-3C-COL1-1-1 recombinant plasmid. The recombinant plasmid pET-32M-3C-COL1-1 and the two plasmids pET-M-3C-COL1-1-1 were transformed into BL21(DE3) competent cells by heat shock method. The cells were then plated on LB solid plates containing ampicillin and cultured at an incubator to obtain the transformant library. The selected positive clones were inoculated into LB liquid medium and cultured. IPTG was added to induce expression. The bacterial cells were collected, crushed by high pressure, and the supernatant was collected by centrifugation. The supernatant was purified by passing it through a nickel column and dialyzed to obtain type I recombinant humanized collagen COL1-1 and COL1-1-1.

[0012] As a preferred embodiment of the method for preparing type I recombinant humanized collagen according to the present invention, wherein the protein concentration of the type I recombinant collagen, as determined by the BCA kit, is 10.69 mg / mL for COL1-1 and 3.17 mg / mL for COL1-1-1.

[0013] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of type I recombinant humanized collagen in the preparation of pharmaceuticals and cosmetics that promote cell proliferation, cell adhesion, cell migration, and cell differentiation.

[0014] As a preferred embodiment of the application described in this invention, the medicine includes a wound dressing medicine, a cartilage tissue repair scaffold medicine, and a skin repair medicine.

[0015] As a preferred embodiment of the application described in this invention, the cosmetic includes lotion, serum, and face cream.

[0016] Beneficial effects of this invention: (1) The type I recombinant collagen used in this invention is derived from a highly bioactive gene fragment in a human sequence, which has high biocompatibility and safety, thereby reducing the risk of immunogenicity.

[0017] (2) The present invention uses the Escherichia coli expression system and achieves efficient expression of type I recombinant collagen by optimizing the gene sequence and induction expression conditions. The concentration of type I collagen pET-32M-3C-COL1-1 after purification is 10.69 mg / mL and pET-M-3C-COL1-1-1 is 3.17 mg / mL, which provides a basis for large-scale production.

[0018] (3) In the preparation process, the present invention uses NdeI enzyme to remove the TRX tag, which reduces the influence of the TRX tag on the protein conformation and active site, making the protein closer to the natural state, improving the bioactivity of type I recombinant collagen, and thus better applying it in medicine.

[0019] (4) The type I recombinant collagen prepared by this invention has good stability and excellent ability to promote osteoblast adhesion, proliferation, migration and differentiation, and has broad application prospects in tissue engineering, medicine and beauty skin care. Attached Figure Description

[0020] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein: Figure 1 A schematic diagram of the construction of recombinant plasmids for type I recombinant collagen pET-32M-3C-COL1-1 and pET-M-3C-COL1-1-1 in this embodiment of the invention.

[0021] Figure 2The agarose gel electrophoresis results after digestion with type I recombinant collagenase in this embodiment of the invention are shown in the figure.

[0022] Figure 3 This is an SDS-PAGE gel image showing the expression of type I recombinant collagen COL1-1 and COL1-1-1 in an embodiment of the present invention.

[0023] Figure 4 This is the linear regression equation for the content of type I recombinant collagen in this embodiment of the invention.

[0024] Figure 5 The image shows the circular dichroism chromatograms of type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention.

[0025] Figure 6 The image shows the ultracentrifugation analysis results of type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention.

[0026] Figure 7 This is an SDS-PAGE gel image showing the stability of type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention.

[0027] Figure 8 The images shown are fluorescent images of type I recombinant collagen COL1-1 and COL1-1-1 cell adhesion in embodiments of the present invention. The positive control is commercially available type I recombinant collagen, and the negative control is D-PBS.

[0028] Figure 9 This is a graph showing the cell adhesion promotion results of type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention.

[0029] Figure 10 The results of the detection of cell proliferation activity of type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention are shown. The positive control is commercial type I recombinant collagen.

[0030] Figure 11 These are microscopic images of type I recombinant collagen COL1-1 and COL1-1-1 promoting cell migration in embodiments of the present invention. The positive control is commercially available type I recombinant collagen, and the negative control is PBS.

[0031] Figure 12 This is a graph showing the results of cell migration promotion by type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention.

[0032] Figure 13 This is a diagram showing the cell differentiation results of type I recombinant collagen COL1-1 and COL1-1-1 in the embodiments of the present invention.

[0033] Figure 14 This is an SDS-PAGE gel image showing the expression of type I recombinant collagen in the comparative example of this invention. Detailed Implementation

[0034] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0035] Example 1 The type I recombinant collagen provided by this invention is formed by repeating a highly bioactive unit sequence eight times, and the nucleotide sequence of the repeating unit is shown in SEQ ID NO: 1.

[0036] SEQ ID NO: 1: GGTCCGCGTGGTCCGCCGGGTCCGCCGGGTAAAAACGGTGATGATGGTGAAGCTGGTAAACCGGGTCGTCCGGGTGAACGTGGTCCGCCGGGTCCGCAGGGTGCTCGT The amino acid sequence is shown in SEQ ID NO: 2.

[0037] SEQ ID NO: 2: GPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGAR The specific method for constructing type I recombinant collagen plasmids is as follows: (1) The target gene fragment obtained by repeating the gene sequence shown in SEQ ID NO. 1 eight times is shown in SEQ ID NO: 3.

[0038] SEQ ID NO: 3 GPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGARGPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGARGPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGARGPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGAR GPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGARGPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGARGPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGARGPRGPPGPPGKNGDDGEAGKPGRPGERGPPGPQGAR The target gene fragment obtained by tandem was cloned into the pET-32M-3C vector using BamHI and XhoI restriction sites. (The pET-32M-3C vector is a modified version of Novagen's pET-32a vector, retaining the TrxA and 6×His tags, but replacing the original restriction sites with HRV 3C protease restriction sites, making subsequent tag removal more efficient and specific. The multiple cloning site (MCS) was redesigned.) Figure 1 (a) shows that it contains BamHI and XhoI, and the target sequence (COL1-1) is inserted. 6×His tags are added to both ends of the MCS to facilitate bidirectional fusion expression and purification. The recombinant plasmid pET-32M-3C-COL1-1 (synthesized by Genewiz Biotechnology Co., Ltd.) was obtained from [the sample / data]. The map of the pET-32M-3C-COL1-1 recombinant plasmid is shown below. Figure 1 As shown in (a), the target gene COL1-1 sequence is inserted into the restriction endonuclease sites (BamHI, XhoI) and a 6His tag is added to facilitate subsequent protein purification. The vector also includes a solubilizing tag TRX to enhance the solubility of the target protein, an ampicillin resistance gene to screen strains, a T7 promoter to drive the transcription of the target gene, and a T7ter terminator to terminate the transcription process.

[0039] (2) Construction of recombinant plasmid pET-M-3C-COL1-1-1 The obtained pET-32M-3C-COL1-1 recombinant plasmid was digested with NdeI enzyme to remove the TRX tag. The map of the pET-M-3C-COL1-1 recombinant plasmid is shown below. Figure 1As shown in (b), the enzyme digestion system consisted of 3 μL NdeI, 3 μL 10×Buffer, 8 μL recombinant plasmid, and 16 μL ddH2O, and was digested at 37℃ for 12 h. The enzyme digestion products were then subjected to agarose gel electrophoresis (100V, 200mA, 30min), and the gel electrophoresis results were observed using a UV spectrometer. The results are as follows: Figure 2 As shown, the target band circled on the gel image was cut off with a knife. The target band was then weighed using an electronic balance (0.11 g). The target band was recovered using a gel recovery kit (Tiangen Biotech (Beijing) Co., Ltd.). The linear plasmid was ligated using T4 ligase. The ligation system consisted of 0.2 μL of T4 ligase, 2 μL of 10×T4 buffer, 7.8 μL of ddH2O, and 10 μL of linear plasmid. The mixture was incubated at 25 °C for 3 h to obtain the recombinant plasmid pET-M-3C-COL1-1-1. Example 2 Expression and purification of type I recombinant collagen: 1. Screening of Escherichia coli genetically engineered strains for high-efficiency expression of type I recombinant collagen. The two recombinant plasmids pET-32M-3C-COL1-1 and pET-M-3C-COL1-1-1 were transformed into Escherichia coli BL21(DE3) competent cells (42℃ metal bath heat shock, 1 min 15 s), spread on LB solid plates containing 100 ug / mL ampicillin, and cultured at 37℃ in a shaker for 12 h to obtain two highly efficient Escherichia coli genetically engineered strains carrying the target gene.

[0040] 2. Expand cultivation The selected positive clones were inoculated into 1L LB liquid medium (containing 100μg / mL ampicillin) and cultured at 37℃ and 220rpm in a shaker until OD 600nm = 0.8. IPTG inducer (300uL) was added and expression was induced at 16℃ and 220rpm for 24h. The cells were then collected by centrifugation at 4000rpm, washed with an appropriate amount of distilled water, and centrifuged at 8000rpm for 10min at low temperature. The supernatant was discarded and the cells were collected.

[0041] 3. Preliminary protein extraction Add appropriate amounts of binding buffer (10 mM imidazole, 50 mM Tris, 0.5 M NaCl, pH=7.9, 50 mL) to the collected two types of bacterial cells (1000 mL each), and add 750 μL of PMSF to protect the target protein from degradation by bacterial proteases. The cells are then disrupted using a high-pressure homogenizer (above 900 Pa, 5 min). The disrupted liquid is centrifuged at 8000 rpm and 4 °C for 30 min. The supernatant after centrifugation is filtered (using a 0.45 μm aqueous filter membrane) to remove impurities, yielding the two types of preliminarily extracted type I recombinant collagen.

[0042] 4. Protein purification by nickel column affinity chromatography The supernatant of the pre-extracted and filtered type I recombinant collagen was added to a pre-equilibrated nickel column (Ni column packing material was Beads, purification column volume was 60 mL, affinity chromatography column was AC column). Under low temperature conditions, the protein was thoroughly bound to the nickel column packing material by shaking for 1 h. The bottom plug of the column was opened to collect 1 mL of flow solution, and the remaining flow solution was allowed to drain. Then, binding buffer (10 mM imidazole, 50 mM Tris, 0.5 M NaCl, pH=7.9) was added, and the column was washed 3-4 times to remove proteins that were not fully bound to the nickel column packing material (wash 1 and wash 2 were collected during this process for subsequent SDS-PAGE gel testing to verify whether the rinsing was complete). Cover the column with the plug, add 5 mL of elution buffer (0.5 M NaCl, 0.5 M imidazole, 100 mM imidazole), bind to the nickel column packing for the first time for 10 min, collect the first elution buffer, then add another 5 mL of elution buffer, bind to the nickel column packing for the second time for 10 min, collect the second elution buffer. The eluents from the first and second collections were then mixed together and added to the nickel column packing. The mixture was then combined with the nickel column packing for a third time for 10 minutes to obtain the nickel-purified type I recombinant collagen.

[0043] 5. Desalting of protein The eluent obtained in step 4 was added to a dialysis bag (MD 44-3500). The dialysis bag was placed in PBS buffer and dialyzed at 4°C with stirring for 6 hours. A high concentration of imidazole (500 mM, volume ratio of imidazole to PBS 1:625) was added to the PBS to reduce the imidazole concentration and avoid affecting subsequent cell experiments. The dialysis-desalted type I recombinant collagen COL1-1 and COL1-1-1 were obtained.

[0044] The supernatant, precipitate, runner, rinse 1, rinse 2, elution buffer, and dialysate of COL1-1 and COL1-1-1 obtained above were added to Loading Buffer and heated in a metal bath at 100℃ for 10 min to denature the protein. SDS-PAGE gel electrophoresis was then performed to verify protein expression. The results are as follows: Figure 3 As shown, the protein was successfully expressed.

[0045] The concentration of type I recombinant collagen was determined using a BCA protein quantification kit. A standard curve was plotted by measuring the absorbance at 562 nm. Figure 4 As shown, the linear regression equation for the obtained protein content is y = 0.118 + 0.146x, R0 2 =0.999, close to 1, indicating a good correlation; The protein concentrations calculated from the standard curve were 10.69 mg / mL for COL1-1 and 3.17 mg / mL for COL1-1-1.

[0046] Example 3 Biochemical analysis of type I recombinant collagen: 1. Circular dichroism spectroscopy analysis The secondary structure of type I recombinant collagen was analyzed using a MOS-450 circular dichroism chromatograph. The concentration of type I recombinant collagen was diluted to 0.1 mg / mL using PBS buffer. The instrument parameters were set as follows: wavelength range: 180-260 nm, scan speed: 50 nm / min, average value after multiple scans, scan mode: continuous scan, broadband 1 nm, temperature: 25℃.

[0047] First, baseline calibration was performed using a buffer solution, and then the protein solution was scanned to obtain the CD spectrum, which was then plotted using Origin.

[0048] like Figure 5 As shown in (a), the curve shows a positive peak at 190 nm and a negative peak at 200 nm. This peak shape is common in the α-helix structure of proteins, indicating that pET-32M-3C-COL1-1 has an α-helix structure; Figure 5 As shown in (b), the curve has a small positive peak at 190 nm, followed by a deep negative peak at 200–210 nm, indicating that pET-M-3C-COL1-1-1 is a mixed structure of β-sheets and random coils.

[0049] 2. Ultracentrifugation analysis The sedimentation velocity analysis of type I recombinant collagen was performed using a Beckman Optima XL-I ultracentrifuge.

[0050] Type I recombinant collagen was diluted to 1 mg / mL with PBS buffer and centrifuged at 50,000 r / min and 4 °C. The detection wavelength was set to 220-280 nm, and the concentration distribution of the protein solution in the centrifuge tube was scanned every 5 min for 2 h until the sedimentation boundary was clear.

[0051] The obtained SV-AUC data was processed using Sedfit software, such as... Figure 6 As shown, pET-32M-3C-COL1-1 exhibits a wide range of polydispersities and high molecular weight aggregates, while pET-M-3C-COL1-1-1 tends to be a low molecular weight component.

[0052] Example 4 Stability of type I recombinant collagen: The stability of the protein was verified by SDS-PAGE gel electrophoresis. The type I recombinant collagen obtained in step 5 of Example 2 was placed at 4℃ and 37℃ for 16 days, respectively. During this period, samples were taken every other day at 0d, 2d, 4d, 6d, 8d, 10d, 12d, 14d and 16d. like Figure 7 As shown, the protein did not degrade at 4℃, but degraded to some extent at 37℃. Furthermore, the stability of COL1-1 was better than that of COL1-1-1, indicating that the protein has good stability under low temperature conditions and that the TRX tag has a certain influence on the stability of the protein.

[0053] Example 5 In vitro cell experiments of type I recombinant collagen: 1. Cell adhesion The steps involved in cell adhesion include coating, blocking, cell seeding, and staining and testing.

[0054] Coating: Add 100 μL of type I recombinant collagen COL1-1 and COL1-1-1 (concentrations of 1 mg / mL and 2 mg / mL) obtained in step 5 of Example 2, commercially available type I recombinant collagen (positive control is commercially available recombinant collagen purchased from Viimei, concentrations of 1 mg / mL and 2 mg / mL), and D-PBS (negative control) to each well of a 96-well plate. Set up 3 replicates in each group, coat in an incubator for 4 h, discard the liquid in the wells, and wash 3 times with PBS to remove unbound collagen.

[0055] Blocking: Add 100 μL of 1% BSA-PBS solution to each well and incubate in an incubator for 1 h to block non-specific adsorption on the surface of the plate. Discard the liquid in the wells and wash three times with PBS to remove any residual washing liquid.

[0056] Cell seeding: The concentration of NIH / 3T3 cells (Tianjin Huayu Biotechnology Co., Ltd.) was diluted to 5×10⁻⁶ with complete culture medium (10 mL fetal bovine serum, 1 mL penicillin-streptomycin solution, and 89 mL DMEM basal medium) premixed with Hoechst 33342 fluorescent staining agent (10% by volume). 4 Cells / mL were added to each well with 100 μL of cell suspension, covered with aluminum foil, and incubated at 37°C in a 5% CO2 incubator for 1 h.

[0057] Staining and detection: Discard the culture medium in the wells, wash three times with PBS to remove unattached cells, and use the CCK8 assay to detect the cell count in the 96-well plate. Take photographs under a microscope. Figure 8 As shown; the number of fluorescent dots in the image was counted using ImageJ software, and the relative cell adhesion promotion rate was calculated, as shown. Figure 9 As shown.

[0058] Figure 9 The results showed that the type I recombinant collagen prepared in this invention had better cell adhesion promotion ability. The relative cell adhesion promotion rates of COL1-1 and COL1-1-1 were higher than those of the standard protein, and there was no significant difference between the two.

[0059] 2. Cell proliferation The steps involved in cell proliferation include cell seeding, sample processing, and CCK-8 assay.

[0060] Cell seeding: NIH / 3T3 cells (Tianjin Huayu Biotechnology Co., Ltd.) in logarithmic growth phase were digested with 0.25% trypsin-EDTA, centrifuged, and the supernatant was discarded. The cells were resuspended in complete culture medium and the cell concentration was adjusted to 5 × 10⁶ cells / year. 3 Cells / mL were used to obtain a cell suspension; Add 100 μL of cell suspension to each well of a 96-well plate, gently shake the plate to distribute the cells evenly, and incubate at 37°C for 24 hours to allow the cells to adhere.

[0061] Sample preparation: Discard the liquid in the 96-well plate, and add 10 μL of complete culture medium (10 mL fetal bovine serum, 1 mL penicillin-streptomycin solution, and 89 mL DMEM) containing different concentrations of recombinant collagen (0.1 mg / mL, 0.5 mg / mL, 1 mg / mL, 2 mg / mL), positive control (commercial recombinant collagen purchased from Viimei, with concentrations of 0.1 mg / mL, 0.5 mg / mL, 1 mg / mL, and 2 mg / mL), and negative control (PBS) to each well. Incubate the plate and continue to culture. Detection is performed at 6 h, 12 h, 24 h, and 48 h.

[0062] CCK-8 method detection: Add 10 μL of CCK-8 solution to each well (Note: Avoid generating air bubbles in the well. If air bubbles are present, remove them with a pipette, as they will affect the OD value reading). The culture plate was incubated in a 37°C incubator in the dark for 2 hours, and the absorbance at 450 nm was measured using an ELISA reader.

[0063] Result calculation: A (with sample): Absorbance of the pore containing cells, CCK-8 solution, and sample solution; A (blank): Absorbance of pores containing culture medium and CCK-8 solution but without cells; A (0 plus test sample): Absorbance of the well containing cells and CCK-8 solution but not the test sample solution.

[0064] Figure 10 The results showed that the type I recombinant collagen prepared in this invention had better cell proliferation activity. At concentrations of 0.5 mg / ml, 1 mg / ml and 2 mg / ml, the cell proliferation ability of both proteins was better than that of the standard protein over time. Moreover, the cell proliferation activity of COL1-1-1 was better than that of COL1-1, indicating that the TRX tag has a certain influence on the cell proliferation activity of the protein.

[0065] 3. Cell migration Pretreatment of the well plate: On the back of the 6-well cell culture plate, use a pen to draw lines in thirds horizontally and vertically to form clear markings for easy observation later.

[0066] Cell seeding and culture: Seed approximately (5-15) × 10 cells per well. 5 Cells were cultured in a 37°C incubator for 24 hours to achieve a confluence of 95%-100% cells. Three replicate wells were set up for each experiment.

[0067] Cell scratch assay: Before cell culture, draw three parallel horizontal lines on the bottom of each well of a 6-well plate with a pen as control lines for subsequent observation. After 24 hours of cell culture, a 10 μL pipette tip was used to gently push down along the horizontal line at the bottom of the well plate with a ruler to form a longitudinal scratch. The cells in the wells were washed three times with PBS to remove the scratched cell debris. 2 mL of serum-free medium with a concentration of 0.5 mg / mL was added to the type I recombinant collagen (0.5 mg / mL). 2 mL of serum-free medium with a concentration of 0.5 mg / mL was added to the positive control group (commercial recombinant collagen, purchased from Viimei, concentration 0.5 mg / mL). 2 mL of serum-free medium was added to the blank control group.

[0068] Observation and Photography: Six-well plates cultured in the incubator were observed and photographed at 0h and 24h of culture. The intersection of the horizontal and vertical lines at the bottom of the wells was used as the core observation area, and photographs were taken using a 40x microscope. Figure 11 As shown.

[0069] Data processing: Imagej software was used to process the cell images taken at 0h and 24h. The area of ​​the scratch region in each image was measured. The area of ​​the initial scratch region at 0h minus the area of ​​the scratch region at 24h gives the area of ​​cell migration. Dividing this by the initial scratch region area gives the cell migration rate. Figure 12 As shown.

[0070] Figure 10 The results showed that the cell migration-promoting ability of the type I recombinant collagen prepared in this invention was better than that of the positive control, and the cell migration-promoting ability of COL1-1-1 was significantly better than that of COL1-1, indicating that the TRX tag has a certain influence on the cell migration-promoting ability of the protein.

[0071] 4. Cell differentiation Coating preparation: Add 2 mL of commercially available protein (positive control, purchased from Viimei), recombinant collagen COL1-1 and COL1-1-1 solution (0.5 mg / mL), and D-PBS solution (negative control) to each of the 6 wells.

[0072] Two wells were prepared for each sample coating and incubated in a 37°C incubator for 2 hours. After discarding the coating solution, 2 mL of 1% BSA-PBS solution was added and incubated in a 1 hour incubator. After discarding the solution in the wells, the samples were washed three times with D-PBS solution. After discarding the washing solution, the samples were sealed with sealing film and stored in a 4°C refrigerator for later use.

[0073] Cell seeding and induction treatment: Digest logarithmic growth phase cells with 0.25% trypsin, incubate at 37℃ for 1-2 min, centrifuge the cell suspension for 5 min, discard the supernatant, add complete culture medium, and adjust the cell concentration to 5×10⁶ cells / mL. 4 Add 1 mL of cell suspension to a pre-prepared 6-well coated plate and gently shake the plate to distribute the cells evenly on the coating surface. Place the 6-well plate in a 37°C incubator and incubate for 4 days, observing cell morphology using an inverted microscope during this period.

[0074] RT-PCR detection of cell differentiation markers: Cell differentiation markers (such as α-SMA, Vimentin, Cadherin-11) were measured using RT-PCR. Cell culture plates without recombinant collagen coating and national standard collagen were used as controls to compare and analyze the cell differentiation-promoting effect of recombinant collagen.

[0075] Data processing: The Ct value of the internal reference gene (MGAPDH) was used as a reference, and 2... (-ΔΔCt) The relative expression levels of target genes (α-SMA, Vimentin, Cadherin-11) were calculated using the following formula: ΔCt = Target gene Ct value - Internal reference gene Ct value (same sample) Relative expression level = 2 (-ΔΔCt) .

[0076] Figure 13 The results showed that, compared with the positive control, the relative expression levels of the mesenchymal marker Vimentin and the epithelial marker Cadherin-1 of COL1-1-1 prepared in this invention were significantly higher than those of the positive control. However, the relative expression levels of the mesenchymal marker Vimentin and the epithelial marker Cadherin-1 of COL1-1 were slightly lower than those of the positive control.

[0077] The relative expression levels of α-SMA in COL1-1 and COL1-1-1 showed no significant difference compared to the positive control. This indicates that the type I recombinant collagen prepared in this invention has a certain ability to promote cell differentiation, and pET-M-3C-COL1-1-1 has a better ability to promote cell differentiation, suggesting that the TRX tag has a certain influence on the cell differentiation ability of the protein.

[0078] While the TRX tag has some predictive power regarding cell differentiation ability, it also has limitations. The TRX tag itself possesses cell differentiation-promoting ability, but due to its relatively large molecular weight (approximately 12 kDa), it interferes with the binding of cell surface receptors to type I collagen, thus affecting its cell differentiation-promoting ability. Furthermore, the TRX tag itself exhibits heterologous immunogenicity. In this invention, removing the TRX tag enhances cell differentiation ability. The fundamental reason is the removal of steric hindrance and interference from non-targeting activities, allowing the recombinant type I collagen to maintain its natural structure and functional targeting.

[0079] Comparative Example 1 Under the experimental conditions of Example 1, the sequence shown in SEQ ID NO: 2 was replaced with SEQ ID NO: 4, and everything else was the same as in Example 1; SEQ ID NO: 4: GERGVPGPPGAVGPAGKDGEAGAQGPPGPAGPAGER Following the conditions in Example 3, the obtained plasmid was transformed into *E. coli* and induced to express. SDS-PAGE gel electrophoresis was performed to verify protein expression. The results are as follows: Figure 14 As shown, the protein expression level in the supernatant is very low, and the protein is almost entirely in the precipitate, which is a phenomenon of inclusion bodies.

[0080] In summary, this invention uses conventional type I recombinant collagen as a positive control in cell experiments. Experimental results show that the type I recombinant collagen prepared in this invention exhibits superior cell adhesion, cell proliferation, cell migration, and cell differentiation effects compared to conventional type I recombinant collagen, as detailed below: 1. Cell adhesion effect Compared with the cell adhesion effect of conventional type I recombinant collagen, the type I recombinant collagen provided by this invention has higher cell adhesion efficiency and stronger cell adhesion ability. The adhesion-promoting ability of different treatment groups on NIH / 3T3 cells was detected using the Hoechst 33342 fluorescence staining method.

[0081] Experimental results showed that at a protein concentration of 1 mg / mL, the average relative cell adhesion promotion rate of COL1-1 provided by this invention was 138.78%, and that of COL1-1-1 was 134.17%, while the average relative cell adhesion promotion rate of conventional type I recombinant collagen was 104.43%. At a protein concentration of 2 mg / mL, the average relative cell adhesion promotion rate of COL1-1 provided by this invention was 137.87%, and that of COL1-1-1 was 132.28%, while that of conventional type I recombinant collagen was 103.39%. Therefore, it is evident that the cell adhesion promotion abilities of the two type I recombinant collagens provided by this invention are superior to those of conventional type I recombinant collagen.

[0082] 2. Cell proliferation effect Compared with the cell proliferation effect of conventional type I recombinant collagen, the type I recombinant collagen provided by this invention has a more significant enhancement of cell activity and a stronger ability to promote cell proliferation. The effects of different concentrations (0.1 mg / mL, 0.5 mg / mL, 1 mg / mL, and 2 mg / mL) of type I recombinant collagen on cell proliferation capacity at culture times of 6 h, 12 h, 24 h, and 48 h were detected using the CCK-8 assay.

[0083] Experimental results showed that COL1-1-1 exhibited the best cell proliferation ability at a concentration of 0.1 mg / mL, reaching its peak at 12 h, significantly higher than conventional type I recombinant collagen. At a concentration of 0.5 mg / mL, both COL1-1 and COL1-1-1 demonstrated stronger cell proliferation abilities than conventional type I recombinant collagen at 12 h, 24 h, and 48 h of culture time. At concentrations of 1 mg / mL and 2 mg / mL, with increasing culture time, the cell proliferation abilities of both COL1-1 and COL1-1-1 provided by this invention were superior to conventional type I recombinant collagen.

[0084] 3. Cell migration effect Compared with conventional type I recombinant collagen, the type I recombinant collagen provided by this invention has better repair potential and stronger cell migration ability. The effect of type I recombinant collagen on the migration ability of NIH / 3T3 cells was evaluated using a scratch healing assay.

[0085] Experimental results show that the average cell migration rate of COL1-1-1 prepared in this invention is 22.66%, the average cell migration rate of COL1-1 is 7.65%, while the average cell migration rate of conventional type I recombinant collagen is 5.88%. This indicates that the cell migration ability of the two types of type I recombinant collagen prepared in this invention is superior to that of conventional type I recombinant collagen.

[0086] 4. Cell differentiation effect Compared with the cell differentiation effect of conventional type I recombinant collagen, the type I recombinant collagen provided by this invention has stronger functional regeneration capacity and stronger cell differentiation promotion ability. RT-PCR was used to detect cell differentiation markers, and then the cell differentiation promotion ability of type I recombinant collagen was compared and analyzed.

[0087] Experimental results showed that the relative expression levels of α-SMA in COL1-1 and COL1-1-1 were not significantly different from those in conventional type I recombinant collagen, indicating that the induction effect of these two collagens on α-SMA was comparable to that of conventional type I recombinant collagen. The relative expression levels of Vimentin and Cadherin-11 in COL1-1-1 were significantly higher than those in conventional type I recombinant collagen, while the relative expression levels of Vimentin and Cadherin-11 in COL1-1-1 were significantly lower than those in conventional type I recombinant collagen. In conclusion, the differentiation-promoting ability of COL1-1-1 provided by this invention is significantly stronger than that of conventional type I recombinant collagen.

[0088] In summary, the type I recombinant collagen provided by this invention has significant advantages over conventional type I recombinant collagen in core applications such as expression level, stability, cell adhesion, cell proliferation, cell migration, and cell differentiation. Furthermore, the type I recombinant collagen prepared by this technical solution has advantages such as low production cost, high expression efficiency, and suitability for large-scale fermentation production. It solves many problems in the production and application of conventional type I recombinant collagen and has broad application prospects in tissue repair scaffolds, wound dressings, medical aesthetics, and cosmetics.

[0089] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. A highly bioactive type I recombinant humanized collagen, characterized in that: The nucleotide sequence of the type I recombinant collagen is obtained by repeating the nucleotide sequence of the repeating unit shown in SEQ ID NO: 1 n times; where n is an integer greater than or equal to 1.

2. The type I recombinant humanized collagen as described in claim 1, characterized in that: The amino acid sequence of the repeating unit is shown in SEQ ID NO:

2.

3. The type I recombinant humanized collagen as described in claim 1 or 2, characterized in that: The value of n is 8.

4. The method for preparing type I recombinant humanized collagen according to any one of claims 1 to 3, characterized in that: include, The target gene fragment obtained by repeatedly repeating the gene sequence shown in SEQ ID NO. 1 was cloned into the pET-32M-3C vector using BamHI and XhoI restriction sites to obtain the pET-32M-3C-COL1-1 recombinant plasmid. The obtained pET-32M-3C-COL1-1 recombinant plasmid was digested with NdeI enzyme to remove the TRX tag, resulting in pET-M-3C-COL1-1-1 recombinant plasmid. The recombinant plasmid pET-32M-3C-COL1-1 and the two plasmids pET-M-3C-COL1-1-1 were transformed into BL21(DE3) competent cells by heat shock method. The cells were then plated on LB solid plates containing ampicillin and cultured at an incubator to obtain the transformant library. The selected positive clones were inoculated into LB liquid medium and cultured. IPTG was added to induce expression. The bacterial cells were collected, crushed by high pressure, and the supernatant was collected by centrifugation. The supernatant was purified by passing it through a nickel column and dialyzed to obtain type I recombinant humanized collagen COL1-1 and COL1-1-1.

5. The preparation method according to claim 4, characterized in that: The protein concentration of the type I recombinant collagen was determined using a BCA kit to be 10.69 mg / mL for COL1-1 and 3.17 mg / mL for COL1-1-1.

6. The use of the type I recombinant humanized collagen according to any one of claims 1 to 3 in the preparation of pharmaceuticals and cosmetics that promote cell proliferation, cell adhesion, cell migration and cell differentiation.

7. The application as described in claim 6, characterized in that: The drugs include wound dressing drugs, cartilage tissue repair scaffold drugs, and skin repair drugs.

8. The application as described in claim 6, characterized in that: The cosmetics include lotions, serums, and creams.

Images