An enzyme preparation for catalyzing the synthesis of phytosphingosine and a method for synthesizing phytosphingosine

By using mutated squalinositol dehydrogenase and muscle inositol dehydrogenase, combined with NADH oxidase and formate dehydrogenase, highly efficient catalytic synthesis of epiinositol was achieved, solving the problems of low conversion rate and high cost, increasing yield and reducing production cost.

CN122303169APending Publication Date: 2026-06-30ZHUCHENG HAOTIAN PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610514502.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-17
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In existing technologies, the conversion rate of epiinositol is low and the production cost is high, while the cofactor NADH is a one-time consumption with a high initial dosage.

Method used

By using mutated squalene dehydrogenase and muscle inositol dehydrogenase, combined with NADH oxidase and formate dehydrogenase, in-situ regeneration of the cofactor NADH is achieved, thereby increasing the yield and conversion rate of epiinositol.

Benefits of technology

It significantly improved the yield and conversion rate of epiinositol and reduced production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303169A_ABST
    Figure CN122303169A_ABST
Patent Text Reader

Abstract

This invention discloses an enzyme preparation for catalytic synthesis of epiinositol and a method for synthesizing epiinositol, belonging to the field of genetic engineering technology. The enzyme preparation includes squalinositol dehydrogenase, NADH oxidase, formate dehydrogenase, and muscle inositol dehydrogenase; the amino acid sequence of squalinositol dehydrogenase is shown in SEQ ID NO. 6, and the amino acid sequence of muscle inositol dehydrogenase is shown in SEQ ID NO. 8. The enzyme activities of the squalinositol dehydrogenase mutant and the muscle inositol dehydrogenase mutant obtained by mutation in this invention are significantly increased, thus further improving the yield and conversion rate of epiinositol during catalytic synthesis. Furthermore, the enzyme preparation of this invention also contains NADH oxidase and formate dehydrogenase, achieving in-situ regeneration of NADH, thereby effectively reducing the amount of cofactors and NADH used in the catalytic synthesis of epiinositol, and thus reducing production costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an enzyme preparation for catalyzing the synthesis of epiinositol and a method for synthesizing epiinositol. Background Technology

[0002] Epi-inositol, an important stereoisomer of inositol, possesses unique physiological activities in areas such as anti-anxiety, regulation of skeletal muscle glucose absorption, and the preparation of functional foods and pharmaceutical intermediates, resulting in continuously growing market demand. Current methods for the biosynthesis of epi-inositol use muscle inositol as a substrate, utilizing squalene dehydrogenase and muscle inositol dehydrogenase to convert muscle inositol into epi-inositol. However, this method has the following drawbacks: first, the conversion rate of epi-inositol is low, leading to excessively high costs; second, cofactors... NADH is a one-time consumption, with a high initial dosage, which further increases the production cost of epiinositol. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide an enzyme preparation for catalytic synthesis of epiinositol and a method for synthesizing epiinositol, so as to overcome the problems of low conversion rate and high cost in the prior art when synthesizing epiinositol.

[0004] In a first aspect, the present invention provides an enzyme preparation for catalyzing the synthesis of epiinositol, the enzyme preparation comprising squalinositol dehydrogenase, NADH oxidase, formate dehydrogenase and muscle inositol dehydrogenase. The amino acid sequence of squalinositol dehydrogenase is shown in SEQ ID NO.6, and the amino acid sequence of muscle inositol dehydrogenase is shown in SEQ ID NO.8.

[0005] Compared with the prior art, the present invention mutates wild-type squalinositol dehydrogenase to obtain a squalinositol dehydrogenase mutant with the amino acid sequence shown in SEQ ID NO.6, and mutates wild-type muscle inositol dehydrogenase to obtain a muscle inositol dehydrogenase mutant with the amino acid sequence shown in SEQ ID NO.8. The enzyme activities of the squalinositol dehydrogenase mutant and the muscle inositol dehydrogenase mutant obtained by the present invention are significantly improved. Therefore, the yield and conversion rate of epiinositol can be further improved when catalyzing the synthesis of epiinositol.

[0006] Furthermore, the enzyme preparation of the present invention also contains NADH oxidase and formate dehydrogenase, wherein NADH oxidase can oxidize NADH to... Formate dehydrogenase can Reverting to NADH, thus achieving In-situ regeneration of NADH effectively reduces the cofactor requirements during the catalytic synthesis of epiinositol. The amount of NADH used was reduced, thereby lowering production costs.

[0007] Furthermore, the mass ratio of squalinositol dehydrogenase, NADH oxidase, formate dehydrogenase and muscle inositol dehydrogenase is (1~10):(1~10):(1~10):(1~10).

[0008] Furthermore, the method for modifying the enzyme activity of squalinositol dehydrogenase is as follows: The amino acid sequence shown in SEQ ID NO.1 has the following mutations: amino acid position 163 is changed from Y to A, amino acid position 167 is changed from Y to F, and amino acid position 260 is changed from R to K.

[0009] Furthermore, the method for modifying the enzyme activity of muscle inositol dehydrogenase is as follows: The amino acid at position 124 of the amino acid sequence shown in SEQ ID NO.3 is mutated from R to Q, and the amino acid at position 173 is mutated from Y to F.

[0010] Secondly, the present invention provides a method for preparing squalinositol dehydrogenase, which is applied to the above-mentioned enzyme preparation, comprising the following steps: An expression vector containing the squalinositol dehydrogenase gene was introduced into a host strain, and the resulting recombinant strain was fermented to induce the expression of the squalinositol dehydrogenase, resulting in recombinant strain 1 containing the squalinositol dehydrogenase.

[0011] Secondly, the present invention provides a method for preparing muscle inositol dehydrogenase, which is applied to the above-mentioned enzyme preparation, comprising the following steps: An expression vector containing the muscle inositol dehydrogenase gene was introduced into a host strain, and the resulting recombinant strain was fermented to induce the expression of the muscle inositol dehydrogenase, resulting in recombinant strain 2 containing the muscle inositol dehydrogenase.

[0012] Thirdly, the present invention provides a method for synthesizing epiinositol, which uses the above-mentioned enzyme preparation to synthesize epiinositol, comprising the following steps: The squalinositol dehydrogenase and the NADH oxidase are coupled. The squalinositol dehydrogenase catalyzes the reaction of muscle inositol to produce 1L-epio-2-inosaccharide. It is reduced to NADH; the NADH oxidase catalyzes the oxidation of NADH to... ; The muscle inositol dehydrogenase and the formate dehydrogenase are coupled together. The muscle inositol dehydrogenase catalyzes the reaction of 1L-epio-2-glycosyl to produce epiinositol, while NADH is oxidized to... The formate dehydrogenase uses sodium formate as a cosubstrate to... Restore to NADH.

[0013] Compared with existing technologies, this invention couples squalene dehydrogenase and NADH oxidase, achieving simultaneous generation of 1L-epio-2-inosaccharide during the reaction. In situ regeneration involves coupling muscle inositol dehydrogenase and formate dehydrogenase, achieving in situ regeneration of NADH while generating epiinositol, with cofactors... In-situ regeneration of NADH effectively reduces the initial amount of cofactors used in the catalytic synthesis of epiinositol, thereby reducing production costs.

[0014] Furthermore, the preparation method of the reaction system for generating 1 L of β-epio-2-glycogen is as follows: Add buffer solution, muscle inositol, to the reaction system The recombinant strain 1 containing squalinositol dehydrogenase and NADH oxidase was used to prepare a reaction system with a buffer concentration of 20-100 mM and a muscle inositol concentration of 1-100 mM. The concentrations of the enzyme were 1-10 mM, the concentration of recombinant strain 1 containing squalene dehydrogenase was 10-100 g / L, and the concentration of NADH oxidase was 1-10 g / L.

[0015] The preparation method for the reaction system to produce epiinositol is as follows: Metal ions, recombinant strain 2 containing muscle inositol dehydrogenase, formate dehydrogenase, and sodium formate were added to the reaction system after 1 L of β-epio-2-glycogen was generated. The concentrations of metal ions, recombinant strain 2 containing muscle inositol dehydrogenase, formate dehydrogenase, and sodium formate in the reaction system were 0.1-5 mM, 10-100 g / L, 1-10 g / L, and 100-150 mM, respectively.

[0016] Furthermore, the buffer may include Tris-HCl buffer, phosphate buffer, or HEPES buffer.

[0017] Furthermore, the metal ions include zinc ions, manganese ions, or magnesium ions.

[0018] Furthermore, the reaction temperature for generating 1L-epio-2-inosaccharide is 20~50℃, and the reaction pH is 6~10; preferably, the reaction temperature is 25~35℃, and the pH is 8~10.

[0019] Furthermore, the reaction temperature for generating epiinositol is 35~70℃, and the reaction pH is 6~10; preferably, the reaction temperature is 40~70℃, and the pH is 6~8. Detailed Implementation

[0020] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0021] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.

[0022] Example 1 Constructing recombinant plasmids containing the PksIDH gene Wild-type squalene dehydrogenase derived from Paracoccus kondratievae was selected, with its amino acid sequence shown in SEQ ID NO.1 and its gene sequence shown in SEQ ID NO.2.

[0023] The gene sequence PksIDH of the above-mentioned wild-type squalinositol dehydrogenase was artificially synthesized. Using the gene sequence PksIDH as a template, Inf-pYB1k-PksIDH-F as the upstream primer and Inf-pYB1k-PksIDH-R as the downstream primer, a PCR amplification reaction was performed using high-fidelity DNA polymerase to obtain the correct PksIDH gene fragment.

[0024] Inf-pYB1k-PksIDH-F: ggctaacaggaggaattaaccatgacggcgacccagaa (SEQ IDNO.9); Inf-pYB1k-PksIDH-R: gtaccagatctaccctcgaggaacagaaccggctgaccg (SEQ ID NO. 10).

[0025] Using the empty pYB1s vector as a template, pYB1s-F as the upstream primer, and pYB1s-R as the downstream primer, PCR amplification was performed using high-fidelity DNA polymerase to obtain the correct pYB1s expression vector fragment.

[0026] pYB1s-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO. 11); pYB1s-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO. 12).

[0027] The reaction systems for the two PCR amplification reactions are shown in Table 1. The reaction programs are as follows: pre-denaturation: 98℃ for 3 min; amplification cycle: 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 4.5 min, 32 cycles; extension: 72℃ for 10 min.

[0028] Table 1 Components volume 5×Phusion HF buffer (reaction buffer) 2μL dNTPs (2.5 mmol / L) (deoxyribonucleotides) 0.8μL template 0.2μL upstream primer 0.3μL Downstream primer 0.3μL DMSO (dimethyl sulfoxide) 0.3μL Phu high-fidelity DNA polymerase (2 U / μl) 0.1μL <![CDATA[ddH2O]]> 6μL The PksIDH gene fragment and pYB1s expression vector fragment obtained from the above PCR amplification reaction were ligated using the Gibson assembly method. The ligation was carried out at 50℃ for 60 min. The ligation reaction system is shown in Table 2.

[0029] Table 2 Components Volume (μL) pYB1s expression vector fragment 1 PksIDH gene fragment 3 2× Heiff Clone Enzyme Premix 5 Double distilled water (DDW) To 10 After the above ligation reaction was completed, the ligation product was added to *E. coli* DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. 600 μL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing streptomycin sulfate and incubated overnight at 37°C. Multiple single colonies were picked and cultured. Colony PCR was performed using universal primers for verification. Correctly verified colonies were extracted and sequenced. The correctly sequenced recombinant plasmid was named pYB1s-PksIDH.

[0030] Example 2 Constructing recombinant plasmids containing the GtIDH gene Wild-type muscle inositol dehydrogenase derived from *Geobaci1lus thermoleovorans* was selected, with its amino acid sequence shown in SEQ ID NO.3 and its gene sequence shown in SEQ ID NO.4.

[0031] The gene sequence GtIDH of the above-mentioned wild-type muscle inositol dehydrogenase was artificially synthesized. Using the gene sequence GtIDH as a template, Inf-pYB1k-GtIDH-F as the upstream primer and Inf-pYB1k-GtIDH-R as the downstream primer, a PCR amplification reaction was performed using high-fidelity DNA polymerase to obtain the correct GtIDH gene fragment.

[0032] Inf-pYB1k-GtIDH-F: ggctaacaggaggaattaaccatgacccgtgttaaagtg (SEQ IDNO.13); Inf-pYB1k-GtIDH-R:taccagatctaccctcgagtttagacagcgcggtctga (SEQ ID NO. 14).

[0033] Using the empty pYB1s vector as a template, pYB1s-F as the upstream primer, and pYB1s-R as the downstream primer, PCR amplification was performed using high-fidelity DNA polymerase to obtain the correct pYB1s expression vector fragment.

[0034] pYB1s-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO. 11); pYB1s-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO. 12).

[0035] The reaction systems for the two PCR amplification reactions are shown in Table 3. The reaction programs are as follows: pre-denaturation: 98℃ for 3 min; amplification cycle: 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 4.5 min, 32 cycles; extension: 72℃ for 10 min.

[0036] Table 3 Components volume 5×Phusion HF buffer (reaction buffer) 2μL dNTPs (2.5 mmol / L) (deoxyribonucleotides) 0.8μL template 0.2μL upstream primer 0.3μL Downstream primer 0.3μL DMSO (dimethyl sulfoxide) 0.3μL Phu high-fidelity DNA polymerase (2 U / μl) 0.1μL <![CDATA[ddH2O]]> 6μL The GtIDH gene fragment and pYB1s expression vector fragment obtained from the above PCR amplification reaction were ligated using the Gibson assembly method. The ligation was carried out at 50℃ for 60 min. The ligation reaction system is shown in Table 4.

[0037] Table 4 Components Volume (μL) pYB1s expression vector fragment 1 GtIDH gene fragment 3 2× Heiff Clone Enzyme Premix 5 Double distilled water (DDW) To 10 After the above ligation reaction was completed, the ligation product was added to *E. coli* DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. 600 μL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing streptomycin sulfate and incubated overnight at 37°C. Multiple single colonies were picked and cultured. Colony PCR was performed using universal primers for verification. Correctly verified colonies were extracted and sequenced. The correctly sequenced recombinant plasmid was named pYB1s-GtIDH.

[0038] Example 3 Constructing mutant plasmids Using the recombinant plasmid pYB1s-PksIDH constructed in Example 1 as a template, with F1 as the upstream primer and R1 as the downstream primer, a PCR amplification reaction was performed to obtain a mutant plasmid containing the encoding gene of the squalinositol dehydrogenase mutant Y163A / Y167F, which is plasmid 1.

[0039] F1: tccgtggtgtaGCTgacgaagatTTCatggcggacccg (SEQ ID NO.15); R1: cgggtccgccatGAAatcttcgtcAGCtacaccacgga (SEQ ID NO. 16).

[0040] Using plasmid 1 as a template, with F2 as the upstream primer and R2 as the downstream primer, a PCR amplification reaction was performed to obtain a mutant plasmid containing the gene encoding the squalene dehydrogenase mutant Y163A / Y167F / R260K, which is plasmid 2.

[0041] F2: ttgcacgcggttatAAAtgtcgtctggcgt (SEQ ID NO. 17); R2: acgccagacgacaTTTataaccgcgtgcaa (SEQ ID NO. 18).

[0042] Using the recombinant plasmid pYB1s-GtIDH constructed in Example 2 as a template, and with F3 as the upstream primer and R3 as the downstream primer, a PCR amplification reaction was performed to obtain a mutant plasmid containing the gene encoding the muscle inositol dehydrogenase mutant R124Q, which is plasmid 3.

[0043] F3: acctgggtatgaacCAGcgttacgcgagcgtt (SEQ ID NO. 19); R3: aacgctcgcgtaacgCTGgttcatacccaggt (SEQ ID NO. 20).

[0044] Using plasmid 3 as a template, with F4 as the upstream primer and R4 as the downstream primer, a PCR amplification reaction was performed to obtain a mutant plasmid containing the gene encoding the muscle inositol dehydrogenase mutant R124Q / Y173F, which is plasmid 4.

[0045] F4: ttaccggcggcttcctgTTCgaaaccccgttcc (SEQ ID NO. 21); R4: ggaacggggtttcGAAcaggaagccgccggtaa (SEQ ID NO. 22).

[0046] The reaction systems for each of the above PCR amplification reactions are shown in Table 5.

[0047] Table 5 Components volume 5×Phusion HF buffer (reaction buffer) 2μL dNTPs (2.5 mmol / L) (deoxyribonucleotides) 0.8μL plasmid template 0.2μL upstream primer 0.3μL Downstream primer 0.3μL DMSO (dimethyl sulfoxide) 0.3μL Phu high-fidelity DNA polymerase (2 U / μl) 0.1μL <![CDATA[ddH2O]]> 6μL The reaction procedures for each of the above PCR amplification reactions are as follows: pre-denaturation: 98℃ pre-denaturation for 3 min; amplification cycle: 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 4.5 min, 32 cycles; extension: 72℃ extension for 10 min.

[0048] After each of the above PCR amplification reactions was completed, plasmid 1 containing the gene encoding the squalene dehydrogenase mutant Y163A / Y167F, plasmid 2 containing the gene encoding the squalene dehydrogenase mutant Y163A / Y167F / R260K, plasmid 3 containing the gene encoding the muscle inositol dehydrogenase mutant R124Q, and plasmid 4 containing the gene encoding the muscle inositol dehydrogenase mutant R124Q / Y173F were obtained respectively.

[0049] The templates in the PCR reaction products were digested with the restriction endonuclease DpnI. The digestion reaction system was 1 μL of 10×buffer, 8 μL of PCR reaction product, and 1 μL of DpnI. The digestion reaction was carried out at 37℃ for 1 h to obtain digestion solutions.

[0050] After each of the above digestion reactions was completed, 10 μL of digestion solution was taken from each and added to E. coli DH5α competent cells. The cells were then incubated on ice for 30 min, heat-shocked in a water bath at 42℃ for 90 s, and placed on ice for 5 min. 600 μL of LB liquid medium was added to each cell, and the cells were shaken at 37℃ and 200 rpm for 45 min. The cells were then spread on LB plates (containing 50 μg / mL streptomycin sulfate) until the bacterial culture was completely absorbed. The plates were then inverted and incubated at 37℃ for 14 h. Plasmid 1, plasmid 2, plasmid 3, and plasmid 4 were extracted and sequenced for verification.

[0051] Plasmid 1 contains the encoding gene for the squalene dehydrogenase mutant Y163A / Y167F.

[0052] Plasmid 2 contains the encoding gene for the squalene dehydrogenase mutant Y163A / Y167F / R260K, the nucleotide sequence of which is shown in SEQ ID NO.5, and the amino acid sequence of the squalene dehydrogenase mutant Y163A / Y167F / R260K is shown in SEQ ID NO.6.

[0053] Plasmid 3 contains the gene encoding the muscle inositol dehydrogenase mutant R124Q.

[0054] Plasmid 4 contains the encoding gene for the muscle inositol dehydrogenase mutant R124Q / Y173F, the nucleotide sequence of which is shown in SEQ ID NO.7, and the amino acid sequence of the muscle inositol dehydrogenase mutant R124Q / Y173F is shown in SEQ ID NO.8.

[0055] Example 4 Take 1 µL each of the recombinant plasmid pYB1s-PksIDH constructed in Example 1, the recombinant plasmid pYB1s-GtIDH constructed in Example 2, and plasmid 2 containing the encoding gene of squalinositol dehydrogenase mutants Y163A / Y167F / R260K, and plasmid 4 containing the encoding gene of muscle inositol dehydrogenase mutants R124Q / Y173F from Example 3. Add 1 µL of each plasmid to four 100 µL BW25113 competent cells to obtain a mixture. Incubate each mixture on ice for 30 min, heat shock at 42°C for 90 s, and stand on ice for 5 min. Add 600 µL of LB liquid medium to each mixture and culture on a shaker at 37°C and 200 rpm for 45 min. Spread 100 µL of the bacterial culture onto four LB plates (containing 50 g of LB broth). Add μg / mL streptomycin sulfate to the bacterial culture until the bacterial suspension is completely absorbed. Invert the plates and incubate at 37°C for 14 h to obtain recombinant strains BW25113-pYB1s-PksIDH, BW25113-pYB1s-GtIDH, and mutant strain BW25113-pYB1s-PksIDH, respectively. Y163A / Y167F / R260K And the mutant strain BW25113-pYB1s-GtIDH R124Q / Y173F .

[0056] The above recombinant strains BW25113-pYB1s-PksIDH, BW25113-pYB1s-GtIDH, and BW25113-pYB1s-PksIDH were selected respectively. Y163A / Y167F / R260K And the mutant strain BW25113-pYB1s-GtIDH R124Q / Y173F Single colonies were inoculated into four LB agar plates containing 50 μg / mL streptomycin sulfate and cultured at 37°C and 200 rpm until OD500. 600 Up to version 2.0, seed cultures of recombinant strain BW25113-pYB1s-PksIDH, recombinant strain BW25113-pYB1s-GtIDH, and mutant strain BW25113-pYB1s-PksIDH were obtained, respectively. Y163A / Y167F / R260K Seed culture and mutant strain BW25113-pYB1s-GtIDH R124Q / Y173F Seed liquid.

[0057] The four seed solutions were inoculated into TB medium containing 50 μg / mL streptomycin sulfate at a 1% (v / v) inoculum, and cultured at 37°C and 200 rpm until OD500. 600The concentration was increased to 0.8, and then L-arabinose was added to a final concentration of 2 g / L. The cultures were induced and cultured at 25 °C and 200 rpm for 20 h. The four fermentation broths were centrifuged at 8000 rpm for 20 minutes, the supernatant was discarded, and the bacterial cells were collected. Strains containing wild-type squalene dehydrogenase 1, wild-type muscle inositol dehydrogenase 2, squalene dehydrogenase mutants Y163A / Y167F / R260K 3, and muscle inositol dehydrogenase mutants R124Q / Y173F 4 were obtained.

[0058] Example 5 Enzyme activity detection of squalinositol dehydrogenase and its mutants The enzyme activity of squalinositol dehydrogenase oxidizing muscle inositol was detected at 30℃ by measuring the rate of change of NADH absorbance at 340 nm.

[0059] Preparation of the reaction system: NAD⁺ and myositol were added to 20 mM Tris-HCl buffer (pH 9.5) to make the total reaction volume 200 μL. The concentration of NAD⁺ in the reaction system was 5 mM and the concentration of myositol was 50 mM. After incubating the above reaction system in a metal bath at 30℃ for 3 min, strain 1 containing wild-type squalene dehydrogenase was added to a final concentration of 50 g / L (wet weight). Using a Bio-Tek Cytation 5 multifunctional cell imaging system, the absorbance was continuously scanned at 340 nm wavelength for 10 min under constant temperature of 30℃. The absorbance change interval within 0-5 min after the start of the reaction was selected, and the absorbance change rate was calculated to determine the enzyme activity.

[0060] Preparation of the reaction system: NAD⁺ and muscle inositol were added to 20 mM Tris-HCl buffer (pH 9.5) to make a total reaction volume of 200 μL. The concentration of NAD⁺ in the reaction system was 5 mM and the concentration of muscle inositol was 50 mM. After incubating the above reaction system in a metal bath at 30℃ for 3 min, strain 3 containing squalene dehydrogenase mutant Y163A / Y167F / R260K was added to a final concentration of 50 g / L (wet weight). Using a Bio-Tek Cytation 5 multifunctional cell imaging system, the absorbance was continuously scanned at 340 nm wavelength for 10 min under constant temperature of 30℃. The absorbance change range within 0-5 min after the start of the reaction was selected, and the absorbance change rate was calculated to determine the enzyme activity.

[0061] Enzyme activity is defined as the amount of enzyme that catalyzes the reduction of 1 μmol NAD⁺ to NADH per minute under the above conditions. One unit (U) is defined as such.

[0062] The formula for calculating enzyme activity is: Enzyme activity (U) = EW × V × 103 / (6220×0.625); Wherein, EW: change in absorbance at 340 nm within 1 min; V: volume of reaction solution (mL); 6220: molar extinction coefficient (L / mol / cm); 0.625: optical path distance (cm).

[0063] Using the activity of wild-type squalene dehydrogenase as 100%, the relative enzyme activities of the squalene dehydrogenase mutants Y163A / Y167F / R260K were calculated, and the results are shown in Table 6.

[0064] Table 6 Squalinositol dehydrogenase relative enzyme activity wild type 100% mutant Y163A / Y167F / R260K 225% As can be seen from the above results, the present invention mutates wild-type squalene dehydrogenase by changing the 163rd amino acid from Y to A, the 167th amino acid from Y to F, and the 260th amino acid from R to K, resulting in the squalene dehydrogenase mutant Y163A / Y167F / R260K, which significantly increases the enzyme activity.

[0065] Example 6 Enzyme activity detection of muscle inositol dehydrogenase and its mutants The enzyme activity of muscle inositol dehydrogenase in the hydrogenation reduction of 1L-epio-2-inosaccharide was detected at 45℃ by measuring the rate of change of NADH absorbance at 340 nm.

[0066] Preparation of the reaction system: NADH, 1L-epi-2-inositose, and zinc chloride were added to 20mM Tris-HCl buffer (pH 7.5) to make a total reaction volume of 200 μL. The concentrations of NADH, 1L-epi-2-inositose, and zinc chloride in the reaction system were 5mM, 50mM, and 1mM, respectively. After incubating the above reaction system in a 45℃ metal bath for 3 min, strain 2 containing wild-type muscle inositol dehydrogenase was added to a final concentration of 40 g / L (wet weight). Using a Bio-Tek Cytation 5 multifunctional cell imaging system, the absorbance was continuously scanned at 340 nm for 10 min under constant temperature conditions of 45℃. The absorbance change within 0–5 min after the reaction started was selected, and the absorbance change rate was calculated to determine the enzyme activity.

[0067] Preparation of the reaction system: NADH, 1L-epi-2-inosaccharide, and zinc chloride were added to 20mM Tris-HCl buffer (pH 7.5) to make a total reaction volume of 200 μL. The concentrations of NADH, 1L-epi-2-inosaccharide, and zinc chloride in the reaction system were 5mM, 50mM, and 1mM, respectively. After incubating the above reaction system in a 45℃ metal bath for 3 min, strain 4 containing the muscle inositol dehydrogenase mutant R124Q / Y173F was added to a final concentration of 40 g / L (wet weight). Using a Bio-Tek Cytation 5 multifunctional cell imaging system, the absorbance was continuously scanned at 340 nm for 10 min under constant temperature conditions of 45℃. The absorbance change within 0–5 min after the reaction started was selected, and the absorbance change rate was calculated to determine the enzyme activity.

[0068] Enzyme activity is defined as the ability of an enzyme to oxidize 1 μmol of NADH to NAD per minute under the conditions described above. + The amount of enzyme is defined as one unit (U).

[0069] The formula for calculating enzyme activity is: Enzyme activity (U) = EW × V × 10 3 / (6220×0.625); Wherein, EW: change in absorbance at 340 nm within 1 min; V: volume of reaction solution (mL); 6220: molar extinction coefficient (L / mol / cm); 0.625: optical path distance (cm).

[0070] The relative enzyme activity of the muscle inositol dehydrogenase mutant R124Q / Y173F was calculated with the wild-type muscle inositol dehydrogenase activity as 100%, and the results are shown in Table 7.

[0071] Table 7 Muscle inositol dehydrogenase relative enzyme activity wild type 100% mutant R124Q / Y173F 188% As can be seen from the above results, the present invention mutates wild-type muscle inositol dehydrogenase by changing the 124th amino acid of its amino acid sequence from R to Q and the 173rd amino acid from Y to F, resulting in the muscle inositol dehydrogenase mutant R124Q / Y173F, which significantly improves enzyme activity.

[0072] Example 7 Preparation of epiinositol 1. Epiinositol was prepared using wild-type squalene dehydrogenase and wild-type muscle inositol dehydrogenase. The specific steps are as follows: Step (1): Add Tris-HCl buffer (pH 9.5), muscle inositol, and other ingredients to the reaction system. The strain 1 containing wild-type squalinositol dehydrogenase and NADH oxidase prepared in Example 4 above were used to prepare a reaction system with a Tris-HCl buffer concentration of 50 mM and a muscle inositol concentration of 20 mM. The concentrations of the above-mentioned components were 1 mM, 80 g / L (strain 1), and 1 g / L (NADH oxidase). The reaction system was incubated at 28 °C and 200 rpm for 12 h.

[0073] Step (2): Add zinc chloride and sodium formate to the reaction system after the reaction in step (1). Adjust the pH of the system to 7.5 using 1M hydrochloric acid. Then add strain 2 containing wild-type muscle inositol dehydrogenase prepared in Example 4 and formate dehydrogenase. The concentrations of zinc chloride, sodium formate, strain 2, and formate dehydrogenase in the reaction system are 1mM, 150mM, 40g / L, and 1g / L, respectively. React the above reaction system at 50℃ and 200rpm for 14h to obtain the reaction solution. Take samples for high-performance liquid chromatography (HPLC) to detect the epiinositol content in the reaction solution and calculate the conversion rate. The results are shown in Table 8.

[0074] 2. Epiinositol was prepared using squalene dehydrogenase mutants Y163A / Y167F / R260K and muscle inositol dehydrogenase mutants R124Q / Y173F. The specific steps are as follows: S1: Add Tris-HCl buffer (pH 9.5), muscle inositol, and other ingredients to the reaction system. The strain 3 containing the squalinositol dehydrogenase mutant Y163A / Y167F / R260K prepared in Example 4 above, and NADH oxidase, were used to prepare a reaction system with Tris-HCl buffer at a concentration of 50 mM and muscle inositol at a concentration of 20 mM. The concentrations of the above-mentioned components were 1 mM, strain 3 was 80 g / L, and NADH oxidase was 1 g / L. The reaction system was subjected to reaction at 28 °C and 200 rpm for 12 h.

[0075] S2: Zinc chloride and sodium formate were added to the reaction system after the S1 reaction. The pH of the system was adjusted to 7.5 using 1M hydrochloric acid. Then, strain 4 containing the muscle inositol dehydrogenase mutant R124Q / Y173F, prepared in Example 4, and formate dehydrogenase were added. The concentrations of zinc chloride, sodium formate, strain 4, and formate dehydrogenase in the reaction system were 1 mM, 150 mM, 40 g / L, and 1 g / L, respectively. The reaction system was reacted at 50°C and 200 rpm for 14 h to obtain the reaction solution. Samples were taken for high-performance liquid chromatography (HPLC) to detect the epiinositol content in the reaction solution and to calculate the conversion rate. The results are shown in Table 8.

[0076] Conversion rate = (molar concentration of surface inositol after reaction) ÷ (molar concentration of muscle inositol at the beginning of reaction) × 100%.

[0077] The high-performance liquid chromatography (HPLC) detection method in this embodiment is as follows: Column: Bio-Rad Aminex HPX-87H; Mobile phase: 5 mM Flow rate: 0.5 mL / min; Column temperature: 60℃; Differential detector.

[0078] Table 8 enzymes Epiinositol content (mM) Conversion rate wild type 6.04 30.2% mutant 14.48 72.4% The results above show that, compared with the preparation of epiinositol using wild-type squalinositol dehydrogenase and wild-type muscle inositol dehydrogenase, the present invention uses squalinositol dehydrogenase mutants Y163A / Y167F / R260K and muscle inositol dehydrogenase mutants R124Q / Y173F to prepare epiinositol, which further improves the yield of epiinositol and the conversion rate of the reaction.

[0079] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An enzyme preparation for catalyzing the synthesis of epiinositol, characterized in that, The enzyme preparations include squalinositol dehydrogenase, NADH oxidase, formate dehydrogenase, and muscle inositol dehydrogenase. The amino acid sequence of the squalinositol dehydrogenase is shown in SEQ ID NO.6, and the amino acid sequence of the muscle inositol dehydrogenase is shown in SEQ ID NO.

8.

2. The enzyme preparation according to claim 1, characterized in that, The mass ratio of squalinositol dehydrogenase, NADH oxidase, formate dehydrogenase and muscle inositol dehydrogenase is (1~10):(1~10):(1~10):(1~10).

3. The enzyme preparation according to claim 1, characterized in that, The method for modifying the enzyme activity of the squalinositol dehydrogenase is as follows: The amino acid sequence shown in SEQ ID NO.1 has the following mutations: amino acid position 163 is changed from Y to A, amino acid position 167 is changed from Y to F, and amino acid position 260 is changed from R to K.

4. The enzyme preparation according to claim 1, characterized in that, The method for modifying the enzyme activity of muscle inositol dehydrogenase is as follows: The amino acid at position 124 of the amino acid sequence shown in SEQ ID NO.3 is mutated from R to Q, and the amino acid at position 173 is mutated from Y to F.

5. A method for preparing squalene dehydrogenase, characterized in that, The enzyme preparation described in claim 1 is applied to the enzyme preparation comprising the following steps: An expression vector containing the squalinositol dehydrogenase gene was introduced into a host strain, and the resulting recombinant strain was fermented to induce the expression of the squalinositol dehydrogenase, resulting in recombinant strain 1 containing the squalinositol dehydrogenase.

6. A method for preparing muscle inositol dehydrogenase, characterized in that, The enzyme preparation described in claim 1 is applied to the enzyme preparation comprising the following steps: An expression vector containing the muscle inositol dehydrogenase gene was introduced into a host strain, and the resulting recombinant strain was fermented to induce the expression of the muscle inositol dehydrogenase, resulting in recombinant strain 2 containing the muscle inositol dehydrogenase.

7. A method for synthesizing epiinositol, characterized in that, The synthesis of epiinositol using the enzyme preparation according to any one of claims 1 to 4 includes the following steps: The squalinositol dehydrogenase and the NADH oxidase are coupled. The squalinositol dehydrogenase catalyzes the reaction of muscle inositol to produce 1L-epio-2-inosaccharide. It is reduced to NADH; the NADH oxidase catalyzes the oxidation of NADH to... ; The muscle inositol dehydrogenase and the formate dehydrogenase are coupled together. The muscle inositol dehydrogenase catalyzes the reaction of 1L-epio-2-glycosyl to produce epiinositol, while NADH is oxidized to... The formate dehydrogenase uses sodium formate as a cosubstrate to... Restore to NADH.

8. The method according to claim 7, characterized in that, The preparation method of the reaction system for generating 1 L of epi-2-glycogen is as follows: Add buffer solution, muscle inositol, to the reaction system The recombinant strain 1 containing squalinositol dehydrogenase and NADH oxidase was used to prepare a reaction system with a buffer concentration of 20-100 mM and a muscle inositol concentration of 1-100 mM. The concentration of squalene was 1-10 mM, the concentration of recombinant strain 1 containing squalene dehydrogenase was 10-100 g / L, and the concentration of NADH oxidase was 1-10 g / L. The preparation method of the reaction system for generating epiinositol is as follows: Metal ions, recombinant strain 2 containing muscle inositol dehydrogenase, formate dehydrogenase, and sodium formate were added to the reaction system after 1 L of β-epio-2-glycogen was generated. The concentrations of metal ions, recombinant strain 2 containing muscle inositol dehydrogenase, formate dehydrogenase, and sodium formate in the reaction system were 0.1-5 mM, 10-100 g / L, 1-10 g / L, and 100-150 mM, respectively.

9. The method according to claim 8, characterized in that, The buffer solution includes Tris-HCl buffer, phosphate buffer, or HEPES buffer; and / or, The metal ions include zinc ions, manganese ions, or magnesium ions.

10. The method according to claim 8, characterized in that, The reaction that produces 1 L-epio-2-kinose occurs at a temperature of 20–50 °C and a pH of 6–10; and / or, The reaction to produce epiinositol takes place at a temperature of 35-70°C and a pH of 6-10.