Small interfering RNA targeting TNF-alpha gene and use thereof

By designing small interfering RNAs targeting the TNF-α gene and using nanoparticles to achieve precise drug delivery, the problem of poor efficacy in existing IBD treatments has been solved, achieving efficient and precise treatment of IBD.

CN122303224APending Publication Date: 2026-06-30YOUJIA (HANGZHOU) BIOMEDICAL TECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YOUJIA (HANGZHOU) BIOMEDICAL TECH CO LTD
Filing Date
2024-12-27
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing IBD treatment strategies rely on high doses of non-targeted drugs, which cannot effectively stop mucosal inflammatory activity, resulting in poor clinical efficacy and easy recurrence. There is an urgent need to develop new therapies with high targeting and specificity.

Method used

We designed small interfering RNAs targeting the TNF-α gene, and used therapeutic gene silencing methods through RNA interference, combined with nanoparticles as carriers, to achieve precise targeted drug delivery and enhance the therapeutic effect of IBD.

Benefits of technology

It achieves precise and efficient treatment of IBD, reduces the side effects of systemic immunosuppression, and improves the targeting and efficacy of treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303224A_ABST
    Figure CN122303224A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedicine, specifically relating to small interfering RNA (sRNA) targeting the TNF-α gene; it includes a sense strand and an antisense strand; the sense strand and / or the antisense strand has a length ranging from 19 to 25 nucleotides, and the antisense strand is inversely complementary to a segment on the target gene. Furthermore, it achieves drug delivery of the small interfering RNA through a specific target gene, enabling precise drug targeting at the site of colonic inflammation, enhancing the therapeutic effect of IBD without causing systemic immunosuppression, thus providing a more precise and efficient gene regulation tool.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a small interfering RNA that targets the TNF-α gene and its applications. Background Technology

[0002] RNA interference (RNAi) is a molecular biological phenomenon of gene silencing induced by double-stranded RNA. Its mechanism involves inhibiting gene expression by blocking the transcription or translation of specific genes. When a double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into a cell, the mRNA degrades, leading to gene expression silencing. Small interfering RNAs (siRNAs), with a length of 20-25 nt, can trigger RNAi, specifically downregulating or shutting down the expression of specific genes. They are highly efficient, easy to synthesize, and easy to manipulate, making this technology widely used in exploring gene function and in gene therapy for infectious diseases and malignant tumors.

[0003] Inflammatory bowel disease (IBD) is a chronic, progressive, relapsing-remitting, and difficult-to-treat inflammatory bowel disease, primarily comprising two subtypes: ulcerative colitis (UC) and Crohn's disease (CD). In recent years, the global incidence of IBD has been increasing annually. Statistics show that more than 6.8 million people worldwide have been diagnosed with IBD.

[0004] Traditional IBD treatment strategies rely on frequent administration of high-dose, non-targeted drugs, primarily including aminosalicylic acid preparations (such as sulfasalazine, balsalazine, olsalazine, and mesalazine), corticosteroids (prednisone, methylprednisone, hydrocortisone, dexamethasone, and budesonide), and immunosuppressants (azathioprine, cyclosporine, and tacrolimus). While these drugs are effective in alleviating early inflammatory symptoms, they do not halt mucosal inflammation or disease progression, resulting in poor clinical efficacy, frequent relapses, and high surgical rates. Therefore, there is an urgent need to develop novel, highly targeted, and specific effective therapies to meet the medical needs of IBD patients. Thus, the development of specific and effective drugs for IBD is urgently required. Summary of the Invention

[0005] This invention designs and synthesizes small interfering RNA targeting TNF-α, and achieves the treatment of IBD through a novel biological method of therapeutic gene silencing via RNA interference.

[0006] The first technical solution of this invention discloses a small interfering RNA targeting the TNF-α gene, comprising a sense strand and an antisense strand, wherein the antisense strand is inversely complementary to a segment on the target gene, and the sense strand and the antisense strand are at least partially inversely complementary to form a double-stranded region; the small interfering RNA is any one of the following (1)-(3),

[0007] (1) The justice chain is: GCAUGGAUCUCAAAGACAA (SEQ ID NO:2), and the antisense chain is: UUGUCUUUGAGAUCCAUGCNN (SEQ ID NO:33).

[0008] (2) The justice chain is: GCUUAUGUUUAAAACAAAA (SEQ ID NO:9), and the antisense chain is: UUUUGUUUUAAACAUAAGCNN (SEQ ID NO:34).

[0009] (3) The justice chain is: GGUCAUUGAGAGAAAUAAA (SEQ ID NO:11), and the antisense chain is: UUUAUUUCUCUCAAUGACCNN (SEQ ID NO:35).

[0010] Where N is any one of G, U, A, C, T, dG, dU, dA, dC, and dT.

[0011] Preferably, the combination of 2 Ns includes CG or AA.

[0012] Preferably, at least one nucleotide in the small interfering RNA is modified; the modified nucleotide is selected from those with a sugar moiety modified at the 2' position, or at least one phosphate ester group is a phosphate ester group containing a modified group, or one or more nucleotide analogs.

[0013] Preferably, the nucleotide modified at the sugar portion of the 2' position comprises nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-ODMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0014] Preferably, the phosphate ester group containing the modifying group is specifically a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond with a sulfur atom.

[0015] Preferably, the nucleotide analogue is selected from one of the following: isonucleotide, LNA, ENA, cEtBNA, UNA, or GNA.

[0016] Preferably, the positive strand structure of the modified small interfering RNA is shown in SEQ ID NO: 25-27 of the table below; the negative strand structure of the modified small interfering RNA is shown in SEQ ID NO: 28-30 of the table below.

[0017] Sequence Name Sense Strand Sequence (5'-3') SEQ ID NO: Antisense Strand Sequence (5'-3') SEQ ID NO: siTNF-α-1 m2 fG-mC-fA-mU-fG-mG-fA-fU-fC-mU-fC-mA-fA-mA-fG-mA-fC-mA-fA 25 mU-fU-mG-fU-mC-fU-mU-fU-mG-fA-mG-mA-mU-fC-mC-fA-mU-fG-mC-s-fC-s-mG 28 siTNF-α-2 m2 fG-mC-fU-mU-fA-mU-fG-fU-fU-mU-fA-mA-fA-mA-fC-mA-fA-mA-fA 26 mU-fU-mU-fU-mG-fU-mU-fU-mU-fA-mA-mA-mC-fA-mU-fA-mA-fG-mC-s-fA-s-mA 29 siTNF-α-3 m2 fG-mG-fU-mC-fA-mU-fU-fG-fA-mG-fA-mG-fA-mA-fA-mU-fA-mA-fA 27 mU-fU-mU-fA-mU-fU-mU-fC-mU-fC-mU-mC-mA-fA-mU-fG-mA-fC-mC-s-fC-s-mG 30

[0018] In this context, the lowercase letter m indicates that the ribose group of the nucleotide to the right of the letter is 2'-methoxyribosyl; the lowercase letter s indicates that the phosphate group between the deoxyribonucleotides on both sides of the letter is a thiophosphate group; and the lowercase letter f indicates that the ribose group of the nucleotide to the right of the letter is 2'-O-ribose fluorinated.

[0019] The second technical solution of the present invention discloses a pharmaceutical composition containing the small interfering RNA described in the first technical solution and a pharmaceutically acceptable carrier.

[0020] The carriers include, but are not limited to, one or more of the following: nanoparticles, carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamide amine dendritic polymers, polylysine, chitosan, poly-D or L-type lactic acid / hydroxyacetic acid copolymers, poly(aminoethyl ethylene phosphate) and poly(N,N-dimethylaminoethyl methacrylate) and their derivatives.

[0021] Furthermore, the dosage form of the pharmaceutical composition may be a liquid formulation (e.g., an injection), a lyophilized powder for injection, or an oral formulation. When administering the lyophilized powder for injection, it is mixed with liquid excipients to form a liquid formulation. The liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular, or intravenous administration, and may also be administered via a spray to the lungs, or via a spray to other organs or tissues (such as the liver).

[0022] The third aspect of this invention discloses the use of the small interfering RNA described in the first aspect or the pharmaceutical composition described in the second aspect for the preparation of agents for diseases related to TNF-α gene overexpression.

[0023] The fourth aspect of this invention discloses the use of the small interfering RNA described in the first aspect or the pharmaceutical composition described in the second aspect in the preparation of a medicament for relieving and / or treating inflammatory bowel disease.

[0024] Beneficial effects: Compared with traditional drugs, TNF-αsiRNA with good gene silencing efficiency was designed and screened, and small interfering RNA was delivered through nanoparticles, enabling precise drug targeting at the site of colon inflammation, enhancing the therapeutic effect of IBD without causing systemic immunosuppression. It is a more precise and efficient gene regulation tool. Attached Figure Description

[0025] Figure 1 The results of filtering the knockdown effect of modified sequences are shown in the figure.

[0026] Figure 2 The figure shows the inhibition rate of the siTNF-α-2 m2 sequence under different drug-lipid ratios using orally administered nanoparticles as carriers. Detailed Implementation

[0027] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0028] The "oligonucleotide" described in this invention is a nucleotide sequence containing 10-50 nucleotides or nucleotide base pairs. In some embodiments of this invention, the oligonucleotide has a nucleobase sequence that is at least partially complementary to the coding sequence of a target gene expressed in cells. The nucleotide may optionally be modified. In some embodiments of this invention, after delivery of the oligonucleotide to cells expressing a gene, the oligonucleotide is able to inhibit or block gene expression in vitro or in vivo.

[0029] The term "inhibition" as used in this invention means that, when a given gene is expressed, gene expression is reduced when the cell, cell population, or tissue is treated with the siRNA, pharmaceutical composition, or siRNA conjugate described in this invention, compared to untreated cells, cell populations, or tissues.

[0030] The term "inhibition" as used in this invention is used interchangeably with "reduction," "silence," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0031] Unless otherwise specified, in the foregoing and hereinafter, “G”, “C”, “A”, “T” and “U” generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. However, it should be understood that the term “ribonucleotide” or “nucleotide” may also refer to modified nucleotides, nucleotide analogues (surrogate replacement moiety), as further detailed below.

[0032] In the context of this invention, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair comprises one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired complementaryly.

[0033] Unless otherwise specified, in the preceding and following text, "substantially inversely complementary" means that there are no more than three base mismatches between the two nucleotide sequences involved; "substantially inversely complementary" means that there are no more than one base mismatch between the two nucleotide sequences; and "completely inversely complementary" means that there are no base mismatches between the two nucleotide sequences. In the preceding and following text, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference is considered to exist between the two nucleotide sequences at that position. In some embodiments, replacing the nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered as a nucleotide difference at that position.

[0034] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0035] Example 1: siRNA Design

[0036] A set of siRNAs targeting the human TNF-α gene were designed and modified based on the transcriptome sequence, as shown in Tables 1 and 2, and synthesized by Suzhou Ouli Biomedical Technology Co., Ltd.

[0037] Table 1

[0038] Name SEQ ID NO: siAR Sense Strand Sequence (5'-3') SEQ ID NO: siAR Antisense Strand Sequence (5'-3') Position in NM_001278601.1 YJH-021-302 1 CGCUCUUCUGUCUACUGAA 13 UUCAGUAGACAGAAGAGCGUG 302 YJH-021-475 2 GCAUGGAUCUCAAAGACAA 14 UUGUCUUUGAGAUCCAUGCCG 475 YJH-021-477 3 GGAUCUCAAAGACAACCAA 15 ​ 477 ​ 4 ​ 16 ​ 537 ​ 5 ​ 17 ​ 593 ​ 6 ​ 18 ​ 834 ​ 7 ​ 19 ​ 1042 ​ 8 ​ 20 ​ 1127 ​ 9 ​ 21 ​ 1438 ​ 10 GGGUCAUUGAGAGAAAUAA 22 UUAUUUCUCUCAAUGACCCGU 1561 YJH-021-1564 11 GGUCAUUGAGAGAAAUAAA 23 UUUAUUUCUCUCAAUGACCCG 1564 NC 12 UUCUCCGAACGUGUCACGUTT 24 ACGUGACACGUUCGGAGAATT NA

[0039] Table 2

[0040] Sequence Name Sense Strand Sequence (5'-3') SEQ IDNO: Antisense Strand Sequence (5'-3') SEQ IDNO: siTNF-α-1 m2 fG-mC-fA-mU-fG-mG-fA-fU-fC-mU-fC-mA-fA-mA-fG-mA-fC-mA-fA 25 mU-fU-mG-fU-mC-fU-mU-fU-mG-fA-mG-mA-mU-fC-mC-fA-mU-fG-mC-s-fC-s-mG 28 siTNF-α-2 m2 fG-mC-fU-mU-fA-mU-fG-fU-fU-mU-fA-mA-fA-mA-fC-mA-fA-mA-fA 26 mU-fU-mU-fU-mG-fU-mU-fU-mU-fA-mA-mA-mC-fA-mU-fA-mA-fG-mC-s-fA-s-mA 29 siTNF-α-3 m2 fG-mG-fU-mC-fA-mU-fU-fG-fA-mG-fA-mG-fA-mA-fA-mU-fA-mA-fA 27 mU-fU-mU-fA-mU-fU-mU-fC-mU-fC-mU-mC-mA-fA-mU-fG-mA-fC-mC-s-fC-s-mG 30

[0041] Example 2: Screening for the effect of naked sequence knockdown

[0042] 1) Mouse macrophages RAW264.7 (Shanghai Cell Bank, Chinese Academy of Sciences) in the logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. The cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0043] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture: The sequences in Table 1 were used. 10 nM siRNA / well and 1.5 μl LipoRNAiMAX (invitrogen) were diluted separately in 25 μl serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.

[0044] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0045] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.

[0046] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl forward primer, and 0.4 μl reverse primer to each well. Dilute 100 ng RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0047] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles.

[0048] The screening results are shown in Table 3.

[0049] Table 3

[0050] Sequence Name Inhibition Rate (%) SD YJH-021-302 69.46 8.65 YJH-021-475 92.12 4.52 YJH-021-477 77.45 1.23 YJH-021-537 66.30 3.23 YJH-021-593 33.59 5.01 YJH-021-834 50.19 3.00 YJH-021-1042 48.51 8.98 YJH-021-1127 60.98 7.45 YJH-021-1438 87.12 5.21 YJH-021-1561 74.21 1.30 YJH-021-1564 89.33 4.08

[0051] As shown in Table 3, three sequences performed well: YJH-021-475, YJH-021-1438, and YJH-021-1564. These three sequences were modified (see Table 2) and then proceeded to the next stage of the experiment.

[0052] Example 3: Screening for the effect of modified sequence knockdown

[0053] 1) Gently blow RAW264.7 cells (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase into a culture dish with DMEM medium containing 10% FBS. After collecting the cell suspension, centrifuge, mix with DMEM medium containing 10% FBS, count the cells with a hemocytometer, and then add 100,000 cells to each well of a 24-well plate for culture.

[0054] 2) Preparation of LipoRNAiMAX (invitrogen) and siRNA mixture: Three types of siRNA, siTNF-α-1 m2, siTNF-α-2 m2, and siTNF-α-3 m2, were selected. The siRNA and LipoRNAiMAX were diluted separately in serum-free culture medium (Opti-MEM, purchased from Gibco). The prepared siRNA solution was then added dropwise to the LipoRNAiMAX solution and mixed. The mixture was incubated at room temperature for 5 min.

[0055] 3) After 24 hours of cell seeding, transfect the cells using FBS-free DMEM medium. Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX mixture to each well. Each transfection well contains 25 μl of RNA solution (50 nM siRNA + Opti-MEM) and 25 μl of transfection reagent solution (1.5 μl LipoRNAiMAX + 23.5 μl Opti-MEM). After 5 hours, replace the medium with DMEM supplemented with 10% FBS, and repeat the transfection process for a total of 24 hours.

[0056] 4) Add 5 μg / ml of LPS (Beyotime) to each well to stimulate and induce cells for 3 h.

[0057] 5) Perform cell lysis and collect cells, discard the culture medium in the wells, add 700 μl of Lysis buffer (BioFlux) to each well, mix well by pipetting, let stand for 5 min, and then transfer to EP tubes.

[0058] 6) Extract RNA

[0059] Add 140 μl of chloroform (MREDA) to the EP tube, vortex to mix, and let stand at room temperature for 2 min. Centrifuge at 12000 rpm for 10 min at 4℃. After centrifugation, the mixture separates into three layers, with RNA in the supernatant. Using a total RNA purification kit (BioFlux, batch number: BSC69M1E), add 300 μl of supernatant to the binding buffer reagent plate. Place the 96-well plate into the NPA-96 nucleic acid extraction and purification instrument. The 96-well reagent plates are arranged from left to right as follows: binding buffer reagent plate, magnetic bead reagent plate, protein removal wash buffer reagent plate, washing buffer reagent plate, washing buffer reagent plate, and elution buffer reagent plate. Before placing the plates, invert them three times and shake them by hand to prevent liquid from adhering. Perform the extraction experiment using the BSC69 automated program. After the extraction, transfer the RNA solution to the EP tube and detect the RNA concentration.

[0060] 7) RT-PCR detection

[0061] Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl mTNFα-2PF, and 0.4 μl mTNFα-2PR to each well. Dilute 100 ng RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0062] PCR reaction conditions: 50℃, 15 min pre-denaturation; 95℃, 1 min; 95℃ annealing for 15 sec; 60℃ extension for 1 min; 39 cycles.

[0063] PCR primers: mTNFα-2P F: Bailige, NG01_310256; mTNFα-2P R: Bailige, NG01_310257.

[0064] Target Name Sequence (5'-3') SEQ ID NO: TNF-α mTNFα-2P F CTGAACTTCGGGGTGATCGG 31 ​ ​ ​ 32

[0065] Novizan reagent kit: batch number 7E0103K3.

[0066] Experimental results are as follows ​ As shown, compared with the BLK group, the LPS group showed a significant upregulation of gene mRNA levels, indicating successful induction of inflammatory cells. Among the three sequences, siTNF-α-2 m2 showed the highest inhibition rate, reaching 60%.

[0067] Example 4: Inhibition rate of siTNF-α-2 m2 sequence with different drug-lipid ratios using orally administered nanoparticles as carriers

[0068] 1) Preparation of nanoparticles with different drug-lipid ratios

[0069] a) Dissolve 30 OD siTNF-α-2 m2 in 1 ml of acetate buffer and store as a stock solution for later use. The concentration of API was measured to be 2450.75 ng / μl using a micro spectrophotometer. Then, take 82 μl of the stock solution, add 418 μl of acetate buffer, and measure the concentration to be 453.060 ng / μl. Then, add another 65 μl of acetate buffer, and measure the concentration to be 397.040 ng / μl, thus preparing a 0.4 mg / ml API solution for later use.

[0070] (b) Weigh 0.42 mg DSPC, 0.84 mg cholesterol, and 0.24 mg DMG-PEG2000, and dissolve them in 0.2 ml of anhydrous ethanol. Separately, weigh 0.39 mg, 0.54 mg, and 0.73 mg DLin-MC3-DMA, and add them to the prepared anhydrous ethanol solutions containing lipid components (0.05 ml each), labeling them as lipid solution ①, lipid solution ②, and lipid solution ③.

[0071] c) Take 0.45 ml of API solution, add 15 μl of HA solution with a concentration of 1 mg / ml, mix well, and divide into three equal portions.

[0072] d) Add 4 μl of ES100 solution with a concentration of 10 mg / ml to three 0.05 ml lipid solutions ①, ② and ③ respectively, and mix well.

[0073] e) Manually mix the above lipid solutions ①, ② and ③ containing ES100 with the API solution containing HA (mixing volume ratio of 1:3) and gently vortex for about 1 minute.

[0074] f) Take 0.2 ml of the mixed solution from each group in step e), and dilute it to 2 ml with enzyme-free sterile water to obtain nanoparticle samples. Use a nanoparticle size and potential analyzer to detect the particle size, PDI and potential of the nanoparticles. The results are summarized in Table 4.

[0075] Table 4: Physicochemical properties of nanoparticles with different drug-lipid ratios

[0076] ​ ​ ​ ​ 6.5:1 132.3±0.8 35.7±0.7 0.183±0.012 9:1 175.7±0.4 39.1±0.9 0.213±0.015 12:1 144.2±2.0 43.9±0.9 0.208±0.006

[0077] 2) Effects of nanoparticles with different drug-to-lipid ratios on the inhibition of TNFα mRNA expression in RAW264.7 cells.

[0078] a) Gently blow RAW264.7 cells (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase from a culture dish with DMEM medium containing 10% FBS. After collecting the cell suspension, centrifuge the cells, mix them with DMEM medium containing 10% FBS, count the cells using a hemocytometer, and then add 100,000 cells to each well of a 24-well plate for culture.

[0079] b) After 24 h of cell culture, prepare the mixture of LipoRNAiMAX (invitrogen) and siRNA: dilute siTNF-α-2 m2 and LipoRNAiMAX separately in serum-free culture medium (Opti-MEM, purchased from Gibco), then add the prepared siRNA solution to the LipoRNAiMAX solution and mix. Incubate at room temperature for 5 min (the transfection well contains 25 μl RNA solution: 100 nM siRNA + Opti-MEM and 25 μl transfection reagent solution: 1.5 μl LipoRNAiMAX + 23.5 μl Opti-MEM).

[0080] Add a certain volume of nanoparticle sample to the well according to the required transfection amount (100 nM siRNA / well).

[0081] c) 24 h after transfection, add 5 μg / ml LPS (Beyotime) to each well to stimulate and induce cell growth for 3 h.

[0082] d) Lysis and cell collection: After washing the cells once with PBS, add 700 μl of Lysis buffer (BioFlux) to each well, mix by pipetting, let stand for 5 min, and then transfer to EP tubes.

[0083] e) RNA extraction

[0084] Add 140 μl of chloroform (MREDA) to the EP tube, vortex to mix, and let stand at room temperature for 2 min. Centrifuge at 12000 rpm for 10 min at 4℃. After centrifugation, the mixture separates into three layers, with RNA in the supernatant. Using a total RNA purification kit (BioFlux, batch number: BSC69M1E), add 300 μl of supernatant to the binding buffer reagent plate. Place the 96-well plate into the NPA-96 nucleic acid extraction and purification instrument. The 96-well reagent plates are arranged from left to right as follows: binding buffer reagent plate, magnetic bead reagent plate, protein removal wash buffer reagent plate, washing buffer reagent plate, washing buffer reagent plate, and elution buffer reagent plate. Before placing the plates, invert them three times and shake them by hand to prevent liquid from adhering. Perform the extraction experiment using the BSC69 automated program. After the extraction, transfer the RNA solution to the EP tube and detect the RNA concentration.

[0085] f) RT-PCR detection

[0086] Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl mTNFα-2PF, and 0.4 μl mTNFα-2PR to each well. Dilute 100 ng RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0087] PCR reaction conditions: 50℃, 15 min pre-denaturation; 95℃, 1 min; 95℃ annealing for 15 sec; 60℃ extension for 1 min; 39 cycles.

[0088] PCR primers: mTNFα-2P F (SEQ ID NO:31): Bailige, NG01_310256; mTNFα-2P R (SEQ ID NO:32): Bailige, NG01_310257.

[0089] Novizan reagent kit: batch number 7E0103K3.

[0090] Experimental results are as follows ​ As shown, compared with the LPS group, all three groups of nanoparticles showed significant gene expression inhibition effects, achieving a high inhibition rate consistent with LipoRNAiMAX transfection, with inhibition rates of over 80%, namely 85%, 84%, and 89%, respectively.

[0091] The detailed descriptions listed above are merely specific illustrations of feasible embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art can devise many other modifications and embodiments, which will fall within the principles and spirit of this application. More specifically, within the scope of this application, the drawings, and the claims, various variations and improvements can be made to the components and / or layout of the subject matter combination layout. Besides variations and improvements to the components and / or layout, other uses will be apparent to those skilled in the art.

Claims

1. A small interfering RNA targeting the TNF-α gene, characterized in that, It includes a sense strand and an antisense strand, wherein the antisense strand is inversely complementary to a segment on the target gene, and the sense strand and the antisense strand are at least partially inversely complementary to form a double-stranded region; the small interfering RNA is any one of the following (1) to (3), (1) The justice chain is: GCAUGGAUCUCAAAGACAA (SEQ ID NO:2), and the antisense chain is: UUGUCUUUGAGAUCCAUGCNN (SEQ ID NO:33). (2) The justice chain is: GCUUAUGUUUAAAACAAAA (SEQ ID NO:9), and the antisense chain is: UUUUGUUUUAAACAUAAGCNN (SEQ ID NO:34). (3) The justice chain is: GGUCAUUGAGAGAAAUAAA (SEQ ID NO:11), and the antisense chain is: UUUAUUUCUCUCAAUGACCNN (SEQ ID NO:35). Where N is any one of G, U, A, C, T, dG, dU, dA, dC, and dT.

2. The small interfering RNA of claim 1, wherein Combinations of two Ns include CG or AA.

3. The small interfering RNA of claim 2, wherein At least one nucleotide in the small interfering RNA is modified; the modified nucleotide is selected from those with a glycosidic modification at the 2' position, or at least one phosphate ester group containing a modified group, or one or more nucleotide analogs.

4. The small interfering RNA of claim 3, wherein The nucleotides modified at the sugar portion of the 2' position include nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-ODMAP), T0-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

5. The small interfering RNA as described in claim 3, characterized in that, Specifically, a phosphate ester group containing a modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in a phosphate diester bond with a sulfur atom.

6. The small interfering RNA as described in claim 3, characterized in that, Nucleotide analogs are selected from one of the following: isonucleotides, LNA, ENA, cEtBNA, UNA, or GNA.

7. The small interfering RNA according to any one of claims 3 to 6, characterized in that, The structures of the positive strand of the modified small interfering RNA are shown in SEQ ID NO: 25-27; the structures of the antisense strand of the modified small interfering RNA are shown in SEQ ID NO: 28-30.

8. A pharmaceutical composition, characterized in that, It contains the small interfering RNA as described in any one of claims 1 to 7 and a pharmaceutically acceptable vector.

9. Use of the small interfering RNA according to any one of claims 1 to 7 or the pharmaceutical composition according to claim 8 for the preparation of a medicament for diseases related to TNF-α gene overexpression.

10. The use of the small interfering RNA according to any one of claims 1 to 7 or the pharmaceutical composition according to claim 8 in the preparation of a medicament for relieving and / or treating inflammatory bowel disease.