Cis-acting elements for enhancing the promoter activity of cotton swp73b gene and application thereof

Abstract

This invention discloses cis-acting elements that enhance the promoter activity of the cotton SWP73B gene and their applications. The invention provides two cis-acting elements that can improve promoter activity, thereby increasing gene transcription levels. These two cis-acting elements are located on the promoter of the cotton boll weight gene GrSWP73B, the sequence of which is SEQ ID NO:1. The cis-acting elements are named GrmotifD and GrmotifE, with their core sequences being CATCA and ATTAA, respectively. The core cis-acting elements GrmotifD and GrmotifE provided by this invention can enhance promoter activity. Vectors containing these cis-acting elements can be used to transform cotton, enabling widespread and efficient expression of the target gene and cultivating new materials with large boll characteristics.

Description

Technical Field

[0001] This invention belongs to the field of cotton molecular breeding and genetic engineering technology, specifically involving two cis-acting elements that can significantly enhance the activity of the cotton SWP73B gene promoter and their applications. Background Technology

[0002] Cotton is a vital economic crop worldwide. With increasing demands for higher yield, better quality, and greater resistance to stress, improving cotton varieties through genetic engineering has become a crucial development direction. While gene function research in cotton genetic engineering is relatively advanced, research on promoters and regulatory elements (such as motifs) remains in its early stages. As the "switch" of gene expression, the promoter, and its core regulatory units—cis-acting elements—are of great significance for understanding gene expression networks and optimizing crop genetic improvement strategies. On one hand, in-depth analysis of promoter motifs allows for precise understanding of the spatiotemporal specificity of gene expression, thus elucidating gene expression networks. For example, by identifying promoter motifs that respond to environmental stress, the expression of stress-resistance genes in cotton can be specifically regulated, enhancing cotton's adaptability to adverse environments. On the other hand, in genetic improvement, the research findings on promoter motifs enable more precise design of breeding strategies, achieving efficient improvement in cotton yield, quality, and other traits, thereby promoting the development of the cotton industry and enhancing cotton's competitiveness in the global market.

[0003] After more than 10 years of research, the patent applicant innovated germplasm through distant hybridization between the diploid wild species *Gnaphalium raimondii* (2n=2x=26=D5D5) and the cultivated species *Gnaphalium hirsutum* (2n=4x=52=AADD), creating a set of upland cotton-*Gnaphalium raimondii* chromosome segment substitution lines. According to patent CN202311570563.X (Sanya Research Institute of Nanjing Agricultural University, 2023), the expression level of the SWP73B gene in the cotton boll material L3077 was 4.75 times that of the control (receptor TM-1), showing a highly significant difference. Its boll weight was 8.77 g, 22.3% higher than the control (control TM-1, 7.17 g). Our further investigation revealed that the expression level of the SWP73B gene in transgenic Arabidopsis thaliana increased by 51.50-fold, and the thousand-seed weight of transgenic Arabidopsis thaliana reached 21.75 mg, 23.60% higher than the control (the thousand-seed weight of wild-type Arabidopsis thaliana was only 17.6 mg). The boll weight of transgenic cotton containing the SWP73B gene reached 6.78 g, 18.85% higher than the control (the control was only 5.71 g), and the expression level of SWP73B in transgenic cotton increased by 2.48-fold. Furthermore, it was found that the cis-acting elements GrmotifD and GrmotifE could enhance the SWP73B promoter activity in both Nicotiana benthamiana and Arabidopsis thaliana. In transgenic cotton, only promoters containing GrmotifD and GrmotifE elements showed significantly increased activity, enhancing the expression level of the SWP73B gene and leading to a significant increase in cotton boll weight. These results fully demonstrate the strong correlation between increased promoter activity, increased SWP73B gene expression, and increased cotton boll size.

[0004] This invention provides two cis-acting elements, GrmotifD and GrmotifE, which can significantly enhance the promoter activity of the cotton SWP73B gene. These elements can be applied in the field of genetic engineering to enable the target gene to be expressed widely and efficiently in recipient plants. Summary of the Invention

[0005] The purpose of this invention is to provide two cis-acting elements that can significantly enhance the activity of the cotton SWP73B gene promoter and their applications.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] In a first aspect, the present invention claims protection for a cis-acting element selected from at least one of GrmotifD and GrmotifE; wherein the core motif sequence of GrmotifD is CATCA and the core motif sequence of GrmotifE is ATTAA; the cis-acting element is used to enhance the activity of the cotton SWP73B gene promoter, wherein the nucleotide sequence of the cotton SWP73B gene promoter is shown in SEQ ID NO:1 or SEQ ID NO:2.

[0008] Furthermore, the cis-acting element is located in the cotton GrSWP73B gene promoter as shown in SEQ ID NO:1, wherein GrmotifD is located at -744 bp to -740 bp and GrmotifE is located at -731 bp to -727 bp (relative to the transcription start site); introducing GrmotifD and / or GrmotifE into the cotton GhSWP73B gene promoter with the nucleotide sequence shown in SEQ ID NO:2 is used to enhance the transcriptional activity of the cotton GhSWP73B gene promoter.

[0009] Secondly, the present invention claims protection for a cotton SWP73B gene promoter comprising the aforementioned cis-acting element, wherein the promoter is at least one of the following (a1)-(a3):

[0010] (a1) The GrSWP73B gene promoter with a nucleotide sequence as shown in SEQ ID NO:1;

[0011] (a2) and (a1) refer to the functional truncated fragments of the GrSWP73B gene promoter; the functional truncated fragments are the pro-1366 or pro-1093 segments of the GrSWP73B gene promoter sequence, wherein the nucleotide sequence of the pro-1366 segment corresponds to positions -1 to -1366 of SEQ ID NO:1; and the nucleotide sequence of the pro-1093 segment corresponds to positions -1 to -1093 of SEQ ID NO:1.

[0012] (a3) A point mutation located in the cis-acting element region is introduced into the wild-type GhSWP73B gene promoter with the nucleotide sequence shown in SEQ ID NO:2 to obtain a mutant promoter containing at least one cis-acting element of GrmotifD and GrmotifE; the transcriptional activity of the mutant promoter is higher than that of the wild-type GhSWP73B gene promoter.

[0013] Furthermore, the point mutation described in (a3) ​​is introduced via overlap extension PCR, specifically including the following steps:

[0014] (i) Design two primer pairs, including flanking primer pairs 1F and 2R and bridging primer pairs 1R and 2F containing the mutation site;

[0015] (ii) Perform the first round of PCR amplification, using the wild-type GhSWP73B gene promoter as a template, and perform the following two independent reactions:

[0016] Reaction A: Using flanking primer 1F and bridging primer 1R, the upstream fragment containing the mutation site was amplified;

[0017] Reaction B: Using bridging primer 2F and flanking primer 2R, downstream fragments containing the mutation site were amplified;

[0018] (iii) Perform a second round of PCR amplification using the purified product from the first round of PCR as a template. After amplification without primers, the upstream and downstream fragments are spliced ​​together by complementary overlapping sequences.

[0019] (iv) Add flanking primers 1F and 2R and continue amplification to obtain the full-length mutant promoter sequence.

[0020] Furthermore, in step (i),

[0021] The nucleotide sequences of the flanking primer pairs used to introduce the point mutation of GrmotifD are shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequences of the bridging primer pairs are shown in SEQ ID NO:5 and SEQ ID NO:6.

[0022] The nucleotide sequences of the flanking primer pairs used to introduce point mutations in GrmotifE are shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequences of the bridging primer pairs are shown in SEQ ID NO:7 and SEQ ID NO:8.

[0023] Thirdly, the present invention seeks to protect biological materials containing the above-mentioned promoters, wherein the biological materials are expression cassettes, recombinant vectors, recombinant cells or recombinant bacteria.

[0024] Furthermore, the recombinant vector is a recombinant vector constructed by inserting the above-mentioned promoter between the HindIII and SmaI restriction sites of the pBI121 vector, replacing the original 35S promoter.

[0025] Fourthly, the present invention seeks protection for the use of the above-mentioned cis-acting element in enhancing the activity of the cotton SWP73B gene promoter, the nucleotide sequence of which is shown in SEQ ID NO:1 or SEQ ID NO:2.

[0026] Fifthly, the present invention claims protection for the use of the above-described promoter in the following (b1) or (b2):

[0027] (b1) Application in increasing the expression level of the SWP73B gene in Arabidopsis thaliana, tobacco or cotton;

[0028] (b2) Application in the development of new cotton germplasm with large boll phenotype.

[0029] Sixthly, the present invention seeks protection for the use of the above-described biomaterials in the following (b1) or (b2):

[0030] (b1) Application in increasing the expression level of the SWP73B gene in Arabidopsis thaliana, tobacco or cotton;

[0031] (b2) Application in the development of new cotton germplasm with large boll phenotype.

[0032] Seventhly, the present invention claims protection for a method for increasing the expression level of the SWP73B gene in plants, comprising introducing the aforementioned promoter into a target plant and causing the promoter to drive the expression of the target gene, thereby enhancing the tissue-specific or broad-spectrum expression of the target gene; wherein the plant is Arabidopsis thaliana, tobacco, or cotton.

[0033] Eighthly, the present invention claims protection for a method for cultivating cotton with large boll characteristics, comprising the following steps:

[0034] (a) Provide a recombinant vector containing the promoters described above;

[0035] (b) Introducing the recombinant vector into cotton plant cells;

[0036] (c) Screening for transgenic cotton plants that stably integrate the promoter, which exhibit increased boll weight.

[0037] This invention provides two cis-acting elements that can enhance promoter activity, thereby increasing gene transcription levels. These two cis-acting elements are located on the promoter of the cotton boll weight gene GrSWP73B, the sequence of which is SEQ ID NO:1. The cis-acting elements are named GrmotifD and GrmotifE, with core sequences CATCA and ATTAA, respectively. The corresponding promoter sequence for the upland cotton homolog GhSWP73B is SEQ ID NO:2. The two cis-acting elements on this promoter were determined through point mutation and transient expression experiments in tobacco, and they can enhance promoter activity and increase the activity of the GUS reporter gene.

[0038] The beneficial effects of this invention are:

[0039] This invention provides a cis-acting element that enhances promoter activity, enabling the regulation of transcriptional levels of target genes using promoters including the GrSWP73B gene of this invention.

[0040] The core cis-acting elements GrmotifD and GrmotifE of the GrSWP73B gene promoter provided by this invention can enhance promoter activity. Vectors containing these cis-acting elements can be used to transform cotton, enabling widespread and efficient expression of the target gene and cultivating new materials with large boll characteristics. Attached Figure Description

[0041] Figure 1 Alignment of promoter sequences for the GhSWP73B and GrSWP73B genes.

[0042] Figure 2 The diagram shows the truncated mode of the SWP73B promoter; SWP73B_pro-1775: the promoter sequence length is 1775 bp, including the 5'UTR region, and so on. Figure 3 GUS staining for promoters of different lengths.

[0043] Figure 4 For promoter point mutation activity analysis.

[0044] Figure 5 Tissue-specific analysis of GrSWP73B and GhSWP73B promoters. Detailed Implementation

[0045] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0046] Example 1: Promoter sequence differences between GrSWP73B and GhSWP73B genes

[0047] (1) Obtain the promoter sequences of GrSWP73B and GhSWP73B genes.

[0048] The promoter sequence of the upland cotton GhSWP73B gene was obtained using the website http: / / cotton.zju.edu.cn / . The sequence upstream of the start codon ATG, which is 1774 bp in length, was extracted, i.e., SEQ ID NO:2.

[0049] Using L3077 DNA as a template, the promoter of the GrSWP73B gene was cloned, and the promoter sequence was obtained by sequencing. The sequence length is 1775 bp, i.e., SEQ ID NO:1. The upstream primer for cloning the GrSWP73B gene promoter is TCTTCAAATTATCCACAACATGC (SEQ ID NO:17), and the downstream primer is CACTAATCTAATTCACTGCGAAA (SEQ ID NO:18).

[0050] (2) Alignment of GrSWP73B and GhSWP73B gene promoter sequences

[0051] Promoter sequences were aligned using the multiple sequence alignment software Jalview-2_11_4_0 to visualize the differences between promoters. Figure 1 The comparison results showed that the promoter sequences of GrSWP73B (SEQ ID NO:1) and GhSWP73B (SEQ ID NO:2, control) genes had a similarity of 99.10%, and the GrSWP73B gene promoter had 14 variant sites.

[0052] Example 2: Promoter Activity Analysis

[0053] (1) Promoter truncation experiment

[0054] To determine the specific motifs affecting promoter activity, promoter sequences of different lengths upstream of the start codon ATG were extracted. For GrSWP73B and GhSWP73B, promoter sequences of different lengths were extracted. The four types of promoters for GrSWP73B are pro-1775, pro-1366, pro-1093, and pro-580. The four types of promoters for GhSWP73B are pro-1774, pro-1363, pro-1091, and pro-580. The boundary bases of each segment are marked in the sequences of SEQ ID NO:1 and SEQ ID NO:2 (see Table 1). Furthermore, the position and bases of each type of promoter boundary are marked in the promoter sequence alignment diagram. Figure 1 (See the detailed diagram of the truncated promoter) Figure 2 .

[0055] Table 1. Termination positions of promoters and corresponding bases.

[0056]

[0057] (2) Carrier construction and transformation

[0058] This invention uses the pBI121 vector, and the 35S promoter sequence inherent in the vector is cut off using HindIII and SmaI restriction enzymes to obtain a linearized vector. Using L3077 and TM-1 DNA as templates and sequences with restriction sites as primers, the promoter sequences of the GrSWP73B and GhSWP73B genes were cloned, respectively. The amplification products were recovered from the gel to obtain purified cDNA fragments, which were then recombined with the linearized vector and transformed into *E. coli* DH5α. After successful sequencing, the positive plasmid was transformed into *Agrobacterium* GV3101.

[0059] Since the primer sequences for GrSWP73B and GhSWP73B are identical, the primer sequences used to amplify the corresponding truncated promoters are also identical. The primers used to construct the promoter vectors pro-1775 or pro-1774 are as follows: upstream primer pro-SWP73B-1F: ccatgattacgccaagcttTCTTCAAATTATCCACAACATGC (SEQ ID NO:19), and downstream primer pro-SWP73B-1R: agggactgaccacccgggCACTAATCTAATTCACTGCGAAA (SEQ ID NO:20). The upstream primers for constructing the truncated promoter pro-1366 or pro-1363 vectors are as follows: pro-1366 / 1363-F: cattagattacgccaagcttAATTGTTAATATTGTTAGATTTGTTGG (SEQ ID NO:21); the upstream primers for constructing the truncated promoter pro-1093 or pro-1091 vectors are as follows: cattagattacgccaagcttCTAGTCCCTTCTATTTAGGGTCT (SEQ ID NO:22); and the upstream primers for constructing the truncated promoter pro-580 vectors are as follows: pro-580-F: cattagattacgccaagcttCCAGTGATTATGGATGGGCG (SEQ ID NO:23). The downstream primers have the same sequence as the pro-SWP73B-1R primers.

[0060] (3) Instantaneous transformation of tobacco

[0061] This invention uses *N. benthamiana*, where tobacco seeds are incubated in paper cups for seven to ten days, then transplanted into individual paper cups for cultivation in an artificial climate chamber. The ratio of nutrient soil to vermiculite during tobacco cultivation is 1:1 (w:w). The tobacco growing conditions are 16 hours of light and 8 hours of darkness, with a humidity of 60%.

[0062] Agrobacterium containing the promoter vector was cultured overnight in 30 mL LB medium. The bacterial cells were collected and resuspended twice with resuspension buffer to the appropriate OD600 value (ensuring OD600 = 0.5-0.8 for each cell). The cells were then incubated in the dark at 28°C for 3-5 h. The bacterial suspension was injected into 4-week-old tobacco leaves using a sterile syringe until completely immersed. After 24 h of dark treatment, light was restored, and GUS staining was performed 48 h later. The tobacco leaves injected with Agrobacterium were placed in GUS staining solution and incubated at 37°C in the dark. After incubation, the staining solution was discarded, and the samples were soaked in 70% ethanol. Decolorization was carried out at 37°C or room temperature (25°C), with the ethanol replaced 2-3 times (until the chlorophyll was completely removed and the tissue turned white or pale yellow). Finally, photographs were taken for recording. GUS staining results showed that neither the GrSWP73B_pro-580 nor the GhSWP73B_pro-580 promoters were active; GhSWP73B_pro-1093 was inactive, while the corresponding GrSWP73B_pro-1093 was active, showing the most significant difference. All other promoters were active. Figure 3 ).

[0063] (4) Quantitative detection of GUS reporter genes

[0064] Tobacco leaves injected with Agrobacterium were perforated to form leaf discs, with each sample containing approximately 100 mg. GUS enzyme activity was measured using the Beijing Coollabo GUS Reporter Gene Quantitative Detection Kit (SL7161), with specific procedures described in the instruction manual. The GUS enzyme activity quantification results showed that a base mutation in the GrSWP73B_pro-1093 region significantly increased promoter activity. Figure 3 ).

[0065] Example 3: Promoter motif differential analysis

[0066] 1. Motif prediction of promoter cis-acting element

[0067] The PlantPAN 4.0 website was used to predict cis-acting element motifs in the GrSWP73B gene promoter pro-1093. There were six variants in the GrSWP73B_pro-1093 region: GrmotifA, GrmotifB, GrmotifC, GrmotifD, GrmotifE, and GrmotifF. The specific motif sequences and their positions in SEQ ID NO:1 are shown in Table 2, and their specific positions are also marked in the sequence alignment diagram. Figure 1 ).

[0068] Table 2 Core motif sequences and their locations

[0069]

[0070] 2. Construction of promoter point mutation vector

[0071] Promoter point mutation requires the design of two pairs of primers: a bridging primer to introduce the mutation site, and flanking primers to clone the complete promoter sequence. Taking the design of a promoter to introduce GrmotifD as an example:

[0072] (1) Four primers were designed: flanking primers pro-1F and pro-2R, and bridging primers pro-D-1R and pro-D-2F. The flanking primers are located at both ends of the promoter, and the bridging primers are inversely complementary and contain mutation sites (Table 3).

[0073] Table 3. Promoter point mutation primers

[0074]

[0075] (2) Using TM-1 DNA as a template, PCR amplification was performed using the following two pairs of primers:

[0076] First round segment 1: pro-1F and pro-D-1R;

[0077] First round segment 2: pro-D-2F and pro-2R.

[0078] The purified PCR product was obtained by gel extraction. There are no special requirements for PCR amplification conditions and systems; refer to the instructions for the amplification enzyme used.

[0079] (3) Using the two purified PCR products as a mixed template, perform 10-20 cycles of annealing extension without primers (20 cycles in this example) to allow the two products to overlap and splice through the complementary sequences of the bridging primers; then add the flanking primers pro-1F and pro-2R and continue amplification for 25-30 cycles (30 cycles in this example). The purified product is obtained by gel recovery, which is the full-length point mutation promoter fragment.

[0080] (4) The linearized pBI121 vector digested with HindIII and SmaI and the purified product obtained in step (3) were recombinantly ligated and transformed to construct a promoter point mutation expression vector.

[0081] (5) When introducing GrmotifA, GrmotifB, GrmotifC, GrmotifE, and GrmotifF, the flanking primers are located at both ends of the promoter, so the flanking primer sequences used are the same, namely pro-1F and pro-2R. Only the bridging primers are different. The specific primer sequences are shown in Table 4.

[0082] Table 4. Bridge primers for promoter point mutation

[0083]

[0084] 3. The effect of motif differences on promoter activity

[0085] The six constructed promoter point mutant vectors were transformed into Agrobacterium, and promoter activity was analyzed by transient tobacco expression experiments, using the same method as the transient tobacco transformation in Example 2. The results showed that, compared with other point mutations, the GrmotifD and GrmotifE point mutant promoters exhibited significant expression activity. Figure 4 ).

[0086] Example 4: Obtaining and analyzing the activity of Arabidopsis thaliana transgenic with GrSWP73B and GhSWP73B gene promoters.

[0087] 1. Creation of transgenic Arabidopsis thaliana

[0088] Arabidopsis thaliana was transformed with the pBI121 (HindIII / SmaI) vector containing the promoters of the GrSWP73B and GhSWP73B genes. The GhSWP73B promoter sequence (SEQ ID NO:2) was used as a control (without GrmotifD and GrmotifE). The expression of the GUS gene was driven using the GrSWP73B promoter sequence (SEQ ID NO:1) (containing GrmotifD and GrmotifE cis-acting elements). The specific procedure is as follows:

[0089] (1) Soak Col-0 seeds in 70% alcohol for 5 min and then rinse twice with sterile water;

[0090] (2) After disinfecting with an appropriate amount of sodium hypochlorite solution for 8 minutes, rinse 3 times with sterile water;

[0091] (3) Spread the Col-0 seeds evenly on 1 / 2 MS solid medium and incubate in a light incubator for about 2 weeks;

[0092] (4) Transplant into paper cups filled with moist nutrient soil and vermiculite, and let them grow until they flower;

[0093] (5) The flowers of Arabidopsis thaliana were completely immersed in the prepared Agrobacterium containing the expression vector for 45 s, the leaves were wiped dry, and the flowers were treated in the dark at room temperature (25℃) for 24 h.

[0094] (6) Repeat step (5) after one week, about 3 times, and harvest the seeds after they mature to be the T1 generation;

[0095] (7) Clean the T1 generation seeds according to (1) and (2) above, spread them evenly on 1 / 2 MS solid medium containing kana resistance, and culture them in a light incubator for about 2 weeks;

[0096] (8) Those that survive on Kana resistant medium are positive clones. The seeds are harvested as T2 generation. Repeat the above steps to harvest T3 generation for promoter tissue activity analysis.

[0097] 2. Promoter tissue activity analysis

[0098] Leaves, flowers, siliques, and early seedlings of positive transgenic Arabidopsis thaliana were collected and placed in GUS staining solution overnight at 37°C. The next day, the samples were placed in 70% ethanol and destained at 37°C or room temperature, with the ethanol replaced 2-3 times during this period (until the chlorophyll was completely removed and the tissue turned white or pale yellow); finally, photographs were taken for recording. Tissue-specific analysis of the GhSWP73B and GrSWP73B promoters showed that the GhSWP73B promoter was expressed only in the stamens of seedlings and flowers, while the GrSWP73B promoter was expressed in seedlings, leaves, petals, siliques, and seeds, with significantly increased activity. Figure 5 ).

[0099] sequence list

[0100] GrSWP73B gene promoter (SEQ ID NO:1):

[0101]

[0102] GhSWP73B promoter (SEQ ID NO:2):

[0103]

Claims

1. A cis-acting element, characterized in that, The cis-acting element is selected from at least one of GrmotifD and GrmotifE; the core motif sequence of GrmotifD is CATCA, and the core motif sequence of GrmotifE is ATTAA; the cis-acting element is used to enhance the activity of the cotton SWP73B gene promoter, and the nucleotide sequence of the cotton SWP73B gene promoter is shown in SEQ ID NO:1 or SEQ ID NO:

2.

2. The cis-acting element according to claim 1, characterized in that, The cis-acting element is located in the cotton GrSWP73B gene promoter as shown in SEQ ID NO:1, wherein GrmotifD is located at -744 bp to -740 bp and GrmotifE is located at -731 bp to -727 bp; the GrmotifD and / or GrmotifE are introduced into the cotton GhSWP73B gene promoter with the nucleotide sequence shown in SEQ ID NO:2 to improve the transcriptional activity of the cotton GhSWP73B gene promoter.

3. A cotton SWP73B gene promoter, characterized in that, The promoter comprises the cis-acting element as described in claim 1 or 2, and the promoter is at least one of the following (a1)-(a3): (a1) The GrSWP73B gene promoter with a nucleotide sequence as shown in SEQ ID NO:1; (a2) and (a1) refer to the functional truncated fragments of the GrSWP73B gene promoter; the functional truncated fragments are the pro-1366 or pro-1093 segments of the GrSWP73B gene promoter sequence, wherein the nucleotide sequence of the pro-1366 segment corresponds to positions -1 to -1366 of SEQ ID NO:1; and the nucleotide sequence of the pro-1093 segment corresponds to positions -1 to -1093 of SEQ ID NO:

1. (a3) A point mutation located in the cis-acting element region is introduced into the wild-type GhSWP73B gene promoter with the nucleotide sequence shown in SEQ ID NO:2 to obtain a mutant promoter containing at least one cis-acting element of GrmotifD and GrmotifE; the transcriptional activity of the mutant promoter is higher than that of the wild-type GhSWP73B gene promoter.

4. The promoter according to claim 3, characterized in that, The point mutation described in (a3) ​​is introduced via overlap extension PCR, specifically including the following steps: (i) Design two primer pairs, including flanking primer pairs 1F and 2R and bridging primer pairs 1R and 2F containing the mutation site; (ii) Perform the first round of PCR amplification, using the wild-type GhSWP73B gene promoter as a template, and perform the following two independent reactions: Reaction A: Using flanking primer 1F and bridging primer 1R, the upstream fragment containing the mutation site was amplified; Reaction B: Using bridging primer 2F and flanking primer 2R, downstream fragments containing the mutation site were amplified; (iii) Perform a second round of PCR amplification using the purified product from the first round of PCR as a template. After amplification without primers, the upstream and downstream fragments are spliced ​​together by complementary overlapping sequences. (iv) Add flanking primers 1F and 2R and continue amplification to obtain the full-length mutant promoter sequence.

5. The promoter according to claim 4, characterized in that, In step (i), The nucleotide sequences of the flanking primer pairs used to introduce the point mutation of GrmotifD are shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequences of the bridging primer pairs are shown in SEQ ID NO:5 and SEQ ID NO:

6. The nucleotide sequences of the flanking primer pairs used to introduce point mutations in GrmotifE are shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequences of the bridging primer pairs are shown in SEQ ID NO:7 and SEQ ID NO:

8.

6. A biomaterial comprising the promoter of any one of claims 3-5, characterized in that, The biological materials mentioned are expression cassettes, recombinant vectors, recombinant cells, or recombinant bacteria.

7. The biomaterial according to claim 6, characterized in that, The recombinant vector is a recombinant vector constructed by inserting the promoter described in any one of claims 3-5 between the HindIII and SmaI restriction sites of the pBI121 vector, replacing the original 35S promoter.

8. The application of the cis-acting element according to claim 1 or 2 in enhancing the promoter activity of the cotton SWP73B gene, characterized in that, The nucleotide sequence of the cotton SWP73B gene promoter is shown in SEQ ID NO:1 or SEQ ID NO:

2.

9. The use of the promoter according to any one of claims 3-5 in either (b1) or (b2): (b1) Application in increasing the expression level of the SWP73B gene in Arabidopsis thaliana, tobacco or cotton; (b2) Application in the development of new cotton germplasm with large boll phenotype.

10. The use of the biomaterial of claim 6 in either (b1) or (b2): (b1) Application in increasing the expression level of the SWP73B gene in Arabidopsis thaliana, tobacco or cotton; (b2) Application in the development of new cotton germplasm with large boll phenotype.

11. A method for increasing the expression level of the SWP73B gene in plants, characterized in that, The invention includes introducing the promoter described in any one of claims 3-5 into a target plant and causing the promoter to drive the expression of the target gene, thereby enhancing the tissue-specific or broad-spectrum expression of the target gene; the plant is Arabidopsis thaliana, tobacco, or cotton.

12. A method for cultivating cotton with large boll characteristics, characterized in that, Includes the following steps: (a) Providing a recombinant vector comprising the promoter of any one of claims 3-5; (b) Introducing the recombinant vector into cotton plant cells; (c) Screening for transgenic cotton plants that stably integrate the promoter, which exhibit increased boll weight.

Images