Promoter ep11 and related biomaterials and applications
By introducing the EP11 promoter into Corynebacterium glutamicum to drive the expression of lysC, ddh, lysA and gnd genes, the problem of insufficient L-lysine production capacity in the prior art has been solved, and efficient production of L-lysine and other amino acids has been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NINGXIA EPPEN BIOTECH CO LTD
- Filing Date
- 2024-12-27
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies are insufficient to effectively increase L-lysine production capacity, and it is necessary to find suitable promoters to enhance the expression intensity of key genes involved in L-lysine synthesis.
A promoter called EP11 is provided, which drives the expression of the lysC, ddh, lysA and gnd genes of Corynebacterium glutamicum by inserting it before the start codons of these genes, thereby constructing recombinant vectors and recombinant microorganisms and increasing the production of L-lysine.
By using the EP11 promoter, the production of L-lysine was significantly increased, and it can be used to produce a variety of other amino acids, thus enhancing the production capacity of the microbial strain.
Smart Images

Figure BDA0005214164260000111
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to promoter EP11 and related biomaterials and applications. Background Technology
[0002] Lysine, chemically known as 2,6-diaminohexanoic acid, is an essential basic amino acid that the body cannot synthesize and must obtain from food. Lysine is mainly found in animal-based foods and legumes; cereal grains contain very little lysine, and it is easily destroyed during processing, thus it is considered the first limiting amino acid. Only the L-form of lysine is absorbed by the body; the CAS number for L-lysine is 56-87-1.
[0003] Lysine plays a vital role in promoting human growth and development, enhancing immunity, fighting viruses, promoting lipid oxidation, and alleviating anxiety. It also promotes the absorption of certain nutrients and works synergistically with others to enhance their physiological functions. In medicine, lysine can be used as an adjunct to diuretics to treat lead poisoning caused by decreased blood chloride levels. It can also form salts with acidic drugs (such as salicylic acid) to reduce adverse reactions. Combined with methionine, it can inhibit severe hypertension. Furthermore, research indicates that lysine supplementation can accelerate the recovery from herpes infections and inhibit their recurrence.
[0004] Due to the significant utilization value of L-lysine, various studies are underway to develop efficient microbial strains and fermentation technologies for its production. Methods for improving the performance of these microbial strains include mutagenesis, mutant selection, and screening. For example, screening for strong promoters to enhance the expression intensity of key genes involved in L-lysine synthesis, thereby increasing their activity and ultimately improving L-lysine production. However, with the increasing demand for L-lysine year by year, further in-depth research on microbial strains is still needed to find suitable promoters to effectively increase L-lysine production capacity. Summary of the Invention
[0005] The technical problem to be solved by this invention is how to produce L-amino acids, especially L-lysine.
[0006] To address the aforementioned technical problems, the present invention first provides a DNA molecule with promoter function, named EP11 promoter, which contains the nucleic acid molecule shown in SEQ ID No. 1 of the sequence listing.
[0007] In one embodiment of the present invention, the EP11 promoter is the DNA molecule shown in SEQ ID No. 1 of the sequence listing.
[0008] The present invention also provides biomaterials associated with the EP11 promoter, said biomaterials containing any one of the following B1) to B7):
[0009] B1) Expression box containing the EP11 promoter;
[0010] B2) Recombinant vectors containing the EP11 promoter;
[0011] B3) A recombinant vector containing the expression cassette described in B1);
[0012] B4) Recombinant microorganisms containing the EP11 promoter;
[0013] B5) Recombinant microorganisms containing the expression cassette described in B1);
[0014] B6) Recombinant microorganisms containing the recombinant vector described in B2);
[0015] B7) Recombinant microorganisms containing the recombinant vector described in B3).
[0016] In the aforementioned biological materials, the expression cassette containing the EP11 promoter described in B1) refers to DNA capable of driving the expression of a target gene by the EP11 promoter in host cells. This DNA may include not only the target gene but also a terminator to terminate the transcription of the target gene. Furthermore, the expression cassette may also include an enhancer sequence.
[0017] Recombinant vectors containing the EP11 promoter can be constructed using existing expression vectors.
[0018] In the aforementioned biological materials, the carrier may be a plasmid, a granule, a bacteriophage, or a viral vector.
[0019] In the aforementioned biological materials, the microorganisms may be yeast, bacteria, algae, or fungi. Among them, bacteria may be *Corynebacterium glutamicum* (such as *Corynebacterium glutamicum* CGMCC No. 12856, *Corynebacterium glutamicum* ATCC13032), *Brevibacterium lactis*, *Brevibacterium flavum*, *Corynebacterium pekinense*, *Brevibacterium ammonia-eating*, *Corynebacterium obliterans*, or *Pantoea*.
[0020] The recombinant microorganisms can be obtained by inserting the EP10 promoter before the start codons of the lysC, ddh, lysA, and gnd genes in Corynebacterium glutamicum ATCC13032 or Corynebacterium glutamicum CGMCC No.12856.
[0021] The present invention also provides the application of the EP11 promoter as a promoter.
[0022] The present invention also provides the use of the EP11 promoter or the biomaterial in the production of L-amino acids.
[0023] In the above applications, the L-amino acid is at least L-lysine, but may also be other L-amino acids.
[0024] The EP11 promoter of this invention can be used to produce a variety of products, including but not limited to L-lysine in the examples. Other products produced include glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc. To produce these products, the EP11 promoter of this invention is placed upstream of the gene in the target product's synthetic pathway, and the EP11 promoter drives the expression of genes in the target product's synthetic pathway (such as the lysC gene, ddh gene, lysA gene, and gnd gene in Corynebacterium glutamicum).
[0025] In one embodiment of the present invention, the gene in the synthetic pathway of the target product is the lysC gene, and the sequence of the lysC gene is the lysC gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0026] In another embodiment of the present invention, the gene in the synthetic pathway of the target product is the ddh gene, and the sequence of the ddh gene is the ddh gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0027] In another embodiment of the present invention, the gene in the synthetic pathway of the target product is the lysA gene, and the sequence of the lysA gene is the lysA gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0028] In another embodiment of the present invention, the gene in the synthetic pathway of the target product is the gnd gene, and the sequence of the gnd gene is the gnd gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0029] The present invention also provides a method for producing L-amino acids, the method comprising: introducing an EP11 promoter into a biological cell capable of synthesizing a target L-amino acid, thereby causing the EP11 promoter to drive the expression of a gene in the target L-amino acid synthesis pathway in the biological cell, to obtain a recombinant biological cell; and culturing the recombinant biological cell to obtain the target L-amino acid.
[0030] In the above method, the biological cell can be a yeast, bacteria, algae, fungus, plant cell or animal cell capable of synthesizing the target L-amino acid.
[0031] The biological cell can be any biological cell capable of synthesizing the target L-amino acid.
[0032] The bacteria are at least Corynebacterium glutamicum, and may also be lactic acid fermenting short bacilli, brevibacterium flavum, Corynebacterium pekinense, ammonia-eating short bacilli, blunt-toothed corynebacterium, or Pantoea.
[0033] In one embodiment of the present invention, the target L-amino acid is L-lysine, and the bacterium is Corynebacterium glutamicum CGMCC No. 12856.
[0034] In one embodiment of the present invention, the target L-amino acid is L-lysine, and the bacterium is Corynebacterium glutamicum ATCC13032.
[0035] The bacteria used for L-lysine production using the promoter of this invention include, but are not limited to, *Corynebacterium glutamicum* CGMCC No. 12856 and *Corynebacterium glutamicum* ATCC 13032. This invention allows the EP11 promoter of this invention to be placed upstream of genes in the L-lysine synthesis pathway of these bacteria, enabling the EP11 promoter to drive the expression of genes in the L-lysine synthesis pathway in these bacteria, thereby synthesizing L-lysine.
[0036] Specifically, in one embodiment of the present invention, the gene in the L-lysine synthesis pathway is the lysC gene, and the sequence of the lysC gene is the lysC gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0037] In another embodiment of the present invention, the gene in the L-lysine synthesis pathway is the ddh gene, and the sequence of the ddh gene is the ddh gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0038] In another embodiment of the present invention, the gene in the L-lysine synthesis pathway is the lysA gene, and the sequence of the lysA gene is the lysA gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0039] In another embodiment of the present invention, the gene in the L-lysine synthesis pathway is the gnd gene, and the sequence of the gnd gene is the gnd gene in the genome of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC No.12856.
[0040] In the above method, the target L-amino acid is at least L-lysine, but may also be other L-amino acids.
[0041] The EP11 promoter of this invention can be used to produce a variety of products, including but not limited to L-lysine in the examples. Other products produced may include glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc. To produce various target products, the EP11 promoter of this invention is placed upstream of the gene in the target product synthesis pathway, and the EP11 promoter drives the expression of the gene in the target product synthesis pathway to achieve the production of the target product.
[0042] In one embodiment of the present invention, the target L-amino acid is L-lysine, and the bacteria is Corynebacterium glutamicum ATCC13032 or Corynebacterium glutamicum CGMCC No.12856.
[0043] The recombinant biological cells were obtained by inserting the EP10 promoter before the start codons of the lysC, ddh, lysA, and gnd genes in Corynebacterium glutamicum ATCC13032 or Corynebacterium glutamicum CGMCC No.12856.
[0044] For amino acid-producing bacteria, this invention utilizes the EP11 promoter to activate genes in the L-lysine synthesis pathway, thereby increasing L-lysine production. This demonstrates that the EP11 promoter of this invention not only possesses high activation activity but can also be used for L-lysine production.
[0045] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0046] Instructions for the Preservation of Biological Materials
[0047] Classification and nomenclature: Corynebacterium glutamicum
[0048] Strain number: YP097158
[0049] Name of depositary institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee
[0050] Abbreviation of depositary institution: CGMCC
[0051] Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Postcode: 100101
[0052] Date of preservation: August 16, 2016
[0053] CGMCC Registration Number: CGMCC No. 12856 Detailed Implementation
[0054] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following embodiments are commercially available. All quantitative experiments in the following embodiments were performed in at least three replicates, and the results were averaged.
[0055] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.01 indicated a highly significant difference, while P < 0.05 indicated a significant difference.
[0056] The Corynebacterium glutamicum CGMCC No. 12856 in the following examples is a strain deposited on August 16, 2016, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) with accession number CGMCC No. 12856. This strain contains the L-lysine synthesis pathway.
[0057] Example 1: Acquisition of the novel promoter EP11
[0058] Using the wild-type promoter of the proP gene from *Corynebacterium glutamicum* ATCC13032, published on NCBI, as a template, the promoter structure was predicted using the SoftBerry website. The most critical regions—the -10 region, -35 region, and the RBS binding site—were modified, resulting in a novel promoter, the nucleotide sequence of which is shown in SEQ ID No. 1. This novel promoter was directly synthesized according to SEQ ID No. 1 (by Invitrogen Shanghai), ligated into the pMD19-T vector, and sequenced. The sequencing results were correct, and the sequence is shown in SEQ ID No. 1. The novel promoter was named EP11.
[0059] Example 2: Construction of a strain with EP11 promoter-driven lysC gene expression
[0060] Primers were designed and synthesized based on the EP11 promoter sequence shown in SEQ ID No. 1 and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI. These primers were used to insert the EP11 promoter into the front of the lysC gene start codon GTG, thereby enhancing lysC gene expression. The specific primer design is as follows (synthesized by Invitrogen Shanghai):
[0061] P1: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGGTGAGGATTAGG-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector);
[0062] P2: 5'-GGCACCGAAATGGGCAACCTTTGTGCACCTTTCGATC-3';
[0063] P3: 5'-GATCGAAAGGTGCACAAAGGTTGCCCATTTCGGTGCC-3';
[0064] P4: 5'-CTGTACGACCAGGGCCACGTAAAAAATCCTTTCGTAG-3';
[0065] P5: 5'-CTACGAAAGGATTTTTTACGTGGCCCTGGTCGTACAG-3';
[0066] P6: 5'- ACAGGAAACAGCTATGACCATGATTACGAATTCGAG GAGCGTATTCAACACTGCG-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector).
[0067] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P1 / P2, P3 / P4, and P5 / P6, respectively, to obtain a 931bp fragment containing an upstream homologous arm (sequence shown as positions 1-931 of SEQ ID No. 2), a 455bp fragment containing the EP11 promoter (sequence shown as positions 895-1349 of SEQ ID No. 2), and a 716bp fragment containing a downstream homologous arm (sequence shown as positions 1313-2028 of SEQ ID No. 2).
[0068] After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The recovered fragments were then ligated with the pK18mobsacB plasmid (Biovector, PK18) purified after enzyme digestion (Xba I / EcoRI) using NEBuilder enzyme (NEB product) at 50°C for 60 min. The resulting single clones were identified by PCR using primers P1 / P6 (amplified sequence as shown in SEQ ID No. 2) to obtain a positive integration plasmid (recombinant vector). The obtained recombinant vector was pK18-EP11-lysC. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin screening. The recombinant plasmid pK18-EP11-lysC has been sequenced and verified. Compared to the pK18mobsacB plasmid, the recombinant plasmid pK18-EP11-lysC differs only in that the double-stranded DNA molecule shown in positions 37-1992 of SEQ ID No. 2 replaces “AGGATCCCCGGGTACCGAG” in the pK18mobsacB plasmid, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0069] The correctly sequenced integration plasmid pK18-EP11-lysC was electroporated into wild-type Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum CGMCC No.12856. The cultures were then incubated on solid culture plates (the composition of which is shown in Table 1) for 40 h. Single colonies were identified by PCR using P7 / P8 primers. Strains that amplified a 1396 bp fragment (sequence shown in SEQ ID No.3) were considered positive strains, while those that did not amplify the fragment were considered the original strains. The positive strains were streaked on solid culture plates containing 15% sucrose (the sucrose content in the culture medium in Table 1 was adjusted to 150 g / L) and cultured for 40 h. The single colonies produced were further identified by PCR using P9 / P10 primers. The strains that were amplified by PCR and contained a 1165 bp fragment (sequence shown in SEQ ID No. 4) were positive strains with the EP11 promoter sequence inserted before the GTG start codon of the lysC gene. The positive strains obtained from Corynebacterium glutamicum CGMCC No. 12856 and wild-type Corynebacterium glutamicum ATCC13032 were named L-EP11-lysC and Y-EP11-lysC, respectively.
[0070] The only difference between the recombinant strain L-EP11-lysC and Corynebacterium glutamicum CGMCC No.12856 is that the recombinant strain L-EP11-lysC is obtained by inserting the EP11 promoter sequence (SEQ ID No.1) before the start codon GTG of the lysC gene in the genome of Corynebacterium glutamicum CGMCC No.12856, while keeping other sequences unchanged.
[0071] The only difference between the recombinant strain Y-EP11-lysC and the wild-type Corynebacterium glutamicum ATCC13032 is that the recombinant strain Y-EP11-lysC is obtained by inserting the EP11 promoter sequence (SEQ ID No. 1) before the start codon GTG of the lysC gene in the genome of the wild-type Corynebacterium glutamicum ATCC13032, while keeping other sequences unchanged.
[0072] P7: 5'-GAACCAAGTAGCCCAAACTG-3';
[0073] P8: 5'-TTCGTAGGTTTCCGTGTCG-3';
[0074] P9: 5'-CACGGCACCGAAAACAGTAAC-3';
[0075] P10: 5'-GGTAAGGACTGCTTTCTTCCAC-3'.
[0076] Table 1. Composition of Corynebacterium glutamicum culture medium (solvent is water)
[0077] Element Final concentration sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L yeast powder 5g / L Urea 2g / L Sodium chloride 2.5g / L Agar powder 18g / L pH 7.0
[0078] Example 3: Construction of a strain with EP11 promoter-driven ddh gene expression
[0079] Primers were designed and synthesized based on the EP11 promoter sequence shown in SEQ ID No. 1 and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI. These primers were used to insert the EP11 promoter into the front of the ATG start codon of the ddh gene, thereby enhancing the expression of the ddh gene. The specific primer design is as follows (synthesized by Invitrogen Shanghai):
[0080] P11: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GATCAGATCGTCCAAGTTCTC-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector);
[0081] P12: 5'-CTACGAAAGGATTTTTTACATGACCAACATCCGCGTAG-3';
[0082] P13: 5'-CTACGCGGATGTTGGTCATGTAAAAAATCCTTTCGTAG-3';
[0083] P14: 5'-CACAATTTTGGAGGATTACAAGAACGTTGCCCATTTCGGTGCC-3';
[0084] P15: 5'-GGCACCGAAATGGGCAACGTTCTTGTAATCCTCCAAAATTGTG-3';
[0085] P16: 5'- ACAGGAAACAGCTATGACCATGATTACGAATTCGAG CAAAGAACTTCCCAATCTCC-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector).
[0086] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P11 / P12, P13 / P14, and P15 / P16, respectively, to obtain a 1003bp fragment containing an upstream homologous arm (sequence of positions 1-1003 in SEQ ID No. 5), a 462bp fragment containing the EP11 promoter (sequence of positions 966-1427 in SEQ ID No. 5), and a 916bp fragment containing a downstream homologous arm (sequence of positions 1385-2300 in SEQ ID No. 5).
[0087] After the PCR reaction, the three fragments obtained from the amplification were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB plasmid, which had been purified after digestion with Xba I / EcoRI, using NEBuilder enzyme (NEB product) at 50℃ for 60 min. The ligation product was transformed into monoclonal clones, and the resulting positive integration plasmid (recombinant vector) was identified by PCR using primers P11 / P16 (amplified sequence as shown in SEQ ID No. 5). The obtained recombinant vector was pK18-EP11-ddh. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin screening. The recombinant plasmid pK18-EP11-ddh has been sequenced and verified. Compared to the pK18mobsacB plasmid, the recombinant plasmid pK18-EP11-ddh differs only in that the double-stranded DNA molecule shown in positions 37-2264 of SEQ ID No. 5 replaces “AGGATCCCCGGGTACCGAG” in the pK18mobsacB plasmid, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0088] The correctly sequenced integration plasmid pK18-EP11-ddh was electroporated into wild-type Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum CGMCC No.12856, and then cultured on solid medium plates (the composition of the medium is shown in Table 1) for 40 h. The single colonies produced by the culture were identified by PCR using P17 / P9 primers. The positive strains were those that amplified by PCR containing a 1761 bp fragment (the sequence is shown in SEQ ID No. 6), and the original strains were those that could not amplify the fragment. The positive strains were streaked on solid culture plates containing 15% sucrose (the sucrose content in the culture medium in Table 1 was adjusted to 150 g / L) and cultured for 40 h. The single colonies produced were further identified by PCR using P8 / P18 primers. The strains that were amplified by PCR and contained a 1422 bp fragment (sequence shown in SEQ ID No. 7) were positive strains with the EP11 promoter inserted before the ATG start codon of the ddh gene. The positive strains obtained from Corynebacterium glutamicum CGMCC No. 12856 and wild-type Corynebacterium glutamicum ATCC13032 were named L-EP11-ddh and Y-EP11-ddh, respectively.
[0089] The only difference between the recombinant strain L-EP11-ddh and Corynebacterium glutamicum CGMCC No.12856 is that the recombinant strain L-EP11-ddh is obtained by inserting the EP11 promoter sequence (SEQ ID No.1) before the ATG start codon of the ddh gene in the genome of Corynebacterium glutamicum CGMCC No.12856, while keeping other sequences unchanged.
[0090] The only difference between the recombinant strain Y-EP11-ddh and the wild-type Corynebacterium glutamicum ATCC13032 is that the recombinant strain Y-EP11-ddh is obtained by inserting the EP11 promoter sequence (SEQ ID No. 1) before the start codon ATG of the ddh gene in the genome of wild-type Corynebacterium glutamicum ATCC13032, while keeping other sequences unchanged.
[0091] P17: 5'-CCACGAGACCCAATCCTATC-3';
[0092] P18: 5'-TCTCTCCCTATTTGAGGGCG-3'.
[0093] Example 4: Construction of a strain with EP11 promoter-driven lysA gene expression
[0094] Primers were designed and synthesized based on the EP11 promoter sequence shown in SEQ ID No. 1 and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI. These primers were used to insert the EP11 promoter into the front of the start codon ATG of the lysA gene, thereby enhancing the expression of the lysA gene. The specific primer design is as follows (synthesized by Invitrogen Shanghai):
[0095] P19: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGATGTCTACTACCACGAGAAC-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector);
[0096] P20: 5'-GGCACCGAAATGGGCAACTGTTACATCTTCCTCCGGTG-3';
[0097] P21: 5'-CACCGGAGAAGATGTAACAGTTGCCCATTTCGGTGCC-3';
[0098] P22: 5'-GAAATTTTCAACTGTAGCCATGTAAAAAATCCTTTCGTAG-3';
[0099] P23: 5'-CTACGAAAGGATTTTTTACATGGCTACAGTTGAAAATTTC-3';
[0100] P24: 5'- ACAGGAAACAGCTATGACCATGATTACGAATTCGAG TCGTATTCGGAGCCGTAGAG-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector).
[0101] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P19 / P20, P21 / P22, and P23 / P24, respectively, to obtain a 963bp fragment containing an upstream homologous arm (sequence of positions 1-963 of SEQ ID No. 8), a 458bp fragment containing the EP11 promoter (sequence of positions 927-1384 of SEQ ID No. 8), and a 1110bp fragment containing a downstream homologous arm (sequence of positions 1345-2454 of SEQ ID No. 8).
[0102] After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB plasmid, which had been purified after digestion with Xba I / EcoRI, using NEBuilder enzyme (NEB product) at 50℃ for 60 min. The ligation product, after transformation, resulted in single clones that were identified by PCR using primers P19 / P24 (the amplified product sequence is SEQ ID No. 8), yielding a positive integration plasmid (recombinant vector). The resulting recombinant vector was pK18-EP11-lysA. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin screening. The recombinant plasmid pK18-EP11-lysA has been sequenced and verified. Compared to the pK18mobsacB plasmid, the recombinant plasmid pK18-EP11-lysA differs only in that the double-stranded DNA molecule shown in positions 37-2418 of SEQ ID No. 8 replaces “AGGATCCCCGGGTACCGAG” in the pK18mobsacB plasmid, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0103] The correctly sequenced integration plasmid pK18-EP11-lysA was electroporated into wild-type Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum CGMCC No.12856, and then cultured on solid medium plates (the composition of the medium is shown in Table 1) for 40 h. The single colonies produced by the culture were identified by PCR using P25 / P8 primers. The positive strains were those that amplified by PCR containing a 1375 bp fragment (the sequence is shown in SEQ ID No. 9), and the original strains were those that could not amplify the fragment. The positive strains were streaked on solid culture plates containing 15% sucrose (the sucrose content in the culture medium in Table 1 was adjusted to 150 g / L) and cultured for 40 h. The single colonies produced were further identified by PCR using P9 / P26 primers. The strains containing a 1571 bp fragment (sequence shown in SEQ ID No. 10) were positive strains with the EP11 promoter inserted before the ATG start codon of the lysA gene. The positive strains obtained from Corynebacterium glutamicum CGMCC No. 12856 and wild-type Corynebacterium glutamicum ATCC13032 were named L-EP11-lysA and Y-EP11-lysA, respectively.
[0104] The only difference between the recombinant strain L-EP11-lysA and Corynebacterium glutamicum CGMCC No.12856 is that the recombinant strain L-lysA is obtained by inserting the EP11 promoter sequence (SEQ ID No.1) before the ATG start codon of the lysA gene in the genome of Corynebacterium glutamicum CGMCC No.12856, while keeping other sequences unchanged.
[0105] The only difference between the recombinant strain Y-EP11-lysA and the wild-type Corynebacterium glutamicum ATCC13032 is that the recombinant strain Y-EP11-lysA is obtained by inserting the EP11 promoter sequence (SEQ ID No. 1) before the start codon ATG of the lysA gene in the genome of wild-type Corynebacterium glutamicum ATCC13032, while keeping other sequences unchanged.
[0106] P25: 5'-AGGCGTGGAGATGATGTTC-3';
[0107] P26: 5'-TGGTGATGTCAGATGGGTAG-3'.
[0108] Example 5: Construction of a strain with EP11 promoter-driven gnd gene expression
[0109] Primers were designed and synthesized based on the sequence of EP11 shown in SEQ ID No. 1 and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI. These primers were used to insert the EP11 promoter into the front of the ATG start codon of the gnd gene, thereby enhancing the expression of the gnd gene. The specific primer design is as follows (synthesized by Invitrogen Shanghai):
[0110] P27: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG TAGCGGAGAAGGTGGTATG-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector);
[0111] P28: 5'-CTACGAAAGGATTTTTTACATGACTAATGGAGATAATCTCGCACAG-3';
[0112] P29: 5'-CTGTGCGAGATTATCTCCATTAGTCATGTAAAAAATCCTTTCGTAG-3';
[0113] P30: 5'-CCGTCAAGTACGATCAATAACGTTGCCCATTTCGGTGCC-3';
[0114] P31: 5'-GGCACCGAAATGGGCAACGTTATTGATCGTACTTGACGG-3';
[0115] P32: 5'- ACAGGAAACAGCTATGACCATGATTACGAATTCGAG CTTGGCGTAATCAATCAGG-3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector).
[0116] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P27 / P28, P29 / P30, and P31 / P32, respectively, to obtain a 684bp fragment containing an upstream homologous arm (sequence of positions 1-684 of SEQ ID No. 11), a 466bp fragment containing the EP11 promoter (sequence of positions 639-1104 of SEQ ID No. 11), and a 928bp fragment containing a downstream homologous arm (sequence of positions 1066-1993 of SEQ ID No. 11).
[0117] After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB plasmid, which had been purified after digestion with Xba I / EcoRI, using NEBuilder enzyme (NEB product) at 50℃ for 60 min. The ligation product, after transformation, resulted in single clones that were identified by PCR using primers P27 / P32 (amplification product sequence is SEQ ID No. 11), yielding a positive integration plasmid (recombinant vector). The resulting recombinant vector was pK18-EP11-gnd. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin screening. The recombinant plasmid pK18-EP11-gnd has been sequenced and verified. Compared to the pK18mobsacB plasmid, the recombinant plasmid pK18-EP11-gnd differs only in that the double-stranded DNA molecule shown in positions 37-1957 of SEQ ID No. 11 replaces “AGGATCCCCGGGTACCGAG” in the pK18mobsacB plasmid, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0118] The correctly sequenced integration plasmid pK18-EP11-gnd was electroporated into wild-type Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum CGMCC No.12856, and then cultured on solid medium plates (the composition of the medium is shown in Table 1) for 40 h. The single colonies produced by the culture were identified by PCR using P33 / P9 primers. The positive strains were those that amplified by PCR containing a 1377 bp fragment (the sequence is shown in SEQ ID No.12), and the original strains were those that could not amplify the fragment. The positive strains were streaked on solid culture plates containing 15% sucrose (the sucrose content in the culture medium in Table 1 was adjusted to 150 g / L) and cultured for 40 h. The single colonies produced were further identified by PCR using P8 / P34 primers. The strains that were amplified by PCR and contained a 1400 bp fragment (sequence shown in SEQ ID No. 13) were positive strains with the EP11 promoter inserted before the ATG start codon of the gnd gene. The positive strains obtained from Corynebacterium glutamicum CGMCC No. 12856 and wild-type Corynebacterium glutamicum ATCC13032 were named L-EP11-gnd and Y-EP11-gnd, respectively.
[0119] The only difference between the recombinant strain L-EP11-gnd and Corynebacterium glutamicum CGMCC No.12856 is that the recombinant strain L-EP11-gnd is obtained by inserting the EP11 promoter sequence (SEQ ID No.1) before the ATG start codon of the gnd gene in the genome of Corynebacterium glutamicum CGMCC No.12856, while keeping other sequences unchanged.
[0120] The only difference between the recombinant strain Y-EP11-gnd and the wild-type Corynebacterium glutamicum ATCC13032 is that the recombinant strain Y-EP11-gnd is obtained by inserting the EP11 promoter sequence (SEQ ID No. 1) before the ATG start codon of the gnd gene in the genome of wild-type Corynebacterium glutamicum ATCC13032, while keeping other sequences unchanged.
[0121] P33: 5'-ACGAACTGTGCCTTGTCCAC-3';
[0122] P34: 5'-ACCATCCTCAGCGAGAAAG-3'.
[0123] Example 6: L-Lysine Fermentation Experiment
[0124] The strains constructed in Examples 2-5, wild-type Corynebacterium glutamicum ATCC13032, and Corynebacterium glutamicum CGMCCNo.12856 were fermented in 500 mL baffle shakers under the culture medium shown in Table 2 and the control conditions shown in Table 3. After fermentation, the L-lysine yield was detected using an SBA-Biosensor Analyzer (Shandong Academy of Sciences Institute of Biology). Each strain was repeated three times, and the results are shown in Table 4.
[0125] Table 2. Shake-flask fermentation medium formulation (solvent is water)
[0126] Element Final concentration glucose 90g / L Molasses 15mL / L ammonium sulfate 45g / L Magnesium sulfate 1.2g / L Potassium dihydrogen phosphate 1.1g / L Corn syrup 15mL / L manganese sulfate 150mg / L Ferrous sulfate 200mg / L Zinc sulfate 1mg / L Copper sulfate 0.9 mg / L Vitamin B1 9mg / L Calcium pantothenate 9mg / L Niacinamide 60mg / L Biotin 1.8 mg / L Calcium carbonate 30g / L Defoamer 0.07 mL / L
[0127] Table 3. Fermentation Control Conditions
[0128] Inoculation volume 10% (by volume) pH pH 7.0 Incubation temperature 30℃ Control conditions 220 rpm Fermentation cycle 48h
[0129] Table 4. L-Lysine production and significance analysis
[0130]
[0131] Note: P<0.01 in the table indicates a highly significant difference compared to the original strain.
[0132] As shown in Table 4, driving the expression of lysC, lysA, ddh and gnd genes in Corynebacterium glutamicum using the EP11 promoter (SEQ ID No. 1) helps to increase L-lysine production.
[0133] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A DNA molecule containing the nucleic acid molecule shown in SEQ ID No.
1.
2. A biological material related to the DNA molecule of claim 1, comprising any one of B1) to B7) below: B1) An expression cassette containing the DNA molecule of claim 1; B2) A recombinant vector containing the DNA molecule of claim 1; B3) A recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the DNA molecule of claim 1; B5) Recombinant microorganisms containing the expression cassette described in B1); B6) Recombinant microorganisms containing the recombinant vector described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3).
3. The use of the DNA molecule of claim 1 as a promoter.
4. The use of the DNA molecule of claim 1 or the biomaterial of claim 2 in the production of L-amino acids.
5. The application according to claim 4, characterized in that: The L-amino acid is at least L-lysine.
6. A method for producing L-amino acids, comprising: The DNA molecule of claim 1 is introduced into a biological cell capable of synthesizing the target L-amino acid, thereby driving the expression of the gene in the target L-amino acid synthesis pathway in the biological cell to obtain a recombinant biological cell; the recombinant biological cell is cultured to obtain the target L-amino acid.
7. The method according to claim 6, characterized in that: The biological cells are yeast, bacteria, algae, fungi, plant cells, or animal cells capable of synthesizing the target L-amino acid.
8. The method according to claim 7, characterized in that: The bacteria are at least Corynebacterium glutamicum.
9. The method according to any one of claims 6-8, characterized in that: The target L-amino acid is L-lysine.