Application of ZmEREB101 gene in improving the genetic transformation efficiency of different maize inbred lines

By applying the ZmEREB101 gene and its encoded protein to maize and using Agrobacterium-mediated transformation, the problems of strong genotype dependence and low efficiency in maize transformation technology have been solved, achieving efficient genetic transformation and promoting the progress of maize functional genomics and bio-breeding.

CN122303261APending Publication Date: 2026-06-30BEIJING CIIC INT INST OF BIOLOGICAL AGRI +2

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING CIIC INT INST OF BIOLOGICAL AGRI
Filing Date
2026-05-29
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing maize genetic transformation technologies suffer from strong genotype dependence and low transformation efficiency, which limits their application in fields such as gene function analysis, new material creation, and synthetic biology.

Method used

Using the ZmEREB101 gene and its encoded protein, maize genetic transformation was performed via Agrobacterium-mediated transformation, which significantly improved the transformation efficiency of maize inbred lines of different genotypes.

Benefits of technology

It significantly improved the genetic transformation efficiency of maize inbred lines, broadened the selection range of transformation recipient inbred lines, and promoted the progress of maize functional genomics research and bio-breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303261A_ABST
    Figure CN122303261A_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant genetic engineering, and discloses... ZmEREB101 Application of genes in improving the genetic transformation efficiency of different maize inbred lines. This invention involves isolating... ZmEREB101 The gene was generated and recombinant vectors, expression cassettes, or recombinant bacteria containing the gene were constructed. Agrobacterium-mediated transformation was used to genetically transform maize inbred lines B104, Zheng 58, Xiang 249, and B73. The results showed that the gene significantly improved transformation efficiency. Compared with traditional methods, this invention not only effectively improved the efficiency of easily transformable genotypes but also significantly improved the transformation effect of difficult-to-transform maize inbred lines, effectively overcoming the limitations imposed by recipient genotypes in maize genetic transformation. This achievement significantly broadens the applicability of maize genetic transformation and provides a new tool for efficiently conducting research and application of gene functions related to high yield, high quality, disease and pest resistance, and stress resistance in maize.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving ZmEREB101 Application of genes in efficient genetic transformation of maize. Background Technology

[0002] As one of the world's three major staple crops, maize is not only an important source of nutrition for humankind but also a key focus of agricultural technology development. With advancements in biotechnology, transgenic breeding has become a crucial pathway for agricultural progress. Transgenic maize shows significant potential in increasing yield, optimizing quality, enhancing stress resistance, and reducing reliance on pesticides and fertilizers. Therefore, research on transgenic maize has significant scientific and practical importance, and its core foundation lies in an efficient and stable genetic transformation system. While maize genetic transformation technology continues to develop, it still faces bottlenecks such as strong genotype dependence and low transformation efficiency, limiting its application in cutting-edge fields such as gene function analysis, new material creation, gene editing, and synthetic biology. In particular, the rise of precision editing tools like CRISPR-Cas9 and synthetic biology has placed higher demands on the efficiency and universality of genetic transformation systems. Therefore, constructing an efficient, widely applicable, and stable maize genetic transformation platform has become an urgent need for modern agricultural biotechnology research.

[0003] The AP2 / EREBP (APETALA2 / ethylene response element binding protein) transcription factor family plays a crucial role in plant growth, development, and stress responses. Members of this family each contain one or two highly conserved AP2 / ERF DNA-binding domains, and are divided into two subfamilies: the AP2 subfamily primarily regulates floral organ and seed development, while the EREBP subfamily (including DREB and ERF types) is widely involved in plant responses to hormones (such as ethylene and abscisic acid), pathogen infection, and abiotic stresses such as drought, low temperature, and high salinity (Jofuku et al., 1994). ZmEREB101 The gene encodes an EREBP protein, the function of which has not yet been reported in maize. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention aims to provide... ZmEREB101 Application of genes and their encoded proteins in maize genetic transformation. This invention successfully isolated... ZmEREB101 The gene was identified, and genetic transformation experiments were conducted using Agrobacterium-mediated transformation. The results showed that the gene could significantly improve the transformation efficiency of maize inbred lines with different genotypes. ZmEREB101 The discovery and application of genes in improving the efficiency of maize genetic transformation will not only help expand the range of inbred lines for maize transformation recipients, but will also promote the research progress of maize functional genomics and accelerate the process of maize biobreeding, which has important potential value.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, corn is obtained by cloning. ZmEREB101 Gene; A second aspect of the invention provides ZmEREB101 Application of genes in efficient genetic transformation of maize; The ZmEREB101 Genes are nucleic acid molecules as shown in (1) or (2) below: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO. 2.

[0006] A third aspect of the invention provides ZmEREB101 Application of gene-encoded proteins in improving the efficiency of maize genetic transformation; The ZmEREB101 The protein encoded by the gene is the protein shown in (1) or (2) below: (1) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2 of the sequence listing; (2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (1). The proteins described in (1) and (2) can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0007] In the above-mentioned proteins, a protein tag refers to a polypeptide or protein expressed by fusing it with a target protein using in vitro DNA recombination technology, in order to facilitate the expression, detection, tracking, and / or purification of the target protein. Specifically, to facilitate the purification of the protein in (1), a tag can be attached to the amino or carboxyl terminus of the protein in (1). The tag can be Poly-His (usually 6 HHHHHH), FLAG (DYKDDDDK), or c-Myc (EQKLISEEDL), etc.

[0008] A fourth aspect of the present invention provides a method for improving the transformation efficiency of nucleic acid molecules introduced into target plants: [The method involves...] ZmEREB101 Genes and nucleic acid molecules are transferred into target plants to improve the transformation efficiency of nucleic acid molecule introduction into target plants. ZmEREB101 Genes are nucleic acid molecules as shown in (1) or (2) below: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO. 2.

[0009] In the above method, ZmEREB101 Genes and nucleic acid molecules can be transferred into target plants through a vector or through different vectors.

[0010] The beneficial effects of this invention are: This invention is the first to discover corn ZmEREB101 The crucial role of genes in promoting the efficiency of plant genetic transformation. This study shows that... ZmEREB101 The gene significantly improved the genetic transformation efficiency of maize inbred lines B104, Zheng 58, Xiang 249, and B73, effectively overcoming the technical bottleneck of maize transformation being limited by genotype and broadening the selection range of transformation recipient inbred lines. This not only provides an important tool for analyzing maize functional genomics but also demonstrates broad application potential in bio-breeding, possessing significant economic value and social benefits for the targeted improvement of high-yield, high-quality, and stress-resistant traits in crops. Attached Figure Description

[0011] Figure 1 For corn ZmEREB101 Gene amplification electrophoresis diagram.

[0012] Figure 2 Recombinant plasmid pG3GB411-ZmEREB101 Structural diagram.

[0013] Figure 3 plant expression vector pG3GB411-ZmEREB101 Structural diagram.

[0014] Figure 4 For overexpression ZmEREB101 Callus regeneration phenotype.

[0015] Figure 5 For overexpression ZmEREB101 Statistical chart of callus induction rate and conversion rate. Detailed Implementation

[0016] Example 1 ZmEREB101 Cloning of genes RNA was extracted from immature embryos of maize inbred line B73 nine days after pollination and reverse transcribed. The synthesized cDNA was then used as a template for amplification. ZmEREB101 The gene has a full-length CDS region of 900 bp. The amplification system is shown in Table 1: Table 1 ZmEREB101 Gene amplification system

[0017] The primer sequences are as follows (5'-3'): EREB101-F (SEQ ID NO.3):CGAAAACCAACTCCCTCCTC EREB101-R (SEQ ID NO.4): GACCTCCTTCCTGGCAATC The PCR reaction program was as follows: 95 ℃ pre-denaturation for 5 min; 98 ℃ denaturation for 10 s, 59 ℃ annealing for 30 s, 68 ℃ extension for 30 s, 32 cycles; 68 ℃ extension for 5 min, and incubation at 16 ℃. The obtained PCR products were analyzed by 1.5% agarose gel electrophoresis. The target fragment (PCR product size 1279 bp) was recovered from the gel. Figure 1 The above PCR product was ligated into the pEASY-BluntZero Cloning Vector (CB501, full-gold) to obtain... pEASY-Blunt-EREB101 The CDS sequence of the PCR product was obtained by sequencing, as shown in SEQ NO.1, and named as follows. ZmEREB101 The gene, whose CDS length is 900 bp and encodes 300 amino acids, as shown in SEQ NO.2, is named ZmEREB101.

[0018] Example 2 pG3GB411-mCherry as well as pG3GB411-ZmEREB101 Carrier construction use BamH The target fragment mCherry (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) and the pG3GB411 plant expression vector (purchase link: https: / / www.addgene.org / 134748 / ) were digested with enzyme I. The fragments were then recovered using a PCR product purification kit (purchased from Tiangen Biotech Co., Ltd.) following the manufacturer's instructions. The two fragments were ligated using a homologous recombinase (purchased from Yisheng Biotechnology Co., Ltd.), and the ligation system is shown in Table 2.

[0019] Table 2 mCherry and pG3GB411 Enzyme fragment ligation system

[0020] The ligation reaction was carried out at 50 °C for 20 min to construct the recombinant plasmid. pG3GB411-mCherry ( Figure 2 ) use BamH I. Purpose of preparation in Example 2 (enzyme digestion) ZmEREB101 Fragments and pG3GB411 The plant expression vector was purified using a PCR product purification kit (purchased from Tiangen Biotech Co., Ltd.) according to the manufacturer's instructions. The two fragments were then ligated using a homologous recombinase (purchased from Yisheng Biotechnology Co., Ltd.), and the ligation system is shown in Table 3.

[0021] Table 3 ZmEREB101 and pG3GB411 Connection system

[0022] The ligation reaction was carried out at 50 ℃ for 20 min to construct the recombinant plasmid pG3GB411-ZmEREB101. Figure 2 and Figure 3 ).

[0023] Will pG3GB411-ZmEREB101 Compared with control vector pG3GB411-mCherry Agrobacterium pVS1-LBA4404 competent cells were transformed to obtain Agrobacterium strains suitable for transformation.

[0024] Example 3 Agrobacterium-mediated transformation of maize immature embryos

[0025] I. Agrobacterium-mediated genetic transformation of maize immature embryos 1. Three days before the start of the infection experiment, place the sample containing... pG3GB411-ZmEREB101 or pG3GB411-mCherry Agrobacterium strain pVS1-LBA4404 was streaked onto YEP solid medium supplemented with 50 mg / L kanamycin and 25 mg / L rifampin, respectively. The medium was then incubated in the dark at 28 °C for 1 to 2 days. Single colonies were then picked for subsequent preparation of Agrobacterium seed culture for infection.

[0026] 2. Using maize inbred lines B104, Zheng 58, Xiang 249, and B73 as recipients, fresh immature embryos measuring 1.2–1.8 mm were extracted. The extracted immature embryos were placed in 2 mL centrifuge tubes containing 1.8 mL of suspension, with approximately 60 embryos per tube, and the entire extraction process was completed within 1 hour.

[0027] 3. Use resuspended ingredients pG3GB411-ZmEREB101 or pG3GB411-mCherry Agrobacterium tumefaciens was used to infect the immature embryos. Then, the immature embryos were placed with the scutellum side up and evenly spread on the surface of the co-culture medium (components: 1 / 2 MS basal medium, 20 g / L sucrose, 10 g / L glucose, 100 μM acetylsyl syringone, 8 g / L agarose) and co-cultured at 23 ℃ in the dark for 2 days.

[0028] 4. After co-culture, the embryos were transferred to recovery medium (components: MS basal medium, MS vitamins, 0.5 mg / L 2,4-D, 2.2 mg / L Picloram, 0.1 g / L casein, 30 g / L sucrose, 40 μM AgNO3, 200 mg / L termethin, 3 g / L plant gel) and cultured at 28°C in the dark for 7-10 days.

[0029] 5. The callus tissue that has undergone recovery culture was transferred to differentiation medium I (components: MS basal medium, 60 g / L sucrose, 1 g / L inositol, 1 mg / L 6-BA, 5 mg / L zeatin, 200 mg / L termethin, 3 g / L plant gel, 1.5 mg / L Iliaphos) for differentiation and preliminary screening. The culture conditions were 25 ℃, 16 hours of light per day, and continued for 10-14 days.

[0030] 6. Transfer the differentiated green regenerated shoots to differentiation medium II (i.e., differentiation medium I with Bialaphos added to 2.0 mg / L) for screening at higher concentrations. Culture conditions are the same as above (25 ℃, 16 hours of light / day) for 10-14 days.

[0031] 7. Once the regenerated seedlings have grown 3 true leaves, they can be transplanted into a rooting medium for continued indoor cultivation. After the seedlings have grown new leaves and roots, they should be removed from the medium and transplanted into small pots containing a 1:3 volume ratio of nutrient soil and vermiculite. When the seedlings have grown another 2-3 new leaves, they can be transplanted to the field.

[0032] II. Statistical analysis of transformation efficiency of maize inbred lines of different genotypes The transformation results showed that mCherry protein exhibited red fluorescence in callus tissue. Figure 4 This indicates that ZmEREB101 and mCherry protein are stably expressed in callus tissue, and compared with the control vector. pG3GB411-mCherry In comparison, containing ZmEREB101 Gene carrier pG3GB411-ZmEREB101 It can significantly improve the callus induction rate and transformation efficiency of maize inbred lines of different genotypes. Figure 4 The relevant indicators were calculated using the following formulas: Callus induction rate = (number of calluses / number of inoculated embryos) × 100%; Transformation efficiency = (number of positive seedlings / number of inoculated embryos) × 100%. Specific experimental results are shown in Table 4 and... Figure 5 As shown.

[0033] For the inbred line B104, which has a relatively high transformation efficiency, the introduction of this vector also showed a significant improvement: the callus induction rate increased from 49.96% to 69.93%, and the transformation efficiency significantly increased from 22.44% to 48.65% (Table 4 and 2000). Figure 5 ).

[0034] Significant improvements were also observed in the inbred lines Zheng 58 and Xiang 249. The callus induction rate of Zheng 58 increased from 22.92% to 48.50%, and the transformation efficiency increased from 4.21% to 17.77% (Table 4 and...). Figure 5The callus induction rate of Xiang 249 increased from 44.65% to 75.12%, and the transformation efficiency significantly increased from 10.28% to 30.05% (Table 4 and ). Figure 5 ).

[0035] Furthermore, in the inbred line B73, which is difficult to genetically transform, the callus induction rate of the control group was 20.64%, and the transformation efficiency was 4.38% (Table 4 and ). Figure 5 ); and transfer pG3GB411-ZmEREB101 After vectorization, the callus induction rate increased to 37.91%, and the transformation efficiency significantly improved to 18.83%, representing an increase of several times (Table 4 and...). Figure 5 ).

[0036] Table 4. Statistical analysis of transformation efficiency of different maize inbred lines

[0037] In conclusion, ZmEREB101 Genes can effectively overcome the genotypic limitations of different maize inbred lines in genetic transformation, significantly improve callus induction rate and transformation efficiency, thereby reducing dependence on specific recipient genotypes and showing good application prospects.

[0038] References Jofuku KD, Den Boer BG, Van Montagu M, et al. Control of Arabidopsis flower and seed development by the homeotic gene APETALA2[J]. ThePlant Cell, 1994, 6(9): 1211-1225.

Claims

1. ZmEREB101 Application of genes in improving the efficiency of maize genetic transformation; the aforementioned ZmEREB101 The gene is a nucleic acid molecule as shown in (1) or (2) below, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO. 2; (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The ZmEREB101 The gene improved the induction rate and regeneration efficiency of resistant callus in recipient plants, thereby increasing the efficiency of maize genetic transformation.

3. ZmEREB101 The application of gene-encoded proteins in improving the efficiency of maize genetic transformation; characterized by, The ZmEREB101 The protein encoded by the gene is the protein shown in (1) or (2) below: (1) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2 of the sequence listing; (2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (1).

4. A method for improving the efficiency of introducing exogenous nucleic acid molecules into maize for transformation, characterized in that, Will ZmEREB101 The transfer of genes and exogenous nucleic acid molecules into maize aims to improve the transformation efficiency of the target plant by introducing nucleic acid molecules; ZmEREB101 Genes are nucleic acid molecules as shown in (1) or (2) below: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO. 2.