Research model and construction method for calcium ion imaging of nematode ASH neurons
By constructing a YC3.60 fluorescent resonance energy transfer probe in nematode ASH neurons and combining it with the sra-6 promoter, the problem of low detection sensitivity in existing technologies was solved, enabling high-sensitivity real-time monitoring of calcium ion levels in nematode ASH neurons, simplifying the operation and reducing costs.
Patent Information
- Application Number
- CN202610415418.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies using microelectrodes and calcium ion fluorescent dyes have low detection sensitivity and are harmful. G-CaMP fluorescent protein probes have limited sensitivity, and early YC2.12 probe technology was outdated, making it difficult to achieve high-sensitivity real-time monitoring of calcium ion levels in nematode ASH neurons.
Using the YC3.60 fluorescent resonance energy transfer probe combined with the ASH neuron-specific promoter sra-6, a transgenic plasmid was constructed by PCR and introduced into the gonads of nematodes by microinjection. Nematode lines that stably expressed fluorescent protein were screened, and gene integration was achieved by UV cross-linking mutagenesis to realize the specific expression of fluorescent protein in ASH neurons.
This method enables highly sensitive real-time monitoring of calcium ion levels in nematode ASH neurons, reducing experimental damage to nematodes, improving detection accuracy and sensitivity, simplifying the operation process, and reducing costs.
Smart Images

Figure CN122303323A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological model construction technology, and in particular to a research model and construction method for calcium ion imaging of ASH neurons in nematodes. Background Technology
[0002] The ASH neurons of *C. elegans* (Amphid Single Cilium H) are fully functional, making them an ideal model for studying neuronal structure and function. The model organism *C. elegans* has a short growth cycle, rapid reproduction rate, small size, simple structure, and good body transparency, facilitating optical imaging analysis. In evolutionary history, nematodes were among the first to possess a neural center, and their simple neuronal structure makes them one of the ideal animal models for neurobiological research. The cell bodies of nematode ASH neurons are located in the neural center (the neural ring around the pharynx). Two ASH neurons are bilaterally symmetrical, with axons extending forward to the nematode's lips. The terminals are rich in sensory receptors, enabling them to sense changes in the chemical substances and concentrations of the surrounding environment. ASH neurons are multimodal nociceptive neurons, mediating the perception of various aversive chemicals and other stimuli associated with avoidance behavior, such as heavy metals, hyperosmolarity, quinine, mechanical stimulation, and extreme temperatures, similar to the multimodal nociceptors in vertebrates.
[0003] Changes in intracellular calcium ion levels have a significant impact on cellular life activities. Dynamic monitoring of intracellular calcium ion levels can reflect the physiological state of cells in real time. Microelectrodes and calcium ion fluorescent dyes are commonly used methods for monitoring intracellular calcium ion levels. However, microelectrode technology has low detection sensitivity and is relatively invasive to experimental animals. Calcium ion fluorescent dyes also have many drawbacks; the dyes stain not only neurons but also all cells in the body, causing interference during detection. In addition, relatively little dye enters the cell, resulting in low detection sensitivity.
[0004] With the development and advancement of fluorescently labeled proteins, transgenic expression of fluorescent protein calcium ion labeling probes in cells has become a new favorite in life science research. Fluorescent protein labeling offers higher measurement accuracy and is more convenient to operate. Currently, there are various fluorescent proteins that can be used for calcium ion labeling. G-CaMP (Calcium sensitive fluorescent protein) can be used for calcium ion labeling in nematode ASH neurons. However, this protein is more suitable for labeling calcium ions in static cells. Nematodes are highly resilient, and it is difficult to achieve absolute stillness during calcium ion imaging analysis. Therefore, G-CaMP fluorescent protein labeling is not ideal. In recent years, a fluorescent protein probe technology for calcium ions based on fluorescence resonance energy transfer (FRET) has emerged. This probe has a cyan fluorescent protein (CFP) at one end and a yellow fluorescent protein (YFP) at the other. The middle region (M13 domain) can bind calcium ions. Subsequently, the overall conformation of the protein changes, and the two ends approach each other, undergoing fluorescence resonance energy transfer (FRET). Energy is transferred from the CFP to the YFP, causing the CFP energy to decrease and the YFP energy to increase. This is reflected in a decrease in CFP fluorescence intensity and an increase in YFP fluorescence intensity. Therefore, in calcium ion fluorescence imaging analysis, only a decrease in CFP intensity and an increase in YFP intensity indicates an increase in calcium ion concentration. This allows for the detection of dynamic changes in calcium ion concentration even with slight movement in nematodes. After several years of development, this fluorescent probe has evolved from the early YC2.12 to YC3.60, with the YC3.60 probe offering higher detection sensitivity. This invention will use this probe for real-time detection of calcium ion concentration. By using the gene that links this fluorescent probe protein to the ASH neuron-specific promoter sra-6p, transgenic it into nematodes and achieving stable expression, this nematode model can be created. Summary of the Invention
[0005] The purpose of this invention is to address the shortcomings of existing technologies, such as poor sensitivity and harmfulness of microelectrodes and calcium ion fluorescent dyes, as well as the limited sensitivity of G-CaMP fluorescent protein probes and the outdated YC2.12 probe technology, in order to achieve high-sensitivity in vivo monitoring of calcium ion levels in nematode ASH neurons.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for constructing a research model for calcium ion imaging of ASH neurons in nematodes includes the following steps performed sequentially:
[0008] S1: Nematode culture;
[0009] S2: Constructing probe plasmids for transgenic purposes, specifically including:
[0010] The ASH neuron-specific promoter sra-6 was obtained by PCR technology. The PCR amplification primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2. Hind III and BamHI restriction sites were introduced at both ends of the promoter, respectively.
[0011] The calcium ion fluorescent probe YC3.60 was amplified by PCR technology, and the PCR amplification primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4.
[0012] S2-1: Insert the sra-6 promoter sequence into the plasmid vector pPD95.75;
[0013] S2-2: Then insert the YC3.60 behind the promoter to obtain the recombinant plasmid;
[0014] S3: Transgenic and genome integration, specifically including:
[0015] The recombinant plasmid was introduced into the gonads of nematodes via microinjection;
[0016] Nematodes expressing fluorescent proteins were screened, and after ultraviolet cross-linking mutagenesis, nematode lines with stable ASH neuronal expression of fluorescent proteins and exogenous genes integrated into the genome were obtained.
[0017] Preferably, the method for inserting the sra-6 promoter into the plasmid in S2-1 is as follows: the plasmid vector pPD95.75 and the promoter sequence are digested with Hind III and BamHI, and then ligated with T4 DNA ligase.
[0018] Preferably, the method for inserting YC3.60 after the promoter in S2-2 is as follows: the plasmid vector pPD95.75 and the YC3.60 fragment PCR product are digested with Kpn I and EcoRI, and then the obtained YC3.60 fragment is ligated to the plasmid vector to obtain the recombinant plasmid.
[0019] Preferably, the specific steps of the ultraviolet cross-linking mutagenesis treatment in S3 are as follows:
[0020] Nematodes expressing fluorescent protein, selected after microinjection, were cultured to the next generation. Non-oviposition nematodes were then selected and subjected to ultraviolet crosslinking. Irradiate with power for 30 seconds;
[0021] After irradiation, the eggs are cultured, the mother insects are removed, and the eggs are retained for further culture.
[0022] Observe the fluorescence expression of the offspring, screen individuals with stable fluorescence expression and good phenotype, and passage them continuously until a nematode line with stable integration of exogenous genes is obtained.
[0023] Preferably, the YC3.60 is a fluorescent probe for calcium ions based on fluorescence resonance energy transfer (FRET), with one end being cyan fluorescent protein (CFP) and the other end being yellow fluorescent protein (YFP).
[0024] Preferably, the sra-6 promoter is an ASH neuron-specific promoter, which specifically initiates gene expression in ASH neurons during both nematode larvae and adults.
[0025] This invention also provides a research model for calcium ion imaging of ASH neurons in nematodes, which is constructed using the aforementioned construction method.
[0026] Compared with the prior art, this application has the following beneficial effects:
[0027] 1. The ASH neurons of nematodes possess a variety of functional behaviors. These neurons are richly endospermized, enabling them to sense chemical stimuli, concentration differences, osmotic pressure, mechanical stimuli, odors, light, and temperature. Utilizing the flexible manipulation technology of microfluidic chips and high-resolution imaging analysis, nematode ASH neurons are excellent models for studying neuronal structure and function. ASH neurons also connect with other central neurons, forming neural circuits that regulate physiological behavior, making them a good model for studying the coordination between neurons.
[0028] 2. The pPD95.75 plasmid was used as the vector. This plasmid is a commonly used transgenic vector for nematodes.
[0029] 3. Using the sra-6 promoter, the probe gene was specifically expressed in nematode ASH neurons, with no significant expression in other tissues. The promoter determines the tissue specificity of gene expression. The sra-6 promoter is specifically distributed in ASH neurons, and its expression level is high in both nematode larvae and adults.
[0030] 4. Use YC3.60 as the fluorescent protein probe for detecting calcium ions. This probe can more accurately measure calcium ion signals, eliminate adverse interferences during the imaging process, and provide more realistic results. Only when the CFP fluorescence intensity of the probe decreases while the YFP fluorescence intensity increases does it indicate an increase in calcium ion concentration.
[0031] 5. A relatively simple and low-cost microinjection method was used to transgenerate nematodes. Subsequently, ultraviolet mutagenesis was used to integrate the exogenous gene into the nematode genome, thereby achieving stable transfection of the fluorescent protein probe. Attached Figure Description
[0032] Figure 1 The synthesis steps for the sra-6 promoter sequence and YC3.60;
[0033] Figure 2 The process of creating a calcium ion fluorescent protein probe plasmid for ASH neurons in nematodes is described, where A is the insertion of the promoter sra-6 (solid short arrow fragment) into the plasmid, and B is the insertion of the YC3.60 fragment (solid long arrow fragment) into the promoter;
[0034] Figure 3 The sra-6::YC3.60 nematode strain prepared in this application can achieve stable expression of the calcium ion fluorescent probe protein in nematode ASH neurons. The scale bar is 60 micrometers.
[0035] Figure 4 This nematode strain was used for calcium ion fluorescence imaging analysis of ASH neurons. In the left image, as the calcium ion concentration increased, it bound to the fluorescent probe and underwent the FRET reaction, resulting in a decrease in CFP intensity and an increase in YFP intensity. The right image shows the changes in calcium ion levels seen in the left image. Detailed Implementation
[0036] The present invention will be further described in detail below with reference to specific embodiments.
[0037] The experimental materials involved in this application and their sources:
[0038]
[0039] This application provides a research model for calcium ion imaging of ASH neurons in nematodes, and the model construction method is as follows:
[0040] S1: Nematode culture:
[0041] 1. Preparation of growth medium
[0042] 1.1 Preparation of food sources for bacteria
[0043] In the laboratory, *C. elegans* is typically fed with *E. coli* strain OP 50. *E. coli* OP 50 is a uracil auxotroph; its growth on NGM plates is restricted, ceasing reproduction after reaching a certain point. When the nematodes consume the bacteria, they resume growth to replenish the population, preventing overgrowth and eliminating vicious competition within the population. Therefore, it does not release toxins that could negatively impact nematode growth and development. The OP 50 bacteria are also provided by the CGC (Cephalomyelitis Genome Center) in the United States. Single-clone strains are isolated using the streak plating method and cultured overnight (approximately 8 hours) on LB broth. This bacterial suspension is then ready for plating.
[0044] 1.2 Preparation of NGM culture dishes
[0045] In the laboratory, *C. elegans* was cultured on OP50-coated non-GM agar using 35 mm diameter culture dishes. The label for the nematode culture dishes should not be on the lid, but rather on the bottom plate. NGM plate preparation: In a 2 L Erlenmeyer flask, add 3 g sodium chloride, 17 g agar, and 2.5 g peptone, along with 1 mL of 1 M calcium chloride, 1 mL of 1 M magnesium sulfate, and 25 mL of 1 M KPO4 buffer. Add 972 mL of water. After mixing, heat to boiling, cool, and add 1 mL of 5 mg / mL cholesterol ethanol solution. Mix well and, in a clean bench, transfer the mixture into 35 mm nematode culture dishes, filling the dish to approximately 3-4 mm (about 2 / 3 of the dish's height). After cooling, spread the OP50 bacterial suspension. Unspread culture dishes can be stored at 4°C for 1-2 weeks until use.
[0046] 1.3 OP 50 coated NGM board
[0047] Using a pipette under a laminar flow hood, apply approximately 0.05 mL of *E. coli* OP 50 liquid culture onto an NGM plate. Be careful not to spread the culture to the edge of the plate, as nematodes tend to spend most of their time in the bacteria. If the culture extends to the edge, the nematodes may crawl to the sides of the plate, dry out, and die. The culture should be spread in the center of the medium. Allow the *E. coli* OP 50 plate to grow at room temperature or 37°C for 8 hours (cool the plate to room temperature before adding the nematodes). It can be used for 2-3 weeks when stored at 4°C.
[0048] 2. Culture Caenorhabditis elegans in petri dishes
[0049] 2.1 Transfer of nematodes growing on NGM plates
[0050] *Caenorhabditis elegans* is a tiny nematode, with adults approximately 1 mm in length, requiring a stereomicroscope for observation. A 10x eyepiece and objective lens are used. The nematodes are picked up using a platinum wire attached to one end of a chopstick-like metal rod. The platinum wire heats and cools rapidly, is oxidation-resistant, and can be frequently calcined in a flame to avoid contaminating the nematode stock. Once the nematode is located under the stereomicroscope, the tip of the wire is slowly lowered, the side of the nematode is gently wiped, and then it is lifted. The picked nematode is then placed on a fresh petri dish, the tip of the platinum wire is slowly lowered, the surface of the agar is gently touched, and the nematode is held in place to allow it to crawl off the wire.
[0051] 2.2 Nematode propagation
[0052] Incubate at 20°C, subculturing approximately every three days, placing two to three worms on each new petri dish. The incubation temperature can be maintained between 16°C and 25°C, with 20°C being the most common. *C. elegans* grows 2.1 times faster at 25°C than at 16°C, and 1.3 times faster at 20°C than at 16°C. Stock plates of *C. elegans* can be maintained for several months at 11°C or 16°C.
[0053] S2: Constructing probe plasmids for transgenic applications:
[0054] Please see Figure 1 First, the exogenous genes, namely the sra-6 promoter and YC3.60, are obtained. After obtaining the exogenous genes, they are inserted into the plasmid. The specific steps are as follows:
[0055] In this application, the sra-6 promoter was obtained by PCR cloning from the nematode genome, and the primers used are as follows: Figure 1 As shown in the figure above, during PCR amplification, Hind III (AAGCTT) and BamHI (GGATCC) restriction sites were ligated to both ends of the sra-6 promoter (the bolded parts in the figure).
[0056] The primers for PCR amplification of the sra-6 promoter are as follows:
[0057] F: 5'CCCAAGCTTCTGTCATGGTCAGTATTTGAGAAG 3' (SEQ ID NO: 1)
[0058] R:5'CGCGGATCCGGCAAAATCTGAAATAATAAATATTAAATTCTGCG 3' (SEQ ID NO: 2)
[0059] Then, the fluorescent protein probe gene (YC3.60) was amplified using PCR technology, such as... Figure 1 As shown in the figure below, KpnI (GGTACC) and EcoRI (GAATTC) restriction sites were added to both ends (the bolded parts in the figure). To improve the restriction efficiency, a three-base fragment was added to the end of the restriction site as a protective base. The YC3.60 gene cDNA sequence was obtained from plasmid pGC1::YC3.60, and the sequence length is 1962 bp.
[0060] The valid cDNA sequences for YC3.60 in this application were purchased from Addgene.
[0061] The following primers were used for PCR amplification to obtain the following:
[0062] The PCR amplification primers for YC3.60 are as follows:
[0063] F: 5' CGGGGTACCCGCTCGAGCATGCATCTAGA 3' (SEQ ID NO: 3)
[0064] R: 5' CCGGAATTCGGCAAACAACAGATGGCTGG 3' (SEQ ID NO: 4)
[0065] The YC3.60 sequence was amplified using a high-fidelity PCR enzyme.
[0066] The YC3.60 is a calcium ion fluorescent probe based on fluorescence resonance energy transfer (FRET). It has a cyan fluorescent protein (CFP) at one end and a yellow fluorescent protein (YFP) at the other end. When calcium ions bind to the middle part, the overall conformation of the protein changes, and the structures at both ends approach each other and undergo fluorescence resonance energy transfer (FRET). The energy is transferred from CFP to YFP, causing the energy of CFP to decrease and the energy of YFP to increase. This is reflected in the decrease of CFP fluorescence intensity and the increase of YFP. Therefore, when performing calcium ion fluorescence imaging analysis, only when the intensity of CFP decreases and YFP increases does it indicate an increase in calcium ion concentration. This allows for more accurate detection of dynamic changes in calcium ions.
[0067] Please see Figure 2 When inserting a foreign gene into a plasmid, the sra-6 promoter sequence (the solid short arrow fragment) is first inserted into the plasmid vector pPD95.75. Figure 2 (A), and then insert the fluorescent protein probe gene sequence YC3.60 (solid long arrow fragment) after the promoter ( Figure 2 (B)
[0068] Specifically, in one embodiment, the method for inserting the sra-6 promoter sequence into the plasmid is as follows:
[0069] The pPD95.75 plasmid and the sra-6 sequence were digested with restriction endonucleases Hind III and BamHI to obtain a linear fragment. Then, the sra-6 fragment was ligated to the plasmid fragment using T4 DNA ligase to obtain the pPD95.75 plasmid with the sra-6 promoter.
[0070] The fluorescent protein probe (YC3.60) is inserted into the plasmid in the following manner:
[0071] The pPD5.75 plasmid containing the promoter and the YC3.60 sequence obtained by PCR were then digested with restriction endonucleases KpnI and EcoRI. The digested sequence was then ligated with the plasmid fragment to obtain a plasmid containing the promoter sra-6 and the YC3.60 sequence, which can be used for transgenic injection into nematodes.
[0072] The specific PCR, enzyme digestion, and enzyme ligation conditions are as follows:
[0073] 1. PCR
[0074] The target fragment was amplified by PCR using Thermo Fisher Scientific Platinum™ Taq high-fidelity DNA polymerase. Reaction volume (25 µL):
[0075]
[0076] The reaction steps are as follows:
[0077]
[0078] 2. Enzyme digestion reaction: Use a 20 µL double digestion system.
[0079]
[0080] 3. T4 ligase ligation reaction:
[0081] 10 µL system:
[0082]
[0083] S3: Transgenic and Genome Integration
[0084] In one embodiment, transgenic microinjection, followed by second- and third-generation screening, is used to select insects that transmit ASH neurons carrying green fluorescent protein.
[0085] The genetic modification process is as follows:
[0086] Nematode transgenic injection and operation process
[0087] One day before injection, 40 L4-stage nematodes were transferred to freshly inoculated NGM agar plates with OP50. They were incubated overnight at 20°C to develop into young adults with fully developed reproductive lines.
[0088] One hour before injection, the nematodes were moved to 15°C to reduce their agility, making them easier to inject. 0.5 µl of DNA solution was added to a tipped capillary tube for microinjection, and the capillary tube was screwed into the needle holder of the micromanipulator. The capillary force collected the solution at the needle tip.
[0089] Place approximately 50 µL of mineral oil onto a dried 2% agarose pad. Under a stereomicroscope, transfer 3–5 nematodes into the oil and gently press the animals onto the agarose surface using the tip of an eyelash. Place the agarose pad on the microscope stage for microinjection and begin the injection procedure quickly, as the animals will dry and die within approximately 10–20 minutes.
[0090] Injection procedure
[0091] The TransferMan NK 2 microscopy operating system uses an injection robotic arm mounted on an inverted microscope. The arm is electrically operated and controlled by a joystick. An injection needle holder is mounted on the arm, tilted downwards at a 45-degree angle. The glass needle for injection is mounted on the needle holder, and a high-pressure air pump is connected to the other end of the holder to provide power for the injection. The needle can be moved omnidirectionally by the joystick. The joystick controls have a "coarse" mode and a "fine" mode, allowing for rapid and precise movements similar to the coarse and fine adjustments of the microscope.
[0092] Locate the nematode in the mineral oil droplet on the agarose pad under a 10x objective lens. Adjust the position of the slide containing the agarose pad so that the injection needle and the nematode's gonads are at a 45-degree angle.
[0093] In "Coarse" mode, move the needle with the joystick to the vicinity of the nematode's gonad. Switch to 40x objective lens and, in "Fine" mode, gently touch the needle tip to the dry agar plate. The glass needle tip will break, allowing the internal fluid to flow out. Then, align the needle tip and the cytoplasmic core of the nematode's distal gonad with each other on the focal plane. Gently move the needle tip horizontally towards the cytoplasmic core of the nematode's distal gonad until the needle tip penetrates it. Press the "Inject" button to release the DNA solution into the gonad. Inject only a small amount; do not inject too much. After injection, withdraw the needle tip and return it to its initial position. Add 2 drops of M9 buffer to the oil droplet containing the injected nematode. After a few minutes, the nematode's activity will recover. Transfer it to a culture dish coated with OP50 and culture for 3-5 days. Observe whether the offspring have a transgenic phenotype. A single transgenic treatment typically requires the injection of 15 to 20 nematodes.
[0094] After transgenic microinjection, 6-8 nematodes with good ASH neuronal fluorescence expression were selected and cultured in 5 cm NGM dishes. After 4 days of culture at 21°C, 20 un-oviposited next-generation nematodes were picked and transferred to 5 cm NGM dishes. A total of 200 nematodes were picked and transferred to 10 separate culture dishes. A UV crosslinker with a power of 300 J / cm² was used for crosslinking. 2The nematodes were irradiated with a high power for 30 seconds. After 5 hours, the nematodes were transferred to new culture dishes and cultured for 24 hours. The mother nematodes were then removed, and the eggs were left to continue culturing. After 3 days, the fluorescence expression of the nematodes was observed. Nematodes with fluorescence expression and good phenotype were selected and cultured separately. If all ASH neurons in the next generation showed fluorescence expression, nematodes with good phenotype were selected for further culture. These nematodes are the nematode strains with successful genome integration of sra-6::YC3.60 nematodes.
[0095] This strain of nematode can stably express a calcium ion fluorescently labeled protein probe.
[0096] The probe used in this application contains two different fluorescent proteins, CFP and YFP. Imaging analysis requires simultaneous monitoring of both fluorescent signals, which necessitates the use of a spectroscope. The fluorescence emitted from the sample location is split into two paths: CFP and YFP. A CCD (Charge-coupled Device) camera is used to record the intensity changes of these two paths, and ImagePro Plus (IPP) is used for imaging analysis and data analysis to further calculate the changes in calcium ion levels.
[0097] Please see Figure 3 The ASH neurons of nematodes have cell bodies located in the neural ring. The cell bodies are relatively large and suitable for imaging analysis. The axons extend forward to the lip to sense changes in environmental signals.
[0098] Furthermore, the nematode strain described in this application exhibits stable expression of the fluorescent probe protein for calcium ions in ASH neurons, with both larvae and mature nematodes showing expression of the fluorescent probe protein. Using this strain as an experimental model for calcium ion signal studies significantly reduces the workload of nematode passage, eliminating the need for picking nematodes under a fluorescence microscope and performing routine passage operations. Moreover, the expression level and distribution of the nematode probe are relatively stable.
[0099] And, as Figure 4 As shown, the ASH neurons of the nematode strain provided in this application can be used for microscopic imaging analysis of calcium ion level changes, overcoming the interference of nematode muscle movement on calcium ion imaging analysis and accurately recording changes in calcium ion levels. Thus, the nematodes do not need to be anesthetized or even fixed, remaining in their natural physiological state.
[0100] 2. In summary, the nematode strains provided in this application can be used for research on neuronal structure and function, the mechanism of coordination between neurons, and the efficacy analysis of neurological drugs.
[0101] In this application, YC3.60 is transferred into nematodes via transgenic methods. A promoter specifically expressed in ASH neurons is used to link the gene for this fluorescent probe protein into the nematode. After transfection, this fluorescent probe is specifically expressed in ASH neurons, with little or no expression in other tissues. In this application, ultraviolet radiation is applied to these nematodes, and through selection and passage, nematode lines that stably inherit the fluorescent protein gene are ultimately screened out, which can serve as a model for studying the structure and function of nematode ASH neurons.
Claims
1. A method for constructing a research model for calcium ion imaging of nematode ASH neurons, characterized by: It includes the following steps performed in sequence: S1: Nematode culture; S2: Constructing probe plasmids for transgenic purposes, specifically including: The ASH neuron-specific promoter sra-6 was obtained by PCR technology. The PCR amplification primers are shown in SEQ ID NO: 1 and SEQ ID NO:
2. Hind III and BamHI restriction sites were introduced at both ends of the promoter, respectively. The calcium ion fluorescent probe YC3.60 was amplified by PCR technology, and the PCR amplification primers are shown in SEQ ID NO: 3 and SEQ ID NO:
4. S2-1: Insert the sra-6 promoter sequence into the plasmid vector pPD95.75; S2-2: Then insert the YC3.60 behind the promoter to obtain the recombinant plasmid; S3: Transgenic and genome integration, specifically including: The recombinant plasmid was introduced into the gonads of nematodes via microinjection; Nematodes expressing fluorescent proteins were screened, and after ultraviolet cross-linking mutagenesis, nematode lines with stable ASH neuronal expression of fluorescent proteins and exogenous genes integrated into the genome were obtained.
2. The construction method of claim 1, wherein, The method for inserting the sra-6 promoter into the plasmid in S2-1 is as follows: the plasmid vector pPD95.75 and the promoter sequence are digested with Hind III and BamHI, and then ligated with T4 DNA ligase.
3. The construction method of claim 1, wherein, The method for inserting YC3.60 after the promoter in S2-2 is as follows: the plasmid vector pPD95.75 and the YC3.60 fragment PCR product are digested with Kpn I and EcoRI, and then the obtained YC3.60 fragment is ligated to the plasmid vector to obtain the recombinant plasmid.
4. The construction method according to claim 1, characterized in that, The specific steps of the ultraviolet cross-linking mutagenesis treatment in S3 are as follows: Nematodes expressing fluorescent protein, selected after microinjection, were cultured to the next generation. Non-oviposition nematodes were then selected and subjected to ultraviolet crosslinking. Irradiate with power for 30 seconds; After irradiation, the eggs are cultured, the mother insects are removed, and the eggs are retained for further culture. Observe the fluorescence expression of the offspring, screen individuals with stable fluorescence expression and good phenotype, and passage them continuously until a nematode line with stable integration of exogenous genes is obtained.
5. The construction method according to claim 1, characterized in that, The YC3.60 is a fluorescent probe for calcium ions based on fluorescence resonance energy transfer (FRET), with cyan fluorescent protein (CFP) at one end and yellow fluorescent protein (YFP) at the other end.
6. The construction method according to claim 1, characterized in that, The sra-6 promoter is an ASH neuron-specific promoter, which specifically initiates gene expression in ASH neurons during both nematode larvae and adults.
7. A research model for calcium ion imaging of ASH neurons in nematodes, characterized in that, It is constructed by the construction method of any one of claims 1 to 6.