Preparation method of DNA samples for SNP chip detection
By designing specific library sequences and enzyme digestion steps, target fragments are enriched in a targeted manner, solving the problem of non-target fragments affecting hybridization efficiency in breeding chip detection, and improving the signal value and accuracy of SNP chip detection.
Patent Information
- Application Number
- CN202610754332.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-28
- Publication Date
- 2026-06-30
AI Technical Summary
In existing breeding chip detection technologies, the presence of non-target fragments during the whole-genome amplification process of DNA samples leads to low hybridization efficiency, affecting the hybridization efficiency and detection accuracy of target fragments.
Design specific library sequences, including P7 sequence, capture sequence, restriction endonuclease cleavage site sequence and P5 sequence, and target fragments are enriched and non-target fragments are removed by PCR amplification, lambda exonuclease digestion and exonuclease I digestion, thereby improving hybridization efficiency.
It significantly improved the hybridization signal value and accuracy of SNP chip detection, and enhanced the signal strength and accuracy of detection.
Smart Images

Figure CN122303381A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and more specifically, this invention relates to a method for preparing DNA samples for SNP chip detection. Background Technology
[0002] Breeding chips are a type of gene chip, also known as single nucleotide polymorphism (SNP) microarrays. They consist of millions of DNA marker sequences arranged in a regular pattern on a glass slide or special silicon chip, immobilized to form an array of DNA or SNP probes. Their working principle involves the base pairing reaction between the DNA marker sequences immobilized on the chip and the target genome, thereby accurately identifying genetic information.
[0003] The most widely used technology in breeding is the SNP chip, which uses SNP probes on a chip to detect a large number of SNP variation sites in an organism, thereby inferring the genotype and key genetic variations in the genome. SNP chips specifically designed for genome breeding are called "genome breeding chips".
[0004] Currently, two US and one Chinese biotechnology companies, Illumina and Affymetrix, and Lasobio and Sailu (Shenzhen Sailu Medical Technology Co., Ltd., the applicant of this application) provide genome breeding chip fabrication technology. Illumina's Infinium chip is a high-density chip based on fiber optic microbeads. Specific gene probe sequences are coupled to microbeads with a diameter of 3 μm, and then self-assembled in the micropores of the matrix to form a microbead chip. Affymetrix's Axiom chip uses in-situ photolithography technology to synthesize gene probe sequences in situ on a substrate through photolithography. Lasobio's breeding chip principle is basically the same as Illumina's, while Sailu's breeding chip (CN118006735B) forms gene probe sequences by in-situ amplification of a probe library on a glass slide followed by enzyme digestion.
[0005] In existing breeding chip detection technologies, DNA samples that need to be detected need to undergo whole-genome amplification to increase the amount of DNA. Then, hybridization and detection are performed on the chip. During this amplification process, in addition to the target fragment being amplified, there are also a large number of non-target fragments. These non-target fragments cannot hybridize with the probes on the chip, which will have a serious adverse effect on the hybridization efficiency of the target fragment. Summary of the Invention
[0006] Based on this, the purpose of this invention is to provide a method for preparing DNA samples for SNP chip detection. This method can target and enrich target fragments, and when applied to breeding chip hybridization detection, it can improve the hybridization efficiency of target fragments.
[0007] The specific technical solutions for achieving the above-mentioned objectives are as follows.
[0008] A first aspect of the present invention provides a method for preparing a DNA sample for SNP chip detection, comprising the following steps: S1. Obtain at least one library sequence, wherein the library sequence comprises, from the 5' end to the 3' end, the following sequence in sequence: P7 sequence, capture sequence, restriction endonuclease cleavage site sequence, adapter sequence, and P5 sequence, wherein the restriction endonuclease cleavage site sequence generates at least 5 arbitrary nucleotides at the 3' end of the capture sequence after enzyme digestion; the capture sequence is complementary to the target fragment of the DNA sample to be tested. S2. Amplify the library sequence described in step S1, and then perform enzyme digestion to obtain the single-stranded library sequence; S3. Mix the amplification product of the DNA sample to be tested with the single-stranded library sequence described in step S2, and denature and anneal it; S4. The product from step S3 is digested with Exonuclease I.
[0009] In a second aspect, the present invention provides a DNA sample prepared by the above method.
[0010] A third aspect of the present invention provides the application of the above-described DNA sample in SNP chip detection.
[0011] This invention first designs a library sequence for a corresponding SNP chip based on the DNA sample to be tested. This library sequence includes a capture sequence complementary to the target fragment of the DNA sample. After amplification of the library sequence, it is digested with lambda exonuclease to obtain a single-stranded library sequence. Then, the single-stranded library sequence is mixed with the amplification product of the DNA sample to be tested, denatured, and hybridized. Finally, it is digested with exonuclease I. The DNA sample to be tested prepared in this way is more pure, with the target fragment targeted and enriched, and a large number of non-target fragments removed. When applied to SNP chip detection, it improves the hybridization efficiency with the SNP chip, thereby improving the detection signal value and accuracy. Attached Figure Description
[0012] Figure 1 This is a schematic diagram illustrating the method for preparing DNA samples for SNP chip detection according to the present invention.
[0013] Figure 2This is an agarose gel electrophoresis pattern after lamda digestion.
[0014] Figure 3 This is a scatter plot of hybridization signals from the control group DNA samples used for SNP chip detection.
[0015] Figure 4 The image shows a scatter plot of hybridization signals when DNA samples prepared by the method of this invention are used for SNP chip detection. Detailed Implementation
[0016] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0017] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0018] Unless otherwise specified, all examples were conducted under standard experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2013), or according to the manufacturer's instructions. All raw materials used were commercially available and readily available.
[0019] Please refer to Figure 1This is a schematic diagram illustrating the principle of the method for preparing DNA samples for SNP chip detection according to the present invention. 1. First, design and obtain at least one library sequence for the corresponding SNP chip of the sample to be tested (such as corn, rice, soybean, etc.). A complete library sequence includes a P7 sequence, a capture sequence (complementary to the target fragment of the DNA sample to be tested, used for subsequent targeted enrichment of the target fragment), a restriction endonuclease cleavage site sequence (a sequence that generates at least 5 arbitrary nucleotides at the 3' end of the capture sequence after enzyme digestion), an adapter sequence, and a P5 sequence; 2. Use the P5 primer (phosphorylated at its 5' end) and the P7 primer to perform a PCR reaction on the designed library sequence to amplify the library sequence, obtaining... 3. Digest the double-stranded library sequence with lambda exonuclease to obtain a single-stranded library sequence (this single-stranded library sequence includes the P7 sequence, capture sequence, restriction endonuclease cleavage site sequence, adapter sequence, and P5 sequence); 4. Mix the amplification product of the DNA sample to be tested (prepared using the CELON gene chip kit) with the single-stranded library sequence, denature, and anneal. At this time, the target fragment will bind with the capture sequence in the single-stranded library sequence to form a double strand, while most non-target fragments remain in a single-stranded state; 5. Then digest the annealed product with Exonuclease I exonuclease (specifically digests DNA from the 3' to 5' ends). Non-target fragments are digested due to their single-stranded state, while the target fragment, being double-stranded, protects the detection site information, thereby achieving the effect of enriching the target fragment and removing non-target fragments; finally, after denaturation, the obtained product can be hybridized with the capture fragment on the SNP chip.
[0020] In some embodiments of the present invention, a method for preparing a DNA sample for SNP chip detection is disclosed, comprising the following steps: S1. Obtain at least one library sequence, wherein the library sequence comprises, from the 5' end to the 3' end, the following sequence in sequence: P7 sequence, capture sequence, restriction endonuclease cleavage site sequence, adapter sequence, and P5 sequence, wherein the restriction endonuclease cleavage site sequence generates at least 5 arbitrary nucleotides at the 3' end of the capture sequence after enzyme digestion; the capture sequence is complementary to the target fragment of the DNA sample to be tested. S2. Amplify the library sequence described in step S1, and then perform enzyme digestion to obtain the single-stranded library sequence; S3. Mix the amplification product of the DNA sample to be tested with the single-stranded library sequence described in step S2, and denature and anneal it; S4. The product from step S3 is digested with Exonuclease I.
[0021] In one embodiment, in step S1, the restriction endonuclease is BaeI or BarI.
[0022] In one embodiment, in step S1, the connector sequence is as shown in CCCGTTCGCAACATGTCTGGCGTCATA; the P7 sequence is as shown in CAAGCAGAAGACGGCATACGAGAT; and the P5 sequence is as shown in TCTTTGTGACTACAGCACCCTCGACTCTCGC.
[0023] In one embodiment, in step S2, amplification is performed using P5 primers and P7 primers, wherein the 5' end of the P5 primer is phosphorylated.
[0024] In one embodiment, step S2 involves enzymatic digestion using lambda exonuclease.
[0025] In one embodiment, in step S3, the volume ratio of the amplification product of the DNA to be tested to the single-stranded library sequence is 1~20:1.
[0026] In one embodiment, in step S3, the volume ratio of the amplification product of the DNA to be tested to the single-stranded library sequence is 8~12:1.
[0027] In one embodiment, in step S3, the volume ratio of the amplification product of the DNA to be tested to the single-stranded library sequence is 10:1.
[0028] In one embodiment, in step S3, the denaturation is carried out by reacting at 95°C to 99°C for 8 min to 12 min, followed by annealing at 50°C to 60°C for 14 h to 16 h.
[0029] In other embodiments of the present invention, DNA samples prepared by the above method are disclosed.
[0030] In other embodiments of the present invention, the application of the above-described DNA samples in SNP chip detection is disclosed.
[0031] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0032] Example 1: Preparation method of DNA sample for SNP chip detection This embodiment uses a DNA sample for corn SNP chip detection as an example to illustrate its preparation method in detail, specifically including the following steps: 1. Obtaining the maize genome library sequence Four library sequences (SEQ ID NO:1~SEQ ID NO:4) were designed for the detection of SNP sites in the maize genome. The library sequences, from the 5' end to the 3' end, include the following sequences in sequence: P7 sequence (CAAGCAGAAGACGGCATACGAGAT), capture sequence (for capturing the target fragment of the DNA sample to be tested), restriction endonuclease cleavage site sequence (nnnnnNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNN), adapter sequence (CCCGTTCGCAACATGTCTGGCGTCATA), and P5 sequence (TCTTGTGACTACAGCACCCTCGACTCTCGC). The restriction endonuclease cleavage site sequence can generate a sequence of 5 arbitrary nucleotides (A / T / G / C) at the 3' end of the capture sequence after enzyme digestion; where N refers to any one of ATCG and Y represents any one of CT.
[0033] SEQ ID NO:1 CAAGCAGAAGACGGCATACGAGAT TCACTGCGATGCTGGATGTTTGCACTCTGGATTCATCTCTGTTTTTCTTTAAGTTttcacNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC SEQ ID NO:2 CAAGCAGAAGACGGCATACGAGAT GCAGCCTGCTATCTGTTTACGTATCTCCTCAAGTTTCTAAGTCAGTGTGGCAAGcccaaNNNNNNNNACNNNNGTAYCNNNNNNNNNNNCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC SEQ ID NO:3 CAAGCAGAAGACGGCATACGAGAT ATTTTCCTGAAACAATCAAGGGATAGAAAAGAAAAACATGTGATACAAATCTCCtcattNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC SEQ ID NO:4 CAAGCAGAAGACGGCATACGAGATGAGCTGTGTACCCCGTATGCCATCTCAAAATGGTTGAGGGACGTAATGGTTTATAttcatNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC The four library sequences were synthesized at Genscript Biotech Inc. The synthesized sequence powder was diluted to 4 nM with Low TE buffer according to the concentration indicated on the synthesis tube. Then, 2 μL of each of the four libraries was mixed, and 1 μL was taken for subsequent steps.
[0034] 2. Amplification and restriction enzyme digestion of the library sequence (1) Take 1µL of the library solution from step 1, prepare the PCR reaction system according to Table 1, and perform PCR amplification according to Table 2; Table 1 Table 2 (2) Take out the amplification product from step (1), purify it with magnetic beads using 1.2X, and then re-dissolve it with 20µL ddH2O; (3) Take the reconstituted product from step (2), prepare the reaction system according to Table 3, and then place it in a PCR instrument at 37°C for 1 hour; Table 3 (4) Take 2µL of the reaction product from step (3) and perform agarose gel electrophoresis. The results are as follows: Figure 2 As shown. From Figure 2 It can be seen that compared with the control (i.e. the amplification product purified in step (2)), the band after lambda digestion shifted significantly downward, indicating that the DNA double-stranded product has been digested into single strands.
[0035] 3. Hybridize the enzyme digestion products with the maize sample DNA amplification products. (1) Take 20µL of the amplification product of the DNA sample to be tested extracted and processed by the CELON gene chip sample preparation kit, mix it with 2µL of the enzyme digestion product obtained in step 2, and place it in a PCR instrument at 96℃ for 10min, and then at 55℃ for 15h. (2) After the reaction is complete, prepare the reaction system according to Table 4, place it in the PCR instrument, and react at 37℃ for 0.5h; Table 4 (3) Take out the reaction product from step (2), add 100µL of isopropanol, mix by inverting the container ten times, and place it at 4℃ for 30min to precipitate. (4) Quickly discard the supernatant and place the PCR tube at room temperature to dry for 1 hour to obtain the enriched DNA sample.
[0036] The DNA sample prepared in this embodiment was used for SNP chip detection, and the steps are as follows: In this embodiment, 23 µL of hybridization buffer (Sailu Gene Chip Sample Preparation Kit) was added to the DNA sample prepared (i.e., the PCR tube in step 3 above), and the mixture was shaken to mix. The sample was then loaded onto the Sailu maize SNP chip (prepared using the SNP chip preparation method of CN118006735B, where the library is the library designed in step 1) for hybridization. The four libraries designed in this embodiment can detect four loci. The detection result for each locus includes signals from four bases: A, C, G, and T. Pairwise plots of the four bases were generated, resulting in six possible hybridization signal diagrams.
[0037] The hybridization signal scatter plot of the control group (i.e., the amplification products of the DNA sample to be tested extracted and processed using the CELON gene chip sample preparation kit were directly hybridized with the CELON maize SNP chip) is shown in the figure below. Figure 3 As shown, the scatter plot of hybridization signals obtained by hybridizing the DNA sample to be tested prepared using the method of this embodiment with the SNP chip of Cereal maize is shown below. Figure 4 As shown. Comparison Figure 3 and Figure 4 It can be seen that, compared with the control group, the hybridization signal value of the DNA sample prepared by the method in this embodiment is about 50% higher.
[0038] Example 2: Hybridization accuracy test of DNA samples prepared by the method in Example 1 For the maize genome, a library capable of detecting 9825 SNP sites was designed, with the design principle of each library being the same as in Example 1. The above library sequences were synthesized at GenScript Biotech Inc. The synthesized sequence powder was diluted to 4 nM with a Low TE buffer according to the concentration indicated on the synthesis tube. Then, the library was mixed in an equal volume ratio, and 1 μL was taken for subsequent steps (same as steps 2-3 in Example 1) to obtain the DNA sample to be tested.
[0039] Add 23µL of hybridization buffer (Cyclone Gene Chip Sample Preparation Kit) to the obtained DNA sample to be tested, vortex to mix; then load it onto the Cyclone 10K maize SNP chip (prepared using the SNP chip preparation method of CN118006735B, in which the library is a designed library that can detect 9825 SNP sites) for hybridization.
[0040] The experiment was repeated twice. The accuracy of hybridization detection is shown in Table 5.
[0041] Table 5 Note: The designed library can detect 9825 SNP sites, but in the actual detection process, some sites could not be detected.
[0042] As can be seen from Table 5, compared with the control group (the amplification products of the DNA to be tested extracted and processed by the Sailu gene chip sample preparation kit were directly hybridized with the Sailu 10K maize SNP chip), the accuracy of the DNA sample to be tested prepared by the method of the present invention for 10K maize SNP chip detection was significantly improved, with an improvement of about 3%.
[0043] Based on the results of Examples 1 and 2, the DNA samples prepared by the method of the present invention can effectively improve the signal value and accuracy of gene chip detection.
[0044] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0045] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A method for preparing DNA samples for SNP chip detection, characterized in that, Includes the following steps: S1. Obtain at least one library sequence, wherein the library sequence comprises, from the 5' end to the 3' end, the following sequence in sequence: P7 sequence, capture sequence, restriction endonuclease cleavage site sequence, adapter sequence, and P5 sequence, wherein the restriction endonuclease cleavage site sequence generates at least 5 arbitrary nucleotides at the 3' end of the capture sequence after enzyme digestion; the capture sequence is complementary to the target fragment of the DNA sample to be tested. S2. Amplify the library sequence described in step S1, and then perform enzyme digestion to obtain the single-stranded library sequence; S3. Mix the amplification product of the DNA sample to be tested with the single-stranded library sequence described in step S2, and denature and anneal it; S4. The product from step S3 is digested with Exonuclease I.
2. The method for preparing DNA samples for SNP chip detection according to claim 1, characterized in that, In step S1, the restriction endonuclease is BaeI or BarI.
3. The method for preparing DNA samples for SNP chip detection according to claim 1, characterized in that, In step S1, the connector sequence is as shown in CCCGTTCGCAACATGTCTGGCGTCATA; the P7 sequence is as shown in CAAGCAGAAGACGGCATACGAGAT; and the P5 sequence is as shown in TCTTTGTGACTACAGCACCCTCGACTCTCGC.
4. The method for preparing DNA samples for SNP chip detection according to claim 1, characterized in that, In step S2, amplification is performed using P5 primers and P7 primers, wherein the 5' end of the P5 primer is phosphorylated.
5. The method for preparing DNA samples for SNP chip detection according to claim 1, characterized in that, In step S2, lambda exonuclease is used for digestion.
6. The method for preparing DNA samples for SNP chip detection according to claim 1, characterized in that, In step S3, the volume ratio of the amplification product of the DNA sample to be tested to the single-stranded library sequence is 1~20:1, preferably 8~12:
1.
7. The method for preparing DNA samples for SNP chip detection according to claim 6, characterized in that, In step S3, the volume ratio of the amplification product of the DNA sample to be tested to the single-stranded library sequence is 10:
1.
8. The method for preparing DNA samples for SNP chip detection according to claim 1, characterized in that, In step S3, denaturation is carried out by reacting at 95℃~99℃ for 8min~12min, followed by annealing at 50℃~60℃ for 14h~16h.
9. A DNA sample prepared by the method according to any one of claims 1 to 8.
10. The application of the DNA sample according to claim 9 in SNP chip detection.
Citation Information
Patent Citations
An SNP chip, its preparation method and application
CN118006735B