InDel molecular marker related to logarithmic traits of meishan rib and its application
By using high-density genotype data and GCTA-COJO analysis methods, combined with independent validation populations, InDel molecular markers associated with the logarithmic number of ribs in Plum Blossom Star pigs were identified. This solved the problems of insufficient population specificity and validation in existing technologies, achieving more accurate genetic marker identification and molecular breeding results, and improving the production efficiency and economic benefits of pigs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- WUHAN POLYTECHNIC UNIVERSITY
- Filing Date
- 2026-03-03
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies for studying logarithmic traits of pig ribs suffer from limitations in population specificity, insufficient independent validation, and inadequate utilization of high-precision data, resulting in insufficient reliability and universality of genetic markers and affecting the effectiveness of molecular breeding in pigs.
By combining high-density genotype data, GCTA-COJO analysis, and independent validation populations, we identified InDel molecular markers associated with the logarithmic number of ribs in Plum Blossom Star pigs. We then used high-throughput sequencing technology to perform genome-wide association analysis, identified independent genetic signals, and constructed molecular probe combinatorials, gene chips, and KASP markers to establish a gene prediction model.
This improved the accuracy and reliability of genetic markers for the number of ribs in pigs, enhanced the universality of the markers, provided a more effective molecular breeding tool, and improved the production efficiency and economic benefits of pigs.
Smart Images

Figure CN122303436A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal genetics and breeding technology, specifically the field of InDel molecular markers related to the logarithmic traits of ribs in Plum Blossom Star Pig and their applications. Background Technology
[0002] my country has a long history of pig farming and abundant pig breeds. Local Chinese pigs, as an important component of my country's pig germplasm resource bank, have developed unique genetic backgrounds and production performance through long-term natural and artificial selection. The Meihuaxing pig, belonging to the Yangxin pig breed, is one of China's excellent local pig breeds, with its core production area mainly distributed in Huangmei County, Hubei Province, and other areas in Central China. As a distinctive and advantageous local pig breed in Hubei Province, the Meihuaxing pig has advantages such as good reproductive performance, tolerance to roughage, good disease resistance, and tender, flavorful meat. Slaughter testing experiments on Meihuaxing pigs have revealed significant differences in the number of rib pairs, and compared to other local pig breeds, it exhibits richer genetic variation in the rib pair count trait.
[0003] The number of rib pairs in pigs is an important economic trait, significantly impacting the economic benefits of pig farming. Studies have shown that each additional rib segment increases carcass length by 80 mm and carcass weight. Furthermore, research indicates a correlation between the genetic mechanisms of nipple and rib number, with some genes related to rib development being strong candidate genes influencing nipple number. Therefore, in modern pig production, selective breeding for more ribs plays a crucial role in improving pig productivity and economic benefits. The rib pair trait affects pig body shape and growth performance. Studies have shown that each additional rib segment increases carcass length by 80 mm and carcass weight. Furthermore, research indicates a correlation between the genetic mechanisms of nipple and rib number, with some genes related to rib development being strong candidate genes influencing nipple number. Therefore, identifying genetic markers related to rib number in pigs and applying them to molecular breeding is of great significance for improving pig productivity and economic benefits.
[0004] Currently, genome-wide association studies (GWAS) have become an important tool for elucidating the genetic structure of complex traits. GWAS mainly involves analyzing the association between genetic variations across the entire genome and target traits, combining systematic data collection, preprocessing, and result interpretation to identify genomic regions or loci significantly associated with target traits. Existing studies have identified genetic loci associated with rib number on multiple chromosomes in different pig breeds. Single nucleotide polymorphisms (SNPs) and small insertions / deletions (InDels) are common types of genetic variation in the genome and play an important role in regulating animal phenotypic diversity. Currently, some studies have made preliminary explorations into genes related to the number of ribs in different pig breeds, such as VRTN, LTBP2, and NR6A1, but research on genome-wide variation in the Plum Blossom pig population remains lacking, especially the discovery and analysis of InDel mutation sites.
[0005] However, traditional GWAS analysis may be affected by linkage disequilibrium (LD) when dealing with complex traits, resulting in the detection of significant signals that are not independent causal variations, but false positive signals that are highly linked to the true causal loci. In order to more accurately identify independent genetic signals, the Conditional & Joint Analysis (COJO) method has been introduced into subsequent GWAS analysis. GCTA-COJO is a commonly used tool that uses stepwise regression to include the most significant variation as a covariate in the model, thereby identifying independent associated signals and effectively distinguishing between independent signals and false positive signals caused by LD. In addition, GWAS studies on logarithmic traits of pig ribs still have the following shortcomings: (1) Population specificity limitation. Currently identified genetic markers often show population specificity, that is, markers that are significant in specific pig breeds may perform poorly or lack statistical significance in other pig breeds or strains, which greatly restricts their universality in broader breeding practices; (2) Insufficient independent validation. Some studies have failed to fully replicate the significant associated loci in independent validation populations. The lack of such validation may lead to false positives, thereby weakening the reliability of the discovered markers and their value in practical applications; (3) The potential of high-precision data utilization has not been fully explored. With the rapid development of high-throughput sequencing technology, GWAS analysis combining chip-filled data and whole-genome sequencing data can provide high-density and high-precision genotypic information. However, existing studies have not yet fully utilized these high-precision data, and their potential in mining more refined genetic variations and improving the power of association analysis still needs to be further developed. Summary of the Invention
[0006] This application aims to address the aforementioned problems in the prior art by combining high-density genotype data, advanced GWAS analysis methods (including GCTA-COJO), and independent validation populations to identify more reliable and universal genetic markers for the trait of rib number in pigs, thereby providing a more effective tool for molecular breeding of pigs.
[0007] To achieve the above objectives, a first aspect of the present invention provides an InDel molecular marker associated with the logarithmic trait of ribs in the Plum Blossom Star Pig, located on chromosome 7, comprising: The base sequence shown in SEQ ID NO.17 has a polymorphism of T or TA at position 201, where the number of rib pairs in the TA / TA genotype is greater than the number of rib pairs in the T / T genotype. The base sequence shown in SEQ ID NO.18 has a polymorphism of T or TG at position 201, where the number of rib pairs in the T / T genotype is greater than the number of rib pairs in the T / TG genotype, which is greater than the number of rib pairs in the TG / TG genotype. The base sequence shown in SEQ ID NO.19 has a polymorphism of T or TC at position 201, where the number of rib pairs in the T / T genotype is greater than the number of rib pairs in the T / TC genotype, which is greater than the number of rib pairs in the TC / TC genotype. As shown in SEQ ID NO.20, the polymorphism at position 201 is CA or C, where the number of rib pairs in the C / C genotype is greater than the number of rib pairs in the CA / C genotype, which is greater than the number of rib pairs in the CA / CA genotype. As shown in SEQ ID NO.21, the polymorphism at position 201 is G or GT, where the number of rib pairs in the G / GT genotype is greater than the number of rib pairs in the G / G genotype; The base sequence shown in SEQ ID NO.22 has a polymorphism of G or GA at position 201, where the number of rib pairs in the G / G genotype is greater than the number of rib pairs in the G / GA genotype, which is greater than the number of rib pairs in the GA / GA genotype. The base sequence shown in SEQ ID NO.23 has a polymorphism of G or GTGAT at position 201, where the number of rib pairs in the G / G genotype is greater than the number of rib pairs in the G / GTGAT genotype, which is greater than the number of rib pairs in the GTGAT / GTGAT genotype. As shown in SEQ ID NO.24, the polymorphism at position 201 is GT or G, where the number of rib pairs in the GT / GT genotype is greater than the number of rib pairs in the GT / G genotype, which is greater than the number of rib pairs in the G / G genotype.
[0008] The above loci were determined based on the pig reference genome Sus scrofa 11.1.
[0009] To achieve the technical objective of this invention, a second aspect of this invention provides a primer combination for amplifying the above-mentioned InDel molecular marker, comprising the nucleotide sequence shown in SEQ ID NO.1-16.
[0010] To achieve the technical objective of this invention, a third aspect of this invention provides a molecular probe array for analyzing the logarithmic traits of the ribs of the Plum Blossom Star Pig, wherein the molecular probe array detects the molecular markers as described above in the sample to be tested.
[0011] To achieve the technical objective of this invention, a fourth aspect of this invention provides a gene chip for analyzing the logarithmic traits of the ribs of the Plum Blossom Star Pig, wherein the gene chip is loaded with the aforementioned combination of molecular probes.
[0012] To achieve the technical objective of this invention, the fifth aspect of this invention provides a KASP marker for analyzing the logarithmic traits of the ribs of the Plum Blossom Star Pig, which can detect the typing results of the aforementioned molecular markers.
[0013] To achieve the technical objective of this invention, the sixth aspect of this invention provides a kit for analyzing the logarithmic traits of the ribs of Plum Blossom Star Pig, which has the above-mentioned combination of molecular probes or gene chips or KASP markers.
[0014] To achieve the technical objective of this invention, a seventh aspect of this invention provides a gene prediction model for analyzing the logarithmic traits of ribs in the Meihuaxing pig. This model is constructed based on the molecular markers described in claim 1, specifically as follows:
[0015] in, Represents probability. This represents the probability of an individual having different numbers of ribs. For the intercept term, Let k be the effect coefficient of the i-th InDel, and k represent the number of ribs. .
[0016] To achieve the technical objective of this invention, the eighth aspect of this invention provides a method for analyzing the logarithmic trait of ribs in Plum Blossom Star pigs, which detects the genotype of the aforementioned molecular markers in the genome of the pig sample to be tested, and determines the number of ribs in Plum Blossom Star pigs based on the genotype results.
[0017] The detection of the genotype of the molecular markers in the genome of the pig sample to be tested is performed by using the above-mentioned molecular probe combination, gene chip, KASP marker, kit, or gene prediction model to detect and analyze the sample.
[0018] To achieve the technical objective of this invention, the ninth aspect of this invention provides the above-mentioned molecular probe combination, gene chip, KASP marker, kit, or gene prediction model for the following uses: (1) application in the evaluation of logarithmic traits of Meihuaxing pig ribs; (2) application in the screening of Meihuaxing pig breeds with logarithmic traits of ribs; (3) application in the identification of Meihuaxing pig breeds with logarithmic traits of ribs; (4) application in the tracing of Meihuaxing pig breeds with logarithmic traits of ribs; (5) application in the breeding of Meihuaxing pig breeds with logarithmic traits of ribs; (6) application in the protection of Meihuaxing pig germplasm resources; (7) application in the improvement of Meihuaxing pig germplasm resources; and (8) application in the reconstruction of Meihuaxing pig pedigree.
[0019] In summary, the present invention achieves beneficial effects by adopting the above technical solution: 1. Improve the accuracy of localization and the depth of data mining: GWAS analysis based on InDel variants is performed using high-depth whole-genome sequencing data to mine InDel variants and associate them with the rib number trait, thereby improving the accuracy, resolution and heritability resolution of genetic markers for the rib number trait in pigs.
[0020] 2. Effective identification of independent causal signals: The introduction of GCTA-COJO for conditional and joint analysis can effectively distinguish independent causal InDel sites from false positive signals caused by linkage disequilibrium, thereby ensuring that the identified significant markers are more biologically significant and have greater application value.
[0021] 3. Enhanced the reliability and universality of markers: By validating in independent validation populations, false positive results were eliminated, the stability of the identified genetic markers under different genetic backgrounds was confirmed, and the reliability and universality of the markers in actual production were significantly improved.
[0022] 4. Provide more effective tools for molecular breeding of pigs: The significant markers identified in this application can be used as molecular selection tools for the rib number trait in pigs, applied to assisted selection breeding of pigs, accelerating the selection process of superior breeding pigs, increasing the rib number of pig herds, and thus improving carcass quality and economic benefits. Attached Figure Description
[0023] Figure 1 Image of DNA electrophoresis results; Figure 2 Manhattan plot for genome-wide association analysis. Detailed Implementation
[0024] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.
[0025] Example 1 1. Data Collection Tissue samples were collected from 102 Sika Star pigs. Rib images of each pig were taken using a Vetoo GJ-2 high-frequency digital X-ray machine (DR) (a device capable of providing clear in vivo imaging of all ribs in young piglets), and phenotypic analysis and statistical analysis were performed. Corresponding tissue samples and DNA were extracted. DNA extraction methods employed conventional techniques in the field, which will not be specifically described in this invention. Statistical results show that the number of rib pairs in the 102 Sika Star pigs used in this invention ranged from 13 to 16, as detailed in Table 1. Table 1. Descriptive statistics of the logarithmic traits of ribs in 102 Meihua Xing pigs.
[0026] Because sequencing requires certain DNA quality, and low-quality DNA can affect sequencing results, 2% agarose gel electrophoresis is used to detect whether the extracted DNA has degraded. The electrophoresis results are as follows: Figure 1 As shown in the image, the DNA sample bands are clear, bright, complete, and without tailing, indicating that the DNA has not been degraded. The results of ultra-micro spectrophotometry analysis show that the lowest DNA concentration was 60.65 ng / μl, the highest was 1492.30 ng / μl, and the average was 539.48 ng / μl. The minimum OD260 / 280 was 1.79, the maximum was 2.02, and the average was 1.93. These results indicate that the DNA quality of the experimental population is good and meets the sequencing requirements.
[0027] 2. DNA Data Processing One hundred and two qualified DNA samples were sent to Wuhan Shadow Gene Technology Co., Ltd. for 20× resequencing (BGI sequencing platform). Raw sequencing data were quality controlled using FASTP (v0.23.4). The raw FASTQ files were then aligned to the pig reference genome (Sus_scrofa.Sscrofa11.1) using BWA software. Finally, samtools was used to sort, deduplicate, remove redundancy, and index the resulting BAM files, yielding pre-processed BAM files.
[0028] 3. Detection of whole-genome SNPs and InDels To ensure data integrity, in one embodiment of the present invention, whole-genome single nucleotide polymorphism (SNP) and insertion / deletion (InDel) variants are detected in qualified sequencing data. The specific method is as follows: (1) Variance detection and joint typing Genetic variation detection and genotyping were performed using the GATK workflow. First, the HaplotypeCaller tool was used to detect variations in each sample, generating a GVCF file containing variation information at all loci. Then, the CombineGVCFs tool was used to merge the GVCF files from all samples, preparing for joint genotyping. Finally, the GenotypeGVCFs tool was used for joint genotyping, yielding a VCF file containing the original variation information from all samples.
[0029] (2) SNP variant screening and filtering SNP variants were extracted from the original VCF file using the SelectVariants tool, and then rigorously filtered using the VariantFiltration tool. The filter parameters were set to "QD<2.0, QUAL<30.0, SOR>3.0, FS>60.0, MQ<40.0, MQRankSum<-12.5, ReadPosRankSum<-8.0". After filtering, the bcftools tool was used to select the biallelic SNPs that passed the filter.
[0030] (3) InDel variant screening and filtering Similarly, InDel variant sites were extracted from the original VCF file using the SelectVariants tool and filtered using the VariantFiltration tool. The filtering parameters for InDel characteristics were set to "QD<2.0, QUAL<30.0, FS>200.0, ReadPosRankSum<-20.0". After filtering, the bcftools tool was used to select InDel sites that passed the filter and were biallelic.
[0031] (4) Quality control and final dataset generation SNPs and InDel variants obtained from screening underwent rigorous quality control, retaining variants with coverage >30% and minor allele frequency (MAF) >0.01, while SNPs within 5 bp of InDel variants were removed. Preliminary quality control of variant sites was performed using vcftools, with the following criteria: a call rate of over 90% for a single site and an individual call rate of over 90%. Subsequently, BEAGLE was used to imput genotypes, with a minimum allele frequency (MAF) threshold of 0.01. A total of 26,208,271 SNP sites and 3,545,761 InDel sites were obtained for subsequent analysis.
[0032] 4. Kinship construction and genome-wide association analysis Because population structure and kinship can lead to complex genetic correlations among samples, false positive results may occur if not corrected. Therefore, constructing a kinship matrix can effectively correct for these confounding effects, making the association analysis between InDel and phenotype more accurate. The kinship matrix of this invention is constructed based on 26,208,271 high-quality SNPs obtained in step 3.
[0033] This invention uses the single-label regression analysis method in GCTA software for GWAS analysis, and the mixed linear model is as follows: y=Xb+Za+e In the above model, y represents the phenotypic value; b represents the InDel effect; and a represents the residual polygenic effect. , Let be the individual additive genetic variance, G be the kinship matrix constructed based on SNPs, X and Z be the association matrices of b and a, respectively; e represents the residual effect vector. , This represents the residual variance.
[0034] Genome-wide association analysis (GWAS) based on InDel was performed on the logarithmic rib traits of 102 Sika Star pigs using GCTA software, and the results were visualized using R software. Figure 2 ), and 77 InDel loci that were significantly associated with the logarithmic traits of the ribs of the Meihuaxing pig were obtained.
[0035] 5. Obtaining InDel molecular markers To identify independent causal loci associated with the rib number trait in Plum Blossom pigs and to perform statistical tests on candidate genes, we conducted a subsequent refined statistical genetic analysis on significant association signals obtained from GWAS analysis. First, we performed conditional and conjoint analyses using the COJO module of GCTA software. This analysis, based on the summary statistics from genome-wide association analyses and combined with linkage disequilibrium information from a reference population, employed a stepwise regression method, iteratively incorporating the most significant variant loci as covariates into the model. Through this step, we identified independent association signals within a given dataset, effectively distinguishing complex association signals caused by multiple causal loci within a single linkage disequilibrium region and excluding false positive associations caused by linkage disequilibrium. Second, to assess the overall contribution of genes within significantly associated regions, we applied the fastBAT method for gene-based association analysis. This method aggregates the effects of all variants within a gene region and performs an overall significance test on each gene, thereby efficiently identifying functional units associated with the target trait. Finally, by integrating the independent signals obtained from COJO analysis with the significant genes identified by fastBAT analysis, eight loci significantly associated with the number of ribs in Meihuaxing pigs were identified as high-confidence candidate loci, and their base sequences are shown in SEQ ID NO.17-24. At position 97157783 on chromosome 7, the polymorphism is T or TA, with the number of rib pairs in the TA / TA genotype exceeding the number of rib pairs in the T / T genotype; at position 97568477, the polymorphism is T or TG, with the number of rib pairs in the T / T genotype exceeding the number of rib pairs in the T / TG genotype; at position 97568634, the polymorphism is T or TC, with the number of rib pairs in the T / T genotype exceeding the number of rib pairs in the T / TC genotype exceeding the number of rib pairs in the TC / TC genotype; at position 97571384, the polymorphism is CA or C, with the number of rib pairs in the C / C genotype exceeding the number of rib pairs in the CA / CA genotype; at position 9... At position 7617647, the polymorphism is G or GT, with the number of rib pairs in the G / GT genotype exceeding the number of rib pairs in the G / G genotype; at position 97691233, the polymorphism is G or GA, with the number of rib pairs in the G / G genotype exceeding the number of rib pairs in the G / GA genotype exceeding the number of rib pairs in the GA / GA genotype; at position 97812991, the polymorphism is G or GTGAT, with the number of rib pairs in the G / G genotype exceeding the number of rib pairs in the GTGAT / GTGAT genotype; at position 98096522, the polymorphism is GT or G, with the number of rib pairs in the GT / GT genotype exceeding the number of rib pairs in the GT / G genotype exceeding the number of rib pairs in the G / G genotype.
[0036] Example 2: Primer combinations, molecular probes, and KASP labeling for analyzing the logarithmic traits of ribs in Plum Blossom Star Pigs. Those skilled in the art can find the preceding and following sequence information of the molecular markers provided in Example 1 and design primers, molecular probes, or KASP markers using conventional methods. These can be obtained without any creative effort. Therefore, the primer combinations, molecular probes, and KASP markers obtained by the site combinations provided in this invention also fall within the protection scope of this invention.
[0037] For example, in one embodiment of the present invention, the amplification primers designed using conventional methods in the art are:
[0038] For example, according to the KASP marker primer design principle, 200 bp sequences upstream and downstream of the eight sites provided in Example 1 are first extracted, as shown in SEQ ID NO.17-24. The above sequences are compared with the reference genome using the software blast v2.10.1 to remove SNP sites that can be aligned to multiple positions, retaining only single-matching SNP sites. Then, primers are designed for the retained SNP sites using the primer design software primer3 v2.4.0, and fluorescent sequence tags "FAM" (GAAGGTGACCAAGTTCATGCT) and "HEX" (GAAGGTCGGAGTCAACGGATT) are added to the front end of the primers, respectively, to convert all the above SNP sites into KASP markers.
[0039] Example 3: Obtaining a gene chip for analyzing the logarithmic traits of the ribs of the Plum Blossom Star Pig. In one embodiment of the present invention, the gene chip can be prepared using any conventional method in the prior art to obtain the primers or probes provided in Example 2. For example, the primers or probes can be immobilized on a polymer substrate, such as a nylon membrane, nitrocellulose membrane, plastic, silicone wafer, or micro-magnetic beads; or the probes can be immobilized on a glass plate; or the primers or probes obtained in Example 2 can be directly synthesized on a hard surface such as glass. The method of using the gene chip of this application is the same as the conventional method. The above process can also be outsourced to a biotechnology company. This also does not require any inventive effort; therefore, the gene chip obtained by the site combination provided by the present invention also falls within the protection scope of the present invention.
[0040] Example 4: Obtaining a kit for analyzing the logarithmic traits of ribs in Plum Blossom Star pigs. In one embodiment of the present invention, the kit can be obtained using primer combinations, molecular probes, gene chips, and KASP markers provided by the present invention, employing methods known or conventional in the art, and the present invention does not impose any limitations.
[0041] For example, in one embodiment of the present invention, the kit can be a kit for amplifying the primer sequences of the above-mentioned 8 sites, including reagents required for the amplification reaction system. For example, a 20 μl reaction system kit contains 2 μL 10× buffer (TAKARA), 0.3 μL HotTaq 5U / μL (TAKARA), 2.4 μL dNTP (2.5mM), 1.2 μL MgCl2 (25mM), 10.1 μL ddH2O, 2 μL sample DNA, and 2 μL multiplex PCR panel primers. The reaction conditions used in this kit are: denaturation at 95℃ for 2 min; denaturation at 95℃ for 20 s, annealing at 60℃ for 40 s, extension at 72℃ for 1 min, cycling 11× (-0.5℃ / cycle); denaturation at 95℃ for 20 s, annealing at 60℃ for 30 s, extension at 72℃ for 1 min, cycling 24×; extension at 72℃ for 1 min; hold at 4℃, cycle forever to obtain PCR products.
[0042] Application Example 1 In addition, a separate population of Sika Star pigs (with a different genetic background or individual origin than the GWAS population) was selected as a validation population. Genotyping of the significant loci analyzed above was performed using multiplex PCR, yielding genotyping results for the InDel loci in 302 Sika Star pigs suitable for valid validation. The specific steps are as follows: (1) Sample quality control Take 1 μl of DNA sample and perform quality testing (concentration and integrity testing) on the sample using 1% agarose gel electrophoresis. Then, dilute the sample to a working concentration of 5-10 ng / μl according to the concentration results of DNA samples from each pig.
[0043] (2) Multiplex PCR reaction of target fragments in samples Target region amplification of the sample: Multiplex PCR amplification was performed using the optimized multiplex PCR primer panel. The primer sequences are shown in the table below:
[0044] The amplification reaction system consisted of 20 μl of 10× buffer (TAKARA), 0.3 μl of HotTaq 5U / μl (TAKARA), 2.4 μl of dNTP (2.5 mM), 1.2 μl of MgCl2 (25 mM), 10.1 μl of ddH2O, 2 μl of sample DNA, and 2 μl of multiplex PCR panel primers. The reaction conditions were: 95℃ denaturation for 2 min; 95℃ denaturation for 20 s, 60℃ annealing for 40 s, 72℃ extension for 1 min, 11× cycles (-0.5℃ / cycle); 95℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 24× cycles; 72℃ extension for 1 min; hold at 4℃ for forever cycles. Then, the PCR amplification validity of the sample was confirmed by 1.5% agarose gel electrophoresis; the multiplex PCR products of each panel of the same sample were quantitatively mixed according to the electrophoresis brightness and the number of fragments in each panel; the mixed multiplex PCR products were diluted 10-20 times and used as templates for the subsequent index PCR step, i.e., specific tag sequences were added.
[0045] The addition of specific tag sequences to samples was performed as follows: using primers with the index sequence, specific tag sequences compatible with the Illumina platform were introduced to the ends of the library via PCR amplification; the following mixture (20 μL) was prepared in a 96-well plate: 4 μL 5×Reaction Buffer, 2.4 μL dNTP (2.5 mM), 0.8 μL NGMPCRF (10 μM). 2 μL NGMPCRR (4 μM) 0.2 μL Herculase® II Fusion DNA Polymerase, 2 μL diluted PCR product, 10.6 μL ddH2O. c) The reaction program was as follows: 95℃ denaturation for 2 min, 1× cycle; 95℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 11× cycle; 72℃ extension for 3 min, 1× cycle; 4℃ hold, forever cycle. All sample index PCR products were mixed in equal proportions according to amplification efficiency.
[0046] The sample mixing and gel extraction steps are as follows: Prepare a 2% agarose gel, take 50 μL of index PCR mixture, and electrophoresis at 120V for 35 minutes; according to the commercial DNA Marker B, cut out the brighter band region near the size of the target product; the gel extraction operation is performed according to the TIANGEN Gel Extraction kit instructions. Library quantification and sequencing; the fragment length distribution of the library was verified using an Agilent 2100 Bioanalyzer; after accurate quantification of the library molar concentration, high-throughput sequencing was finally performed on the Illumina platform in 2×150 bp paired-end sequencing mode to obtain FastQ data.
[0047] Then, one-way ANOVA was performed using SPSS software to analyze the genotypes and rib logarithmic traits at the eight InDel loci. Different genotypes at the eight loci had a significant impact on the rib logarithmic trait in Meihuaxing pigs. An additive linear model was used to estimate the combined effect of the eight significant loci. The model fitting results showed that the eight significantly related loci could explain 30.69% of the variance in the rib logarithmic phenotype.
[0048] Meanwhile, SPSS software was used to perform significance tests on genotype and rib logarithmic traits at the eight InDel loci, and the results are shown in Table 2.
[0049]
[0050] As shown in Table 2, all eight InDel loci were significantly correlated with the number of rib pairs in pigs (P<0.05), reaching a highly significant level (P<0.01). The number of rib pairs was significantly higher in the T / TA genotype at chr7_97157783 than in the T / T genotype; significantly higher in the T / T genotype than in the T / TG and TG / TG genotypes at chr7_97568477; significantly higher in the T / T genotype than in the T / TC and TC / TC genotypes at chr7_97571384; and significantly higher in the C / C genotype than in the CA / C and CA / CA genotypes at chr7_97571384. The number of rib pairs in the G / GT genotype at the chr7_97617647 locus was significantly greater than that in the G / G genotype; the number of rib pairs in the G / G genotype at the chr7_97691233 locus was significantly greater than that in the G / GA and GA / GA genotypes; the number of rib pairs in the G / G genotype at the chr7_97812991 locus was significantly greater than that in the G / GTGAT and GTGAT / GTGAT genotypes; and the number of rib pairs in the GT / GT genotype at the chr7_98096522 locus was significantly greater than that in the GT / G and G / G genotypes.
[0051] The above results indicate that there is still considerable room for improvement in the logarithmic rib trait of the breeding pig population. In actual breeding, priority should be given to selecting individuals carrying the superior genotypes related to multiple ribs (specifically: T / TA genotype at chr7_97157783, T / T genotype at chr7_97568477, T / T genotype at chr7_97568634, C / C genotype at chr7_97571384, G / GT genotype at chr7_97617647, G / G genotype at chr7_97691233, G / G genotype at chr7_97812991, and GT / GT genotype at chr7_98096522) to increase the gene frequency of superior alleles in the population, thereby increasing the overall number of rib pairs, improving the carcass structure of pigs, increasing body length, and ultimately improving the economic benefits of commercial pig production.
[0052] Application Example 2: Multigene Prediction Model Based on 8 InDels To further demonstrate the application of the molecular markers provided by this invention in breeding models, one embodiment of this invention provides a multi-gene prediction model based on eight InDel molecular markers. Specifically, a more accurate multi-gene prediction model is constructed based on association analysis of eight significant loci, and the predictive performance of the model is evaluated through cross-validation.
[0053] Model Construction: In one embodiment of the present invention, a proportional advantage model is used to comprehensively analyze the eight InDel loci. This model is suitable for predicting ordinal categorical variables and can fully utilize the joint effects among InDels. The model is as follows:
[0054] in, Represents probability. This represents the probability that the observed result is less than or equal to a specific threshold k. For the intercept term, Let k be the effect coefficient of the i-th InDel, and k represent the number of ribs. .
[0055] Using the genotypes of 302 Sika Star pigs at eight loci, locus effect coefficients were calculated to predict the probability of an individual having different rib numbers. Finally, a 5-fold cross-validation method was used to evaluate the model performance. The results showed that the overall accuracy of the model prediction was 71.9%, and the eight InDel genotypes collectively influenced the number of ribs by 1.5, with a relative change of 10.9%. Encoding the individual's genotype and substituting it into the above formula to calculate the probability of that individual having different rib numbers provides an effective predictive tool for marker-assisted selection of the rib number trait in Sika Star pigs.
[0056] It should be noted that, because the molecular markers provided by this invention have clear locations and are highly correlated with the phenotype of logarithmic rib traits, those skilled in the art can easily obtain probes, gene chips, KASPs, and kits based on the molecular markers of this invention using conventional techniques in the field, without requiring any inventive effort. Furthermore, those skilled in the art can easily conceive of using them for the evaluation of logarithmic rib traits in pigs, breed screening, identification, tracing, pig breeding, germplasm resource protection and improvement, and pedigree reconstruction in pigs.
[0057] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-described technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. InDel molecular markers associated with the logarithmic trait of ribs in Plum Blossom Star pigs, located on chromosome 7, include: The base sequence shown in SEQ ID NO.17 has a polymorphism of T or TA at position 201, where the number of rib pairs in the TA / TA genotype is greater than the number of rib pairs in the T / T genotype. The base sequence shown in SEQ ID NO.18 has a polymorphism of T or TG at position 201, where the number of rib pairs in the T / T genotype is greater than the number of rib pairs in the T / TG genotype, which is greater than the number of rib pairs in the TG / TG genotype. The base sequence shown in SEQ ID NO.19 has a polymorphism of T or TC at position 201, where the number of rib pairs in the T / T genotype is greater than the number of rib pairs in the T / TC genotype, which is greater than the number of rib pairs in the TC / TC genotype. As shown in SEQ ID NO.20, the polymorphism at position 201 is CA or C, where the number of rib pairs in the C / C genotype is greater than the number of rib pairs in the CA / C genotype, which is greater than the number of rib pairs in the CA / CA genotype. As shown in SEQ ID NO.21, the polymorphism at position 201 is G or GT, where the number of rib pairs in the G / GT genotype is greater than the number of rib pairs in the G / G genotype; The base sequence shown in SEQ ID NO.22 has a polymorphism of G or GA at position 201, where the number of rib pairs in the G / G genotype is greater than the number of rib pairs in the G / GA genotype, which is greater than the number of rib pairs in the GA / GA genotype. The base sequence shown in SEQ ID NO.23 has a polymorphism of G or GTGAT at position 201, where the number of rib pairs in the G / G genotype is greater than the number of rib pairs in the G / GTGAT genotype, which is greater than the number of rib pairs in the GTGAT / GTGAT genotype. The base sequence shown in SEQ ID NO.24 has a polymorphism of GT or G at position 201, where the number of rib pairs in the GT / GT genotype is greater than the number of rib pairs in the GT / G genotype, which is greater than the number of rib pairs in the G / G genotype. The above loci were determined based on the pig reference genome Sus scrofa 11.
1.
2. The primer combination for amplifying the InDel molecular marker as described in claim 1, characterized in that, Includes nucleotide sequences as shown in SEQ ID NO. 1-16.
3. A molecular probe combination for analyzing the logarithmic traits of the ribs of Plum Blossom Star Pig, wherein the molecular probe combination detects the molecular markers as described in claim 1 in the sample to be tested.
4. A gene chip for analyzing the logarithmic traits of the ribs of the Plum Blossom Star Pig, wherein the gene chip is loaded with the primer combination as described in claim 2 or the molecular probe combination as described in claim 3.
5. Analysis of KASP markers for the logarithmic traits of ribs in Plum Blossom Star Pigs, characterized in that, It can detect the typing results of the molecular markers described in claim 1.
6. A kit for analyzing the logarithmic traits of ribs in Plum Blossom Star pigs, comprising the primer combination of claim 2, the molecular probe combination of claim 3, the gene chip of claim 4, or the KASP marker of claim 5.
7. A gene prediction model for the logarithmic trait of ribs in Plum Blossom Star pigs, characterized in that, The model is constructed based on the molecular markers described in claim 1, specifically as follows: in, Represents probability. This represents the probability that the observed result is less than or equal to a certain threshold K. For the intercept term, Let k be the effect coefficient of the i-th InDel, and k represent the number of ribs. .
8. A method for analyzing the logarithmic trait of ribs in Plum Blossom Star pigs, wherein the genotype of the molecular marker described in claim 1 is detected in the genome of the pig sample to be tested, and the number of ribs in Plum Blossom Star pigs is determined based on the genotype results; Preferably, the genotype of the molecular marker of claim 1 in the genome of the pig sample to be tested is detected by using the primer combination of claim 2, the molecular probe combination of claim 3, the gene chip of claim 4, the KASP marker of claim 5, or the kit of claim 6 to detect the sample to be tested.
9. The method as described in claim 8, characterized in that, The determination of the number of rib pairs in Plum Blossom Pigs based on genotype results can be predicted by calculating the probability of an individual having different rib numbers using the model described in claim 7, thereby predicting whether that individual can increase the number of ribs in the population.
10. The primer combination of claim 2, the molecular probe combination of claim 3, the gene chip of claim 4, the KASP marker of claim 5, the kit of claim 6, or the gene prediction model of claim 7 have the following uses: (1) Application in the evaluation of logarithmic traits of ribs in Meihuaxing pigs; (2) Application in the screening of varieties with logarithmic traits of ribs in Meihuaxing pigs; (3) Application in the identification of logarithmic traits of ribs in Meihuaxing pigs; (4) Application in the tracing of the logarithmic trait of ribs in Meihuaxing pig breeds; (5) Application in the breeding of logarithmic traits of ribs in Meihua Star Pig; (6) Application in the conservation of Meihua Star Pig germplasm resources; (7) Application in the improvement of Meihuaxing pig germplasm resources; (8) Application in the reconstruction of the pedigree of the Plum Blossom Star Pig.