Detection marker of wheat major gene qrs-2a for resistant starch content

Abstract

The application belongs to the technical field of wheat breeding, and particularly relates to a detection marker of a main-effect gene qRS-2A of resistant starch content in wheat. The linkage marker is a SNP marker AX-110945017, the SNP marker is located on the long arm of the 2A chromosome, and the 36th base is an A / G allele, and there are AA genotypes with high resistant starch content and GG genotypes with low resistant starch content. Based on the SNP site and the corresponding KSAP marker, the resistant starch content in the wheat kernel can be accurately distinguished, and thus a good technical foundation can be laid for early screening of wheat germplasm resources with different resistant starch contents in the process of wheat molecular breeding, and subsequent selection of wheat varieties with target traits.

Description

Technical Field

[0001] This application belongs to the field of wheat breeding technology, specifically involving the detection marker of the major gene qRS-2A for wheat resistant starch content. Background Technology

[0002] Resistant starch is a general term for starch substances that cannot be digested and absorbed by the healthy human intestine. Due to its resistant properties, it can serve as a novel dietary fiber and prebiotic, playing a positive role in maintaining human health and preventing chronic diseases. Furthermore, in the food industry, resistant starch can be used to improve food texture (such as increasing bread elasticity and extending shelf life) and enhance the health attributes of products (such as low-GI foods). Therefore, in-depth research on resistant starch is crucial.

[0003] Based on their source and physicochemical properties, resistant starches can be classified into five categories: RS1, RS2, RS3, RS4, and RS5. RS1 is physically encapsulated starch, found in the cell walls of cereal seeds and tubers; RS2 consists of resistant starch granules, mostly found in immature starchy foods such as raw potatoes, raw peas, and green bananas; RS3 is retrograde starch, mostly found in cooked and cooled foods such as rice and corn; RS4 is chemically modified starch, a type of modified starch that undergoes cross-linking reactions with chemical substances; and RS5 is a high-amylose-content complex composed of amylose and fat.

[0004] Resistant starch in wheat is mainly of the RS2 type. Previous studies have shown that the genes determining resistant starch content are typical quantitative trait genes, with the final content controlled by multiple genes of minor effect. These genes are also easily influenced by temperature, light, and mineral nutrition factors, exhibiting a normal distribution across varieties. Therefore, if the genes controlling wheat resistant starch content can be located stably under various environmental conditions, and corresponding molecular markers can be developed, it will provide strong technical support for early-generation screening in the breeding process, identification of germplasm resources with high resistant starch, and subsequent variety selection, which is of great technical significance. Summary of the Invention

[0005] The purpose of this application is to provide an SNP marker AX-110945017 that is significantly associated with a gene for resistant starch content in wheat grains, thereby laying a certain technical foundation for further identification of resistant starch content genes and the development of new wheat varieties with different resistant starch contents.

[0006] The technical solution adopted in this application is described in detail below.

[0007] The detection marker for the major gene qRS-2A of wheat resistant starch content is a linkage marker, namely an SNP marker AX-110945017, which is located on the long arm of chromosome 2A. The nucleotide sequence (71 bp) of the SNP marker is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAAC[A / G]GAATTCTTTCTCGCCAACACGCGATCTGAGACAAGG; That is, its 36th base is an A / G allele, therefore, it can be divided into two types: the AA genotype with high resistant starch content and the GG genotype with low resistant starch content. The nucleotide sequence of the AA genotype is shown in SEQ ID No. 1, and is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAACAGAATCTTTCTCGCCAACACGCGATCTGAGACAAGG; The nucleotide sequence of the GG genotype is shown in SEQ ID No. 1, and is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAACGGAATCTTCTCGCCAACACGCGATCTGAGACAAGG.

[0008] The linkage markers for wheat grain resistant starch content are used in wheat breeding. The linkage markers are associated with wheat resistant starch content. Wheat with the AA genotype has high resistant starch content, while wheat with the GG genotype has low resistant starch content.

[0009] The linkage marker was detected using KASP markers, which are a set of primers used for PCR amplification. The primer sequences were designed as follows: F1:5'-GAAGGTGACCAAGTTCATGCTGCATGCATTACACTTCCGTCCTGTA-3', F2: 5'-GAAGGTCGGAGTCAACGGATTGCATGCATTACACTTCCGTCCTGTG-3', R: 5'-TAGGCAGAGTGTGTCGTCCAGT-3'.

[0010] The KASP marker is used in wheat breeding to detect and distinguish wheat germplasm with high resistant starch content AA genotype and wheat germplasm with low resistant starch content GG genotype.

[0011] The method for detecting wheat resistant starch content using the KASP-labeled method includes the following steps: (a) Extracting DNA Genomic DNA was extracted from the leaf tissue of the wheat to be tested for later use. (II) PCR amplification Using the genomic DNA extracted and prepared in step (I) as a template, PCR amplification was performed using the KASP marker; (III) Identification and Differentiation Based on the PCR amplification results of step (II), the genotype of the wheat to be detected is determined. If it is the AA genotype, then the wheat to be tested is a germplasm with high resistant starch content; If the genotype is GG, then the wheat to be tested is a germplasm with low resistant starch content.

[0012] Based on the analysis of resistant starch content in 206 different wheat varieties and further association analysis between resistant starch content and high-throughput molecular markers, the inventors discovered a SNP marker (AX-110945017) on the long arm of wheat chromosome 2A that is significantly associated with resistant starch content. The 36th base of this marker sequence is an A / G allele mutation. Genotyping analysis using the polymorphism at this site showed that when the base at this site is A, the wheat grain has a higher resistant starch content, and when the 36th base is G, the grain has a lower resistant starch content. To facilitate the application of this SNP site in practical molecular breeding processes, the inventors further developed a corresponding KSAP marker.

[0013] Preliminary experimental results show that KSAP markers based on relevant SNP sites can accurately distinguish the content of resistant starch in wheat grains, thus laying a good technical foundation for the early screening of wheat germplasm resources with different resistant starch contents and the subsequent breeding of wheat varieties with target traits in the process of wheat molecular breeding. Attached Figure Description

[0014] Figure 1 The correlation between the SNP markers developed for this invention and the resistant starch content in grains: blue indicates the resistant starch content in grains of wheat varieties (lines) with genotype AA; pink indicates the resistant starch content in grains of wheat varieties (lines) with genotype GG; the results show that the difference between the two genotypes is extremely significant (P<0.01). Figure 2 Genotyping diagram of KASP markers; blue represents wheat varieties (lines) with genotype AA, green represents wheat varieties (lines) with genotype GG; gray represents NTC blank control; red represents AG heterozygous control. Detailed Implementation

[0015] The present application will be further explained below with reference to the accompanying drawings and embodiments. It should be noted that the applicant, as a professional agricultural research institution, has established a professional and publicly available seed resource bank, and the inventor, as a professional researcher, has long been engaged in wheat breeding and related research. Therefore, the inventor has long collected and preserved relevant publicly available germplasm materials. Thus, the relevant wheat varieties involved in the following embodiments all comply with the requirements of relevant administrative regulations. Example 1

[0016] Based on the analysis of resistant starch content in 206 different wheat samples, the inventors found significant differences in resistant starch content among different wheat varieties (see Table 1 below for the same statistical results). Figure 1 Further gene association analysis led the inventors to identify an SNP marker, AX-110945017, on the long arm of wheat chromosome 2A. The discovery and identification process of this marker is briefly described below.

[0017] (I) Experimental Materials The experimental materials consisted of 206 wheat germplasm resources with different genetic backgrounds. During the planting process, to ensure the accuracy and reliability of phenotypic (resistant starch) data, all materials were planted in the same year and in the same experimental field, and uniform water and fertilizer management measures were adopted to minimize the impact of environmental factors on resistant starch content. The field trial adopted a randomized block design with three biological replicates.

[0018] (II) Phenotypic determination: For the determination of resistant starch content in harvested wheat grains, the Megazyme resistant starch test kit (K-RSTAR) is used. For specific operation, please refer to the kit instructions or the following operation procedure.

[0019] First, the wheat grains were ground and passed through a 1.0 mm sieve. The moisture content of the sample was determined and 100 mg of dry sample was accurately weighed and placed in a centrifuge tube. Add 4.0 mL of pancreatic α-amylase working solution to a centrifuge tube, vortex to mix, and incubate in a shaking water bath at 37 ℃ for 16 h. After incubation, add 4.0 mL of anhydrous ethanol to terminate the reaction, centrifuge at 1500 g for 10 min, and discard the supernatant. Wash the precipitate twice with 50% ethanol, centrifuging at 1500 g for 10 min after each wash, discard the supernatant, and collect the precipitate. Place the centrifuge tube containing the precipitate in an ice-water bath, add 2 mL (2 mol / L) potassium hydroxide solution, and stir to fully dissolve the resistant starch; then add 8 mL (1.2 mol / L) sodium acetate buffer (pH 3.8) and mix well, then add 0.1 mL of amylase (AMG) solution, and incubate in a 50 ℃ water bath for 30 min (mixing several times during the process). After incubation, the reaction solution was centrifuged, and 0.1 mL of the supernatant was taken. 3.0 mL of GOPOD colorimetric working solution was added, and the mixture was incubated at 50℃ for 20 min. The absorbance was measured at 510 nm. Simultaneously, a standard curve was plotted using D-glucose standard solution for quantitative calculation. The calculation formula is as follows: Resistant starch content (g / 100g) = Corrected absorbance × Standard correction factor / Sample dry weight × Conversion factor.

[0020] (III) Genotyping and association analysis: The Wheat 660K SNP chip was used to perform whole-genome genotyping on 206 wheat materials. After obtaining SNP marker data, genome-wide association analysis (GWAS) was performed. Using −log10 P ≥ 3 as a threshold, sites significantly associated with resistant starch content were screened, and a stable associated SNP marker AX-110945017 was finally identified on the long arm of wheat chromosome 2A.

[0021] Further sequence analysis revealed that the SNP marker AX-110945017 has an A / G allele mutation at base 36, and its nucleotide sequence is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAAC[A / G]GAATTCTTTCTCGCCAACACGCGATCTGAGACAAGG; Correspondingly, they can be divided into the AA genotype with high resistant starch content and the GG genotype with low resistant starch content; The nucleotide sequence corresponding to the AA genotype is shown in SEQ ID No. 1, as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAACAGAATCTTTCTCGCCAACACGCGATCTGAGACAAGG; The nucleotide sequence corresponding to the GG genotype is shown in SEQ ID No. 2, as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAACGGAATCTTCTCGCCAACACGCGATCTGAGACAAGG.

[0022] Table 1. Correlation between SNP marker AX-110945017 polymorphism and grain resistant starch content. genotype Number of varieties Resistant starch content (%) AA 142 5.15±0.297 GG 53 5.03±0.294 Missing 11 - P-value AA / GG 0.0054 .

[0023] Example 2 Based on Example 1, considering that SNP markers can be used to detect and differentiate the content of resistant starch in wheat, and to facilitate their application in practical molecular breeding, the inventors further developed a corresponding KASP marker for this SNP marker. The specific primer set design is as follows: F1:5'-GAAGGTGACCAAGTTCATGCTGCATGCATTACACTTCCGTCCTGTA-3', F2: 5'-GAAGGTCGGAGTCAACGGATTGCATGCATTACACTTCCGTCCTGTG-3', R: 5'-TAGGCAGAGTGTGTCGTCCAGT-3'.

[0024] The genotypes of the aforementioned 206 wheat germplasms were detected and determined using the primer set described above. The specific operation method is as follows.

[0025] (a) DNA extraction: The leaf tissue of the wheat to be tested was used as a sample (leaf samples of wheat seedlings were collected and stored at -80℃ during the early planting process), and the genomic DNA of the leaves was extracted by CTAB method for later use.

[0026] (II) Fluorescent PCR amplification: Using the genomic DNA extracted and prepared in step (I) as a template, fluorescent PCR amplification was performed using the KASP label; the specific 5μL amplification system and reaction procedure are as follows: 2xPARMs Pro Mix, 2.5μL; Primer Mix, 0.7 μL; ddH2O, 0.8 μL; Template DNA, 1 μL; Reaction procedure: . (III) Identification and differentiation: Based on the PCR amplification results of step (II), the FAM and HEX fluorescence signal values ​​are read using a real-time PCR instrument to determine the genotype of the wheat to be tested. The specific determination criteria are as follows:

[0027] If only FAM fluorescence signal is detected and no HEX fluorescence signal is detected: it is determined to be a homozygous AA genotype, and this wheat is a high-resistant starch content germplasm. If HEX fluorescence signal is detected but no FAM fluorescence signal is detected: the genotype is identified as GG homozygous, and the wheat is a low-resistant starch content germplasm. If both FAM and HEX fluorescence signals are detected simultaneously, the genotype is determined to be AG heterozygous.

[0028] The specific determination results for the relevant wheat are shown in Table 4 below. A summary of the relevant test results is as follows: Figure 2 Analysis shows that the genotyping results based on this KASP marker are consistent with the results of resistant starch content, and can be used for preliminary determination of resistant starch content.

[0029] Overall statistical results show that wheat varieties with genotype AA account for approximately 68.9%, while those with genotype GG account for 25.7%. The resistant starch content in wheat grains with genotype AA ranges from 4.39% to 6.15%, while that of wheat with genotype GG ranges from 4.39% to 5.58%. This is generally consistent with the statistical results in Example 1. In other words, the KASP marker can be used to preliminarily and effectively identify the levels of resistant starch in different wheat germplasm materials.

[0030] Table 4. Genotypes and resistant starch content of the AX-110945017 marker in wheat association analysis populations. Sample number wheat variety name genotype Resistant starch content (%) 1 Changwu 135 GG 5.21 2 Shaanxi 229 AA 5.55 3 Xiao Yan No. 6 AA 5.08 4 Lantian No. 10 AA 5.07 5 Luohan No. 3 AA 5.36 6 Beijing 411 AA 5.46 7 Ningdong No. 1 AA 5.43 8 Mianyang 11 AA 5.23 9 Taishan No. 5 AA 6.15 10 Xinmai No. 13 AA 5.60 11 Xinmai No. 18 GG 5.31 12 Zhoumai No. 16 AA 4.82 13 Yuanfeng 139 AA 4.99 14 Fengchan No. 3 AA 5.16 15 Zhongyu No. 8 AA 4.90 16 160 farmers - 5.19 17 Lomai 21 AA 5.00 18 4110 AA 5.41 19 Handan 6172 AA 5.36 20 Huaimai 21 AA 5.79 21 Mianyang 26 AA 5.09 22 Round selection 715 AA 5.37 23 Yupi No. 1 AA 5.71 24 Xifeng No. 9 AA 5.25 25 Agricultural University 198 AA 5.08 26 Ke Dong 81 AA 5.23 27 Linfen No. 10 AA 4.73 28 Fengkang No. 5 AA 5.41 29 Changfeng No. 1 GG 5.00 30 Jingdong No. 1 AA 5.35 31 Jinmai 21 AA 5.05 32 Jimai 23 AA 4.97 33 Dry selection No. 10 AA 5.50 34 Xi'an Solid Wheat AA 4.77 35 Red wheat AA 5.15 36 Bima No. 1 AA 5.05 37 Dwarf Bull GG 5.08 38 Wenmai No. 6 GG 5.16 39 Grasshopper Wheat AA 5.11 40 Big Jade Flower GG 4.72 41 Leopard out of mountain GG 4.98 42 Large half-awn GG 4.82 43 White grasshopper AA 5.13 44 Ganmai No. 8 - 5.41 45 Yunmai No. 34 AA 5.03 46 May Day Wheat AA 5.49 47 Nanjing University 2419 AA 5.13 48 Nonglin No. 10 AA 4.88 49 Dryland wheat AA 5.81 50 Lovlin 10 GG 5.06 51 Aifeng No. 3 AA 4.76 52 Yunhan 618 AA 5.00 53 Tobacco farmer 21 AA 4.92 54 Jinmai 47 AA 5.19 55 Changwu 58 AA 5.06 56 Zhenghan No. 1 GG 5.08 57 6878 GG 5.15 58 Luohan No. 1 AA 5.02 59 Luohan No. 6 AA 5.12 60 Luohan No. 11 GG 5.09 61 Puxing No. 5 AA 5.35 62 Ruiquanmai 24 AA 5.12 63 Dehongfu No. 2 AA 5.00 64 Zhongmai 895 AA 4.88 65 Huaimai 35 AA 5.18 66 Longpingmai 518 GG 5.59 67 Huaimai 30 AA 4.91 68 Zhongyuan No. 6 AA 5.85 69 Ping An No. 8 AA 5.62 70 207 Bai Nong AA 5.08 71 Save No. 1 GG 5.15 72 Zhoumai 26 AA 5.42 73 Luomai 18 AA 5.01 74 Baofeng 10-82 AA 5.25 75 Su553 AA 4.54 76 09N37 GG 5.28 77 Guinong 17 - 5.04 78 Hengguan 35 AA 4.95 79 Yumai 18 AA 4.76 80 Yumai 13 AA 5.40 81 Yumai 47 AA 5.12 82 Zhengmai 004 AA 4.86 83 Yumai 50 GG 5.58 84 Space 6 GG 5.02 85 Flowering No. 5 AA 5.19 86 9987 AA 5.29 87 Henan Education No. 5 - 5.63 88 Henan Agricultural University 416 GG 5.38 89 Hundred Farmers 64 AA 4.82 90 Zhoumai No. 9 AA 5.16 91 Zhoumai 13 AA 5.18 92 Zhoumai 8425B GG 4.80 93 Open mic 21 AA 5.16 94 Luozhen No. 1 GG 4.76 95 Neixiang 188 AA 5.52 96 Dwarf 26-2 GG 5.13 97 Changge Black Grains GG 4.90 98 Green Wheat No. 1 AA 5.52 99 Subei Wheat No. 1 AA 5.43 100 Jinan 17 - 5.17 101 Jimai 20 AA 5.00 102 Shaanxi 225 AA 5.41 103 Northwest A&F University 979 AA 5.64 104 Baxter Australia AA 5.25 105 Australian CD87 GG 5.44 106 Australian Kukri AA 5.03 107 French wheat GG 5.42 108 Belero - 5.62 109 Fundulea900 GG 5.44 110 Tincurrin AA 5.30 111 H149 AA 5.49 112 French B08 - 4.75 113 French B20 AA 4.95 114 416 Bai Nong AA 5.27 115 Luo 31 GG 5.34 116 Taihe Wheat No. 1 AA 5.41 117 Junmai 35 AA 5.17 118 Loma 23 AA 5.44 119 Jiaomai 266 AA 4.48 120 Wen Nong No. 14 AA 5.38 121 Jimai 22 AA 5.36 122 Ningmai No. 9 AA 4.84 123 10EW28 - 5.53 124 10EW137 GG 4.94 125 18th of the week AA 4.73 126 04 out of 38 GG 5.06 127 Yumai 34-9901 GG 4.79 128 Zheng 9023-8 AA 5.33 129 Zheng 103 AA 4.87 130 Calingiri, Australia AA 4.69 131 Zhengmai 366 AA 4.39 132 Zhengmai 7698 AA 5.14 133 Zhoumai 22 GG 5.45 134 Zhoumai 27 AA 5.10 135 Zhoumai 30 AA 5.25 136 Zhoumai 32 AA 4.98 137 Liangxing66 AA 4.99 138 Emai 25 AA 5.13 139 Ningchun No. 5 AA 5.27 140 Shaanxi Agricultural 33 AA 4.71 141 Zhongmai 175 AA 5.41 142 Gaocheng 8901 - 4.77 143 Shannong Extra Large Grain No. 1 AA 4.78 144 Changmai No. 9 AA 5.04 145 Yangfumai No. 2 GG 4.92 146 Wanmai 53 GG 4.99 147 Panmai No. 8 AA 4.58 148 Yunmai 51 - 5.59 149 Yunmai 53 GG 4.87 150 Yunmai 47 GG 5.12 151 Northwest A&F University 928 GG 5.42 152 Xinmai 26 AA 5.53 153 Wanmai 47 AA 5.22 154 Yangmai 13 GG 5.36 155 Gaoyou 2018 AA 5.16 156 Gaoyou 9415 GG 4.60 157 Shi Luan 02-1 AA 5.80 158 Zheng 1005 AA 5.43 159 Zheng 1105 GG 4.95 160 Zheng 1118 - 4.51 161 Zheng 1289 AA 5.21 162 Zheng 3093 AA 5.50 163 March Yellow GG 4.75 164 Five-flower head GG 4.39 165 Bald Wheat GG 4.51 166 White spikes GG 4.41 167 Qu Mangmai GG 4.81 168 Zhengzhou No. 6 GG 4.42 169 Zheng Yin No. 1 AA 5.12 170 Select No. 7 AA 4.89 171 Double harvest AA 5.01 172 Zhengzhou No. 7 GG 4.94 173 Wan Changsui AA 4.75 174 cylinder AA 5.34 175 Longfumai No. 4 AA 5.24 176 Yizheng 8165 AA 5.14 177 Thai Morning No. 2 AA 4.99 178 Yumai 17 AA 5.36 179 Chuanmai 50 AA 4.62 180 Chuanmai 46 AA 4.82 181 Chuanmai 44 AA 5.00 182 Chuanmai 107 GG 5.34 183 Mianyang 35 AA 4.96 184 Zhengmai 101 AA 5.22 185 Zhengmai 518 AA 5.60 186 58 GG 4.99 187 Shan Nong 22 AA 5.11 188 Agricultural University (211) AA 5.17 189 Shan Nong 19 AA 4.72 190 Shannong 06-278 AA 4.82 191 Yangmai 18 AA 5.04 192 Ningmai 17 AA 4.96 193 Ningmai 13 GG 4.82 194 Zhenmai 168 AA 4.75 195 Yangmai 12 GG 5.12 196 Yangmai 14 AA 4.83 197 Huamai No. 5 GG 4.65 198 Yangmai 20 GG 4.98 199 Yangmai 21 AA 4.90 200 Zhengmai 379 AA 5.52 201 Zhengmai 05706 AA 5.26 202 Zhengmai 113 GG 4.93 203 Zhengmai 369 AA 5.34 204 Zhengmai 05871 AA 4.99 205 Xinmai 19 GG 5.21 206 Shan Nong 26 AA 5.49 .

Claims

1. A marker for detecting the major gene qRS-2A of resistant starch content in wheat, characterized in that, The linkage marker is a SNP marker AX-110945017, which is located on the long arm of chromosome 2A. The nucleotide sequence of the SNP marker is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAAC[A / G]GAATTCTTTCTCGCCAACACGCGATCTGAGACAAGG; Its 36th base is an A / G allele, therefore, it is divided into two types: the AA genotype with high resistant starch content and the GG genotype with low resistant starch content. The nucleotide sequence of the AA genotype is shown in SEQ ID No. 1, and is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAACAGAATCTTTCTCGCCAACACGCGATCTGAGACAAGG; The nucleotide sequence of the GG genotype is shown in SEQ ID No. 1, and is as follows: GTGGAGTATCGGGTTAGATACAATACTGAGGAAACGGAATCTTCTCGCCAACACGCGATCTGAGACAAGG.

2. The application of the wheat grain resistant starch content linkage marker as described in claim 1 in wheat breeding, characterized in that, The linkage markers are associated with wheat resistant starch content; wheat with the AA genotype has high resistant starch content, while wheat with the GG genotype has low resistant starch content.

3. The detection method using KASP markers for the chain markers described in claim 1, characterized in that, The KASP marker is a set of primers for PCR amplification, and the primer sequences are designed as follows: F1:5'-GAAGGTGACCAAGTTCATGCTGCATGCATTACACTTCCGTCCTGTA-3', F2: 5'-GAAGGTCGGAGTCAACGGATTGCATGCATTACACTTCCGTCCTGTG-3', R: 5'-TAGGCAGAGTGTGTCGTCCAGT-3'.

4. The application of the KASP marker in wheat breeding, characterized in that, KASP markers were used to distinguish wheat germplasm with high resistant starch content (AA genotype) from wheat germplasm with low resistant starch content (GG genotype).

5. The method for detecting the KASP-labeled resistant starch content in wheat according to claim 3, characterized in that, Includes the following steps: (a) Extracting DNA Genomic DNA was extracted from the leaf tissue of the wheat to be tested for later use. (II) PCR amplification Using the genomic DNA extracted and prepared in step (I) as a template, PCR amplification was performed using the KASP marker; (III) Identification and Differentiation Based on the PCR amplification results of step (II), the genotype of the wheat to be detected is determined. If it is the AA genotype, then the wheat to be tested is a germplasm with high resistant starch content; If the genotype is GG, then the wheat to be tested is a germplasm with low resistant starch content.

Images