Improved efficiency of haploid editing
By utilizing haploid induction technology and heat treatment combined with DNA-modifying enzymes in plants, the problem of long gene editing time in existing technologies has been solved, achieving efficient genome editing and producing homozygous breeding lines in just two generations.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SYNGENTA CROP PROTECITON AG
- Filing Date
- 2024-12-20
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies struggle to efficiently and stably integrate exogenous DNA into the genomes of most plant lines, especially superior inbred lines, resulting in a complex and time-consuming transformation process that typically takes three to seven years to gradually infiltrate transgenic traits into inbred lines.
By using haploid induction technology in plants such as corn or wheat, combined with DNA modifying enzymes and guide nucleic acids, and using heat treatment to improve editing efficiency, haploid offspring are produced, and double haploids are formed through chromosome doubling agents, thus achieving genome editing.
It significantly shortens the time required for gene editing, enabling the production of homozygous breeding lines in just two generations, thus improving the efficiency and speed of gene editing.
Smart Images

Figure CN122319239A_ABST
Abstract
Description
Cross-reference to related applications
[0001] This application claims priority to Patent Cooperation Treaty (PCT) application No. PCT / CN2023 / 140616, filed on December 21, 2023. The entire contents of that application are incorporated herein by reference for all purposes. Technical Field
[0002] This invention relates to the field of plant biotechnology, specifically agricultural biotechnology and gene editing, as well as plant breeding. The subject matter of this disclosure relates to the use of haploid inducible lines (whether existing or created) and the transformation of such haploid inducible lines to contain DNA encoding a cellular molecular system (machinery) capable of editing genes. sequence list
[0003] This application includes a sequence list in XML format entitled 83020-WO-REG-ORG-P-1.xml, created on December 2, 2024. The XML file is approximately 209 kilobytes in size and is submitted with this specification. The sequence list contained in the XML file is part of this specification and is incorporated herein by reference in its entirety. Background Technology
[0004] For decades, plant transformation (i.e., the stable integration of exogenous DNA (“transgenic”) into a plant genome) has been used to add new, useful traits to crops. While some plant lines (e.g., maize) are relatively easy to transform (i.e., accept transgenic DNA), most lines are not. For example, most superior inbred lines (which are produced through several generations of self-pollination to obtain a pure or near-pure homozygous genome and used as parent lines to produce commercially valuable hybrids) are typically not transformable with exogenous DNA. Therefore, in order to introduce transgenic traits into inbred lines, the transgenic traits must first be transformed into a transformable maize line. For example, in maize, such a transformed maize line is rarely suitable for use as a parent line in a breeding platform. Therefore, the transformed maize line is hybridized into an inbred line to produce offspring plants that will contain the genomes of both the inbred and transformed parents in a heterozygous manner. Then, the offspring plants containing the transgene must be backcrossed into inbred lines for about six or seven generations in order to eliminate as much of the genome contributed by the transforming parent as possible while retaining the transgene trait. This introgression process typically takes three to seven years.
[0005] A crucial tool in plant breeding is haploid induction (HI), a plant phenomenon characterized by the loss of a set of chromosomes from one parent (i.e., the chromosomes of the haploid induction line parent) in the embryo during or some time after fertilization. The loss of a set of chromosomes typically occurs during early embryonic development. Haploid induction is also known as monogyny if the induction line is used as the male parent in a hybridization, or monoandry if the induction line is used as the female parent. HI has been studied in numerous plant species, such as sorghum, barley, wheat, maize, Arabidopsis, and many others. Haploids are valuable when they are doubled (called double haploid (DH) plants) and used to produce homozygous breeding lines. In homozygous lines, all genes on every pair of chromosomes are identical in every cell of the plant. These homozygous lines are 100% self-pollinating lines that would otherwise have to be produced through repeated forced self-pollination. The haploid method allows breeders to generate inbred lines in just two generations, whereas traditional breeding requires 10 generations. In corn, the most efficient way to generate double haploids is through haploid induction.
[0006] In maize, haploid seeds or embryos can be produced by crossing a haploid inducing line paternal parent (i.e., "haploid inducing line pollen") with virtually any ear of choice. In the case of a maternal HI system (e.g., a maternally based system), haploids are produced when the haploid inducing line pollen DNA (i.e., the haploid inducing line paternal DNA) is not fully transmitted and / or maintained through the first cell division of the embryo. The resulting kernels have a haploid embryo containing only maternal DNA plus a normal (fertilized) triploid endosperm. In the case of a paternal HI system (e.g., a CENH3-based or ig1-based system), haploids are produced when, after fertilization of the egg cell with a sperm cell, the maternal chromosome is lost during cell division. The resulting kernels have a haploid embryo containing only paternal DNA plus a normal (fertilized) triploid endosperm. Regardless of the HI system used, the resulting phenotype is not fully penetrating; some ovules contain haploid embryos, while others contain diploid, aneuploid, chimeric, or aborted embryos. Following haploid induction, haploid embryos or seeds are typically isolated from diploid and aneuploid sister plants using phenotypic or genetic marker screening, and then allowed to grow or be cultured into haploid plants. These plants are then naturally or chemically transformed into double haploid (DH) plants using anti-microtubule agents such as colchicine, acetylene-methyl, flusulfanilamide, or trifluralin, which then produce self-pollinated seeds. Summary of the Invention
[0007] This summary is provided to introduce the concept choices further described below in the detailed description. This summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to help limit the scope of the claimed subject matter.
[0008] In one aspect, a method for editing plant genomic DNA is provided, the method comprising (a) providing an egg cell donor plant containing plant genomic DNA to be edited; (b) pollinating the egg cell donor plant with a pollen donor plant, wherein the pollen donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid; (c) subjecting the pollinated egg cell donor plant of step b to a heat treatment; and (d) producing at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor haploid inducing line plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the pollen donor haploid inducing line plant.
[0009] On the other hand, a method for editing plant genomic DNA is provided, the method comprising: (a) providing a pollen donor plant expressing a DNA-modifying enzyme and optionally a guide nucleic acid; (b) subjecting pollen from the pollen donor plant to heat treatment; (c) pollinating an egg cell donor plant with the heat-treated pollen from the pollen donor plant, wherein the egg cell donor plant contains plant genomic DNA to be edited; and (d) producing at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the pollen donor plant.
[0010] In some embodiments of these methods, the pollen donor plant is a haploid inducible line. In some embodiments, the pollen donor plant is a paternal haploid inducible line. In some embodiments, the paternal haploid inducible line contains a knockout mutation in the MATL gene.
[0011] On the other hand, a method for editing plant genomic DNA is provided, the method comprising: (a) providing a pollen donor plant containing plant genomic DNA to be edited; (b) pollinating an egg cell donor plant with pollen from the pollen donor plant, wherein the egg cell donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid; (c) subjecting the pollinated egg cell donor plant of step b. to heat treatment; and (d) producing at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the pollen donor plant and does not contain the genome of the egg cell donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the egg cell donor plant.
[0012] A method for editing plant genomic DNA, the method comprising: (a) providing a pollen donor plant containing plant genomic DNA to be edited; (b) subjecting pollen from the pollen donor plant to heat treatment; (c) pollinating an egg cell donor plant with the heat-treated pollen from the pollen donor plant, wherein the egg cell donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid; and (d) producing at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the pollen donor plant and does not contain the genome of the egg cell donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the egg cell donor plant.
[0013] In some embodiments of these methods, the egg cell donor plant is a haploid induction line. In some embodiments, the egg cell donor plant is a maternal haploid induction line. In some embodiments, the maternal haploid induction line contains a mutation in the CENH3 gene. In some embodiments, the maternal haploid induction line is heterozygous for the mutation in the CENH3 gene.
[0014] In embodiments of the provided method, at least one of the egg cell donor plant or the pollen donor plant is a maize plant. In some embodiments, the pollen donor plant is a maize plant. In some embodiments, the egg cell donor plant is a maize plant. In some embodiments, the egg cell donor plant is a wheat plant.
[0015] In some embodiments, the pollen donor plant is a maize plant. In some embodiments, the maize plant is selected from and / or derived from strains Stock 6, RWK, RWS, UH400, NP2222RS, or NP2222.
[0016] In some embodiments, the DNA-modifying enzyme is a site-directed nuclease selected from the group consisting of meganucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and Cas nucleases. In some embodiments, the Cas nuclease is a type II Cas nuclease, a type IV Cas nuclease, or a type V Cas nuclease. In some embodiments, the type II Cas nuclease is a Cas9 nuclease, a Cas9 nickase, a nuclease-free Cas9, or a Cas9 fused with a heterologous domain. In some embodiments, the type V Cas nuclease is a Cas12a nuclease, a Cas12a nickase, a nuclease-free Cas12a, or a Cas12a fused with a heterologous domain. In some embodiments, the guiding nucleic acid is guiding RNA.
[0017] In some embodiments, haploid progeny are treated with a chromosome doubling agent to produce edited double haploid progeny. In some embodiments, the chromosome doubling agent is colchicine, acetylenesulfonamide, flusulfanilamide, trifluralin, or other known antimicrotubule agents.
[0018] In some embodiments, the pollen donor plant expresses a marker gene. In some embodiments, the marker gene is selected from the group consisting of: R1, R1-SCM2, R1-nj, GUS, PMI, PAT, GFP, RFP, CFP, B1, CI, anthocyanins, and any other marker gene.
[0019] On the other hand, edited haploid plants produced by any of the methods disclosed herein are provided.
[0020] On the other hand, progeny plants of edited haploid plants produced by any of the methods disclosed herein are provided. Attached Figure Description
[0021] Figure 1 A- Figure 1 B shows a confocal microscope image of corn pollen grains stained with DAPI DNA staining agent. Figure 1 A shows a control pollen grain with typical sperm pair morphology (i.e., long, thin, and filamentous). Figure 1 B shows a pair of sperm cells after heat treatment at 45°C for one hour. The sperm cells exhibit diffuse staining, broadened shape, and larger overall size. A brief description of sequences in a sequence list.
[0022] SEQ ID NO: 1 is the nucleotide sequence encoding construct 27145.
[0023] SEQ ID NO: 2 is the nucleotide sequence encoding construct 27146.
[0024] SEQ ID NO: 3 is the nucleotide sequence encoding construct 27680.
[0025] SEQ ID NO: 4-6 represent TaqMan® quantitative PCR assay 3895, using primers TCTTGTTCCGTCTTTTGCAG (SEQ ID NO: 4) and AAGGCAAAAGGAGGGAACTGAT (SEQ ID NO: 5) and probe TACCTCGGCGACGCC (SEQ ID NO: 6).
[0026] SEQ ID NO: 7 is an exemplary MATL variant cDNA nucleotide sequence.
[0027] SEQ ID NO: 8 is an exemplary CENH3 variant DNA nucleotide sequence.
[0028] SEQ ID NO: 9 is the nucleotide sequence encoding construct 28255.
[0029] SEQ ID NO: 10 is the nucleotide sequence encoding construct 28291.
[0030] SEQ ID NO: 11 is the nucleotide sequence encoding construct 28292.
[0031] SEQ ID NO: 12 is the nucleotide sequence encoding construct 28293.
[0032] SEQ ID NO: 13 is the nucleotide sequence encoding construct 28294.
[0033] SEQ ID NO: 14 is the nucleotide sequence encoding construct 25072.
[0034] SEQ ID NO: 15 is the nucleotide sequence encoding construct 28825.
[0035] SEQ ID NO: 16 is the nucleotide sequence encoding construct 28834. Detailed Implementation I. Terminology
[0036] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to techniques used herein are intended to refer to techniques commonly understood in the art, including variations and / or equivalents of those techniques that are readily apparent to one of ordinary skill in the art. While it is believed that the following terms will be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate the interpretation of the subject matter disclosed herein.
[0037] Unless otherwise specified, the singular forms “a / an” and “the” used herein include plural referents. Thus, for example, references to “antibody” may optionally include combinations of two or more such molecules.
[0038] As used herein, the term “about” refers to a commonly known range of error for the corresponding value that is readily known to those skilled in the art, such as ±20%, ±10%, or ±5% within the intended meaning of the listed value.
[0039] As used herein, the term “comprising” or “comprise” is open-ended. When used in conjunction with a subject nucleic acid (or amino acid sequence), it refers to a nucleic acid sequence (or amino acid sequence) that includes the subject sequence as a part or as its entire sequence.
[0040] The term "multiple" means more than one entity. Therefore, "multiple individuals" means at least two individuals. In some embodiments, the term "multiple" means more than half of a whole. For example, in some embodiments, "multiple in a group" means more than half of the members of that group.
[0041] As used herein, the term “and / or” when used in the context of enumerating entities refers to entities existing individually or in combination. Thus, for example, the phrase “A, B, C and / or D” includes A, B, C, and D individually, but also any and all combinations and sub-combinations of A, B, C, and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD, and BCD). In some embodiments, one or more elements referred to by “and / or” may also exist individually in one or more occurrences in one or more combinations and / or one or more sub-combinations.
[0042] The term "HI-editing efficiency" refers to a measurement of progeny plants produced by HI-editing hybridization that are both edited and haploid (or, if doubled, were haploid before doubling). "HI-editing efficiency," "haploid editing rate," "HI-editing rate," and "HER" are used interchangeably throughout. HI-editing efficiency is usually expressed as a percentage.
[0043] The "HI-edit window" refers to the period of time during which editing can take place before genome elimination, typically from several hours to three days after pollination. This timeframe is not precisely fixed, and environmental and biological factors (such as pollen viability) can influence the duration and / or start time of the HI-edit window.
[0044] "Heat treatment" refers to any treatment applied to plants, greenhouses, or corn ears aimed at raising their temperature. In one example ("greenhouse warming treatment"), heat treatment maintains the greenhouse temperature at 35°C during the day and 25°C at night. In a second example ("heat pack treatment"), heat treatment may be performed using a heat pack.
[0045] As used herein, a “heating pack” refers to a device that generates heat, whether through an exothermic chemical reaction (e.g., therapeutic heating patches) (see, for example, THERMACARE® Muscle Pain Therapy HeatWraps (thermacare.com / heat-wraps / muscle-pain-therapy, last accessed August 15, 2023)) or through resistance (e.g., electric blankets) (see, for example, CONAIRCOMFORT® Standard Heating Pad (conair.com / en / standard-heating-pad / HP40.html, last accessed August 15, 2023)). The heating pack is wrapped around the plant or the site on the plant where haploid induction has occurred. For example, for corn plants, the heating pack is typically wrapped around the ear (with optional insulation) to maintain the ear temperature at approximately 30°C–40°C. Other heat sources may also be used. Insulation may include wool, fiberglass, etc.
[0046] The term "haploid inducing line" or "haploid inducing line strain" refers to a plant strain that triggers the development of pollinated oocytes into embryos containing only a haploid genome (i.e., induces the formation of haploid offspring). Offspring produced by hybridization with a haploid inducing line strain lack the haploid inducing line genome. A haploid inducing line can be a pollen donor haploid inducing line or an oocyte donor haploid inducing line. A haploid inducing line can be a paternal haploid inducing line or a maternal haploid inducing line. A "haploid inducing line plant" is a haploid inducing line strain plant. An example of a haploid inducing line plant is a maize plant containing a mutation in the ZmMATL gene. Another example is a maize plant containing a mutation in the CENH3 gene. Yet another example is a maize plant with wild-type MATL and CENH3 used for distant hybridization to pollinate wheat plants. Haploid inducing line plants are not limited to maize and are used herein for illustrative purposes only.
[0047] As used in this article, the term "distant hybridization" refers to the process of hybridization in which one parent originates from outside the direct gene pool of the other parent. Distant hybridization can refer to hybridization between two different species or genera and can be used for gene transfer and the creation of new crop species.
[0048] As used herein, the term "plant" can refer to the whole plant at any stage of development or any part or component of a plant; and includes cell or tissue cultures derived from a plant. Thus, for example, "plant" can refer to components or organs such as leaves, stems, roots, plant tissues, seeds, and / or plant cells.
[0049] As used herein, the term "plant cell" refers to the structural and physiological unit of a plant, including the protoplast and cell wall. Plant cells can exist as isolated single cells or cultured cells, or as part of higher tissue units (such as plant tissues, plant organs, or the whole plant). Plant cells can be derived from or are part of angiosperms or gymnosperms. Plant cells can be monocotyledonous cells (e.g., corn cells, rice cells, sorghum cells, sugarcane cells, barley cells, wheat cells, oat cells, turfgrass cells, or ornamental grass cells) or dicotyledonous cells (e.g., tobacco cells, pepper cells, eggplant cells, sunflower cells, cruciferous plant cells, flax cells, potato cells, cotton cells, soybean cells, sugar beet cells, or oilseed rape cells).
[0050] As used herein, the term "plant cell culture" refers to a culture of plant units, such as protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at different developmental stages.
[0051] "Plant organs" are unique and distinct structured and differentiated parts of a plant, such as roots, stems, leaves, flower buds, or embryos.
[0052] As used herein, the term "plant tissue" refers to a group of plant cells organized into structural and functional units. This includes any plant tissue in or cultured. The term includes, but is not limited to, the whole plant, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into structural and / or functional units. The use of this term in conjunction with (or in the absence of) any particular type of plant tissue listed above, or in other ways covered by this definition, is not intended to exclude any other type of plant tissue.
[0053] As used herein, the term "plant part" refers to a portion of a plant, including single-celled and cellular tissues (e.g., intact plant cells), cell masses, and tissue cultures that can regenerate plants. Examples of plant parts include, but are not limited to, single-celled and cellular tissues derived from: pollen, ovules, zygotes, leaves, embryos, roots, root tips, anthers, flowers, floral parts, fruits, stems, buds, cuttings, and seeds; as well as pollen, ovules, egg cells, zygotes, leaves, embryos, roots, root tips, anthers, flowers, floral parts, fruits, stems, buds, cuttings, scions, rhizomes, seeds, protoplasts, callus, etc.
[0054] The term "variety" or "cultivar" refers to a group of similar plants that can be distinguished from other varieties within the same species by structural or genetic characteristics and / or phenotypes.
[0055] As used herein, the terms “offspring,” “offspring plant,” and “offspring” refer to plants produced by vegetative or sexual reproduction of one or more parent plants. The term “offspring” can refer to any derived offspring of a particular hybrid or parent plant. Typically, offspring plants are produced by breeding two individuals, but some species (particularly some plants and hermaphroditic animals) can be produced through self-fertilization or cloning (i.e., the same plant acts as a donor for both male and female gametes). One or more derived offspring can be, for example, F1, F2, or any subsequent generations. In some embodiments, “offspring” plants are produced by HI-editing or thermal editing methods.
[0056] As used herein, the term "event" refers to a recombinant plant resulting from genetic modification of a plant cell or tissue and the regeneration of said plant cell or tissue. Examples of events include gene editing events, such as gene editing via site-directed nuclease (SDN); and transformation events having an expression cassette containing the target gene. The term "event" also refers to the original modified plant (by gene editing, transformation, or other methods) and / or the progeny of the original modified plant containing the genetic modification. The term "event" also refers to the progeny produced by sexual crossbreeding of a modified plant with another plant line, wherein the progeny contains the genetic modification. Even after repeated backcrossing with a recurrent parent, the modified DNA from the transforming parent or the insert DNA from the transforming parent with flanking DNA is present at the same chromosomal location in the hybrid progeny. In the case of a transgenic event, the term "event" also refers to DNA from the original transformant containing (1) the insert DNA and (2) a flanking genomic sequence immediately adjacent to the insert DNA, which is intended to be transferred to the progeny receiving the insert DNA. Inserted DNA refers to a targeted transgene resulting from sexual hybridization of a parental line containing inserted DNA (e.g., a primitive transformant and its self-pollinated progeny) with a parental line not containing inserted DNA. Typically, transformation of plant tissue produces multiple events, each representing the insertion of a DNA construct into a different location in the plant cell genome. Specific events are selected based on transgene expression, the absence of harmful effects, or other desired characteristics.
[0057] The term "trait introgression" or "introgression" refers to the incorporation of a desired trait into an existing plant line (also known as a "superior" or "self-pollinated" line; these lines possess stable genetic characteristics and are nearly homozygous on their chromosomes). Introgression involves transferring genetic material from a donor line to an existing (i.e., recipient) superior line, so that the benefits of the trait are integrated into the existing superior germplasm. This is achieved by backcrossing plant offspring with their self-pollinated parents for multiple generations, selecting for the desired trait.
[0058] Plants referred to as “haploids” in this article have a reduced number of chromosomes (n), and their chromosome set is equal to that of the gametes. In haploid organisms, only half the normal number of chromosomes is present. Therefore, haploid (2n) organisms (e.g., maize) exhibit haploidity (1n); tetraploid (4n) organisms (e.g., ryegrass) exhibit diploidity (2n); hexaploid (6n) organisms (e.g., wheat) exhibit triploidity (3n); and so on.
[0059] Plants referred to here as "double haploids" are produced by doubling the set of haploid chromosomes. Plants or seeds obtained from double haploid plants through self-pollination to any generation can still be identified as double haploid plants. Double haploid plants are considered homozygous plants. If a plant is fertile, it is considered double haploid even if the entire vegetative part of the plant is not composed of cells with doubled chromosome sets; that is, if the plant contains living gametes, it will be considered double haploid even if the plant is chimeric in its vegetative tissue.
[0060] The term "quantitative trait locus" or "QTL" refers to a region of DNA associated with a specific phenotypic trait, that is, a phenotype that can be measured numerically and varies in degree, and which can be attributed to a polygenic effect, i.e., the product of two or more genes and their environment. Typically, QTLs are the basis for continuous traits (those traits that vary continuously, such as haploid induction rate) rather than qualitative (i.e. discrete) traits.
[0061] The term "one or more alleles" refers to any one of one or more alternative forms of a gene, where all alleles relate to at least one trait or characteristic. In diploid cells, the two alleles of a given gene occupy corresponding loci on homologous chromosome pairs. In some cases (e.g., for QTLs), it is more accurate to refer to "haplotype" (i.e., alleles of a chromosomal segment) rather than "allele." However, in those cases, the term "allele" should be understood to include the term "haplotype." If two individuals (e.g., two plants) have the same alleles at a particular locus, and these alleles are inherited from a common ancestor (i.e., these alleles are copies of the same parental alleles), then these alleles are called "homologically identical." An alternative is "state-identical" alleles, i.e., alleles that appear identical but are derived from two different copies of the allele. Homologous identity information can be used in linkage studies; both homologous identity and homomorphic identity information can be used in association studies, although homologous identity information may be particularly useful.
[0062] The term "haploid" can refer to the set of alleles inherited from a single parent in an individual. Therefore, a diploid individual has two haploids. The term "haploid" can also be used in a more limited sense to refer to physically linked and / or unlinked genetic markers (e.g., sequence polymorphism) associated with a phenotypic trait. The phrase "haploid block" (sometimes simply referred to as haploid in the literature) refers to a group of two or more genetic markers that are physically linked on a single chromosome (or a portion thereof). Typically, each block has several common haploids, and a subset of the genetic markers (i.e., "haploid tags") can be selected to uniquely identify each of these haploids.
[0063] The term “genotype” and its variants refer to the genetic components of an organism, including, for example, whether a diploid organism is heterozygous (i.e., has two distinct alleles for a given gene or QTL) or homozygous (i.e. has the same alleles for a given gene or QTL) for one or more genes or loci (e.g., SNPs, haplotypes, gene mutations, insertions, or deletions).
[0064] Within the scope of this disclosure, “phenotype” should be understood as one or more distinguishable characteristics of a trait controlled by genes. The phrase “phenotypic trait” refers to an individual’s appearance or other detectable characteristic resulting from the interaction between the individual’s genome and the environment.
[0065] As used herein, when identifying the presence / absence of a locus, the term "marker" can be used to refer to a genetic marker as defined above, or its coding product (e.g., a protein) used as a reference point. Markers can be derived from genomic nucleotide sequences or expressed nucleotide sequences (e.g., derived from RNA, cDNA, etc.). The term also refers to nucleotide sequences complementary to or flanking the marker sequence, such as nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence. These nucleotide sequences are "complementary" (e.g., according to the Watson-Crick base pairing principle) when they specifically hybridize in solution. The term "marker" also refers to a genetic marker indicating a trait by the absence of a nucleotide sequence complementary to or flanking the marker sequence (such as nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence).
[0066] The term “marker-based selection” is understood within the scope of this disclosure to refer to the use of genetic markers to detect one or more nucleic acids in a plant that are associated with a desired trait in order to identify plants carrying genes for the desired (or undesirable) trait, so that those plants can be used (or avoided) in, for example, transformation or selective breeding programs.
[0067] The terms “testester” or “testester plant” should be understood within the scope of this disclosure as referring to a plant used to genetically characterize traits in a test plant. Typically, the test plant is crossed with a testester plant, and the segregation rate of traits in the hybrid offspring is scored. The term “testester” can also refer to a line or individual with a standard genotype, known characteristics, and established performance. A “testester parent” refers to an individual derived from a testester line that is used as a parent in sexual hybridization. Typically, the testester parent is unrelated to the individual it is hybridized with and is genetically distinct. Testesters are typically used to produce F1 offspring when crossed with individuals or inbred lines for phenotypic evaluation.
[0068] The term "seed set" refers to a measure of the portion of the maize ear that produces the embryo (i.e., kernel or seed). Seed set can be expressed qualitatively (e.g., low, good, or high) or quantitatively. In quantitative measurements, the measurement can be given as a percentage or as the number of seeds per ear. The term typically refers to the percentage or number of normal kernels (i.e., non-abortive kernels with endosperm viability). For normal maize lines (i.e., not haploid inducing lines), a seed set of more than 80% (or more than 300 kernels per ear) is considered good. For haploid inducing lines, seed set tends to be lower; a seed set of more than 50% (e.g., more than 60%, more than 70%, or more than 80%) or more than 180 (e.g., more than 200, more than 220, more than 260, or more than 280) kernels per ear is generally considered high.
[0069] A "gene" is a defined region located within the genome that, in addition to encoding nucleic acid sequences, may include other sequences, such as regulatory sequences responsible for controlling the expression (i.e., transcription) and translation of the coding portion (where proteins are produced by the gene). A gene may include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions). Genes typically express mRNA, functional RNA, or specific proteins, including regulatory sequences. A gene may or may not be used to produce functional proteins. In some embodiments, a gene refers only to the coding region. The term "natural gene" refers to a gene as found in nature.
[0070] Genes can be “isolated,” meaning that the nucleic acid molecule contains, substantially or essentially, no components associated with nucleic acid molecules typically found in their native state. Such components include other cellular material, culture media from recombinant production, and / or various chemicals used in the chemical synthesis of nucleic acid molecules. “Isolated” does not necessarily mean that the preparation is industrially pure (homogeneous), but rather that it is pure enough to provide nucleic acids in a form suitable for the intended purpose.
[0071] Therefore, an "isolated" nucleic acid molecule is a nucleic acid molecule or nucleotide sequence that is not adjacent to a nearby nucleotide sequence (either at the 5' end or the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are adjacent to the coding sequence. Therefore, the term includes, for example, recombinant nucleic acids that are integrated into a vector, a self-replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or that exist as a separate molecule independent of other sequences (e.g., a fragment of cDNA or genomic DNA produced by PCR or restriction endonuclease treatment). It also includes recombinant nucleic acids that are portions of hybrid nucleic acid molecules encoding additional RNA or polypeptide sequences. "Isolated" nucleic acid molecules can also include polynucleotides that are derived from the same native cell type and inserted therein, but exist in a non-native state, for example, in a different copy number, and / or under the control of regulatory sequences that are different from those found in the native state of nucleic acid molecules.
[0072] The terms “nucleic acid” and “polynucleotide” are used interchangeably and, as used herein, refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form and polymers thereof, and to both sense and antisense strands of RNA, cDNA, genomic DNA, mitochondrial DNA, and synthetic forms and mixtures thereof. In higher plants, DNA is the genetic material, while RNA is involved in the transfer of information contained within DNA to proteins. A “genome” is the total genetic material contained in every cell of an organism. It should be understood that when RNA is described, its corresponding cDNA is also described, where uridine is represented as thymidine. In particular embodiments, a nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of any type of nucleotide or a combination thereof. Additionally, the polynucleotides disclosed herein may include any or both of naturally occurring nucleotides and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide bonds. Nucleic acid molecules may be chemically or biochemically modified, or may contain non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, tagging, methylation, substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonate, triphosphate, aminophosphate, carbamate, etc.), charged linkages (e.g., thiophosphate, dithiophosphate, etc.), side moieties (e.g., polypeptides), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents, alkylating agents, and modified linkages (e.g., α-anomeric nucleic acids, etc.). The above terms are also intended to include any topological conformation, including single-stranded, double-stranded, partially double-stranded, triple-stranded, hairpin-shaped, circular, and padlock-shaped conformations. Unless otherwise stated, references to nucleic acid sequences cover their complements. Therefore, references to nucleic acid molecules having a specific sequence should be understood to cover their complementary strands having their complementary sequences. Nucleotide sequences are “complementary” (e.g., according to the Watson-Crick base pairing principle) when they specifically hybridize in solution. The term also includes codon-optimized nucleic acids encoding the same polypeptide sequence. It should also be understood that nucleic acids can be unpurified, purified, or attached to, for example, synthetic materials (such as bead or column matrices).
[0073] As used herein, the term “promoter” refers to a nucleotide sequence, typically upstream (5') of its coding sequence, that controls the expression of the coding sequence by providing recognition of RNA polymerases and other factors required for proper transcription. “Promoter regulatory sequences” consist of proximal and more distal upstream elements. Promoter regulatory sequences affect transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, untranslated leader sequences, introns, and polyadenylation signal sequences. These include native and synthetic sequences, as well as sequences that may be combinations of synthetic and native sequences. An “enhancer” is a DNA sequence that can stimulate promoter activity and can be an intrinsic element of the promoter or an inserted heterologous element to enhance the promoter’s level or tissue specificity. It is capable of operating in both orientations (normal or inverted) and can function even when moved upstream or downstream of the promoter. The term “promoter” includes the meaning of “promoter regulatory sequences.”
[0074] As used herein, the term "primer" refers to an oligonucleotide that, when placed under conditions inducing primer extension product synthesis (e.g., in the presence of nucleotides and reagents for polymerization, such as DNA polymerase, and at suitable temperature and pH), is capable of annealing to a nucleic acid target (specifically annealing to a nucleic acid target in some embodiments) to allow DNA polymerase and / or reverse transcriptase to attach thereto, thereby serving as a starting point for DNA synthesis. In some embodiments, one or more primers are used to amplify plant nucleic acids (e.g., using polymerase chain reaction or PCR).
[0075] As used herein, in the context of nucleic acid sequences, the term “reference sequence” refers to a defined nucleotide sequence that serves as the basis for comparison of nucleotide sequences.
[0076] As used in this disclosure, in the context of nucleic acid sequences, the term "corresponds" means that, when two sequences are best aligned, certain positions or regions of the target nucleotide sequence align with those positions or regions of the reference sequence, but the position numbers of the two sequences are not necessarily precisely aligned. While best alignment and scoring can be performed manually, the process can be facilitated by computer-implemented alignment algorithms. Easily available sequence comparison and multiple sequence alignment algorithms include the Basic Local Alignment Search Tool (BLAST) and the ClustalW / ClustalW2 / Clustal Omega programs, which are available on the Internet (e.g., the EMBL-EBI website). Other suitable programs include, but are not limited to, GAP, BestFit, PlotSimilarity, and FASTA, which are part of the Accelrys GCG software package available from Accelrys Inc. (San Diego, California, USA). See also Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; Ausubel et al., 1988; and Sambrook and Russell, 2001.
[0077] One example of an algorithm suitable for determining percentage sequence identity and sequence similarity is the BLAST algorithm, described in Altschul et al., 1990. In some embodiments, the percentage of sequence identity refers to sequence identity across the full length of a nucleic acid or polypeptide sequence.
[0078] Unless otherwise specified, a particular nucleic acid sequence also implicitly includes variants of its conserved modifications (e.g., degenerate codon substitutions in sequences encoding proteins), alleles, SNPs and complementary sequences, as well as explicitly specified sequences.
[0079] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. As used herein, these terms cover amino acid chains of any length, including full-length proteins, where amino acid residues are linked by covalent peptide bonds.
[0080] As used in the context of polynucleotide or polypeptide sequences described herein, the term "identity" or "substantial identity" refers to a sequence having at least 60% sequence identity with a reference sequence. Alternatively, the identity percentage can be any integer from 60% to 100%. Exemplary embodiments include: using the procedure described herein, preferably with standard parameters, a BLAST compared to a reference sequence, at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. Those skilled in the art will recognize that these values can be appropriately adjusted by taking into account codon degeneracy, amino acid similarity, reading frame positioning, etc., to determine the corresponding identity of proteins encoded by two nucleotide sequences.
[0081] For sequence comparisons, typically one sequence serves as a reference sequence to be compared with the test sequence. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, with subsequence coordinates specified if necessary, and the sequence algorithm program parameters specified. Default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percentage of sequence identity between the test sequence and the reference sequence based on the program parameters.
[0082] As used herein, a “comparison window” includes a segment that refers to any of the number of consecutive positions selected from groups of 20 to 600, typically about 50 to about 200, and more typically about 100 to about 150, wherein, after optimal alignment of two sequences, the sequence can be compared with a reference sequence having the same number of consecutive positions. The sequence alignment methods used for comparison are well known in the art. The optimal alignment of sequences for comparison can be performed in the following ways: local homology algorithm by Smith and Waterman Add. APL. Math. [Advances in Applied Mathematics] 2:482 (1981); homology alignment algorithm by Needleman and Wunsch J. Mol. Biol. [Journal of Molecular Biology] 48:443 (1970); similarity method search by Pearson and Lipman Proc. Natl. Acad. Sci. (USA) [Proceedings of the National Academy of Sciences of the United States of America] 85:2444 (1988); computer implementations of these algorithms (e.g., BLAST); or manual alignment and visual inspection.
[0083] Unless otherwise stated, identity and similarity will be calculated using the Needleman-Wunsch global alignment and scoring algorithm (Needleman and Wunsch (1970) J. Mol. Biol. [Journal of Molecular Biology] 48(3):443-453), which is implemented as part of the "needle" program (Rice, P., Longden, I. and Bleasby, A., EMBOSS: The European Molecular Biology Open Software Suite, 2000, Trends in Genetics 16, (6) pp. 276-277, version 6.3.1, available from EMBnet (embnet.org / resource / emboss) and emboss.sourceforge.net, etc.), using the default vacancy penalty and scoring matrix (EBLOSUM62 for proteins and EDNAFULL for DNA). An equivalent program may also be used. The term "equivalent procedure" refers to any sequence comparison procedure that, for any two sequences in question, generates an alignment with the same nucleotide residue match and the same percentage of sequence identity when compared to the corresponding alignment generated by needle in EMBOSS version 6.3.1.
[0084] Other mathematical algorithms are known in the art and can be used to compare two sequences. See, for example, the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 87:2264, which is an improvement on that of Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 90:5873-5877. Such algorithms are integrated into the BLAST program of Altschul et al. (1990) J. Mol. Biol. [Journal of Molecular Biology] 215:403. BLAST nucleotide searches can be performed using the following procedures: using the BLASTN program (a nucleotide query for searching nucleotide sequences) to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention, or using the BLASTX program (a nucleotide query for searching protein sequences for translation) to obtain protein sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches can be performed using the following procedures: the BLASTP procedure (searching for protein queries based on protein sequences) to obtain amino acid sequences homologous to the protein molecules of the present invention, or the TBLASTN procedure (searching for protein queries based on translated nucleotide sequences) to obtain nucleotide sequences homologous to the protein molecules of the present invention. For vacancy-free alignments for comparative purposes, Gapped BLAST (in BLAST 2.0) as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389 can be used. Alternatively, iterative searches can be performed using PSI-Blast, which detects distant relationships between molecules. See Altschul et al. (1997), ibid. When using BLAST, Gapped BLAST, and PSI-Blast procedures, the default parameters of the corresponding procedures (e.g., BLASTX and BLASTN) can be used. Alignments can also be performed manually by checking. II. Introduction
[0085] In this disclosure, “haploid-induced editing” (also known as “HI-editing”) of the genome utilizes the haploid induction phenomenon to deliver a gene-editing molecular system to the genome of a recipient plant cell. In such a procedure, a first plant is crossed with a second plant to obtain haploid progeny, wherein the chromosomes of the haploid-inducing line are eliminated and the recipient plant’s haploid chromosomes have the desired edit. In the method provided in this disclosure, the inventors have determined that applying heat treatment during the HI-editing method results in an increased haploid induction rate and / or an increased haploid editing rate in the haploid progeny. The heat treatment can be applied to an egg cell donor plant pollinated with pollen from a pollen donor plant, or to pollen from a pollen donor plant, which is then used to pollinate the egg cell donor plant. One of the egg cell donor plant or pollen donor plant expresses a gene-editing molecular system (i.e., a DNA-modifying enzyme and optionally a guiding nucleic acid expressed via transgenic expression), while the other contains the plant genomic DNA to be edited. For example, in some cases, the egg cell donor plant expresses a gene-editing molecular system, and the pollen donor plant contains the plant genomic DNA to be edited. In other cases, the pollen donor plant expresses a gene-editing molecular system, and the egg cell donor plant contains the plant genomic DNA to be edited. The haploid progeny possesses the genome of the donor plant, which contains the plant genomic DNA to be edited, and the genome of the haploid progeny has been modified by a gene-editing molecular system delivered by another donor plant. Increased haploid induction rate (HIR) and / or haploid editing rate (HER) translates into commercially significant growth in the development of new inbred lines.
[0086] The window for HI-editing is relatively short before the loss of transgenes in gene-editing molecular systems. In some embodiments, transgenes in gene-editing molecular systems are lost within a period between fertilization and genome elimination. It is generally understood that approximately 10 to 20 hours after pollination in maize allows the pollen tube to descend through the style (maize silks) and transport sperm cells to the ovule, thus completing double fertilization. After double fertilization, the embryo begins to develop. In haploid inducible lines, some embryos will exhibit genome elimination of the inducible line genome at some point after fertilization, and this occurs either immediately after fertilization or within the first few cell divisions of the embryo, which can take anywhere from several hours to several days. After genome elimination, the non-inducible line genome is preserved, and the embryo is haploid (or, if a portion of the inducible line genome is present, the embryo may be aneuploid—aneuploid embryos are typically discarded upon discovery).
[0087] Studies have shown that heat stress can increase the frequency of haploid induction. See, for example, Jin et al., (2023) and Ahmadli et al., (2023). In some embodiments, heat can increase the expression of certain genes, including gene-editing molecular systems. Based on information on plant heat stress responses, heat treatment can increase the expression of gene-editing molecular systems (i.e., DNA-modifying enzymes and optionally guiding nucleic acids) from transfer DNA by opening the chromatin surrounding HI-edited pollen or zygote transfer DNA (T-DNA). See, for example, Huang et al., (2023); Liang (2021); Das and Mathur (2023); Perrella et al., (2022). This effect may be particularly useful for HI-editing because spermatocyte chromatin is very dense during late pollen development, pollen tube growth, style transfer, and fertilization. This density can block the effective expression of gene-editing molecular systems, or it can block the effective editing of target sites. Therefore, to avoid being constrained by theory, making chromatin more open or relaxed may enhance transgene expression in gene-editing molecular systems or improve target site accessibility, thus allowing gene-editing molecular systems to edit the genome more effectively. Either of these phenomena would result in a higher haploid editing rate. The method of combining heat application with HI-editing is called "hot editing." III. Haploid-induced editing (thermal editing) using heat treatment
[0088] This document provides methods for editing plant genomic DNA. Generally, these methods involve providing a first parent plant as an egg cell donor and a second parent plant as a pollen donor, such that at least one progeny produced from pollination of the two parents contains a genome that has been edited compared to one of the two parents in a hybridization. In some embodiments, a heat treatment step is applied before, during, or after a hybridization event between the first and second plants. One or more progeny plants can be produced using the methods disclosed herein. Progeny plants produced using the methods disclosed herein are edited haploids.
[0089] In the methods disclosed herein, one parent plant (i.e., the target plant) contains plant genomic DNA to be edited, while the other parent plant contains components capable of gene editing. In some embodiments, the gene-editing component comprises a DNA-modifying enzyme and optionally a guiding nucleic acid. In some embodiments, the first parent plant and the second parent plant are different species. In some embodiments, both the first parent plant and the second parent plant are the same species.
[0090] In some embodiments, the first parent plant is an egg cell donor plant, and the second parent plant is a pollen donor plant. In some embodiments, the egg cell donor plant contains plant genomic DNA to be edited. In some embodiments, the pollen donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid. In some embodiments, the method includes generating at least one edited haploid progeny, wherein the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor plant. Additionally, in some embodiments, the genome of the haploid progeny has been modified by a DNA-modifying enzyme and optionally a guide nucleic acid delivered by the pollen donor plant.
[0091] In some embodiments, the first parent plant is a pollen donor plant, and the second parent plant is an egg cell donor plant. In some embodiments, the pollen donor plant contains plant genomic DNA to be edited. In some embodiments, the egg cell donor plant expresses DNA-modifying enzymes and optionally, guide nucleic acids.
[0092] In some embodiments, the method includes generating at least one edited haploid progeny, wherein the haploid progeny contains the genome of the pollen donor plant but not the genome of the egg cell donor plant. Additionally, in some embodiments, the genome of the haploid progeny has been modified by a DNA-modifying enzyme and optionally a guide nucleic acid delivered by the egg cell donor plant.
[0093] In some embodiments, an egg cell donor plant is pollinated with a pollen donor plant. In some embodiments, the pollinated egg cell donor plant is subjected to heat treatment after the pollination step.
[0094] In some embodiments, heat treatment is applied to the pollen donor plant. In some embodiments, heat treatment is applied to the pollen from the pollen donor plant. In some embodiments, heat treatment is applied prior to the pollination step. In some embodiments, the egg cell donor plant is pollinated with heat-treated pollen from the pollen donor plant.
[0095] In some embodiments, the first parent plant is a pollen donor plant, and the second parent plant is an egg cell donor plant. In some embodiments, the egg cell donor plant contains plant genomic DNA to be edited. In some embodiments, the pollen donor plant expresses DNA-modifying enzymes and optionally, guide nucleic acids. A. Haploid induction via HI-editing
[0096] Haploid induction (HI) can be used to introduce genome editing into the newborn seeds of different monocotyledonous and dicotyledonous species through a method called "HI-editing" used for "haploid induction editing." HI-editing employs haploid inducible lines of plants modified to express gene-editing molecular systems to deliver the editing molecular system to the genome to be edited in the recipient plant. In such a procedure, the first plant is crossed with a second plant to obtain haploid progeny, in which the chromosomes of the haploid inducible line are eliminated and the recipient plant's haploid chromosomes have the desired editing. The HI-editing method is detailed in PCT Publication WO 2018 / 102816 and also described in Kelliher, T et al. (2019) One-step genomeediting of elite crop germplasm during haploid induction. Nature Biotech 37:287-292.
[0097] Generally, during haploid induction, both parental lines used in the induced hybridization are diploid, and therefore their gametes (egg cells and sperm cells) are haploid. Haploid induction is usually a medium for reducing the penetrance of the inducing line, so the resulting offspring, depending on the species or circumstances, can be diploid (if no genome deletion has occurred) or haploid (if a genome deletion has actually occurred). If the parental line crossed with the haploid inducing line is not diploid, but a tetraploid, hexaploid, or higher-ploidy plant, the resulting “haploid” offspring will have gamete chromosome numbers such as diploid (if the parent is tetraploid) or triploid (if the parent is hexaploid). Therefore, as used herein, a “haploid” has half the chromosome number of either parent.
[0098] Haploid induction can occur during self-pollination or intercrossing between two lines of the same species, or it can occur during distant hybridization, in which case it can be seen as a hybridization barrier, preventing the formation of interspecific hybrids. In maize, a common method for inducing haploids is by using HI alleles at several genomic loci that can promote effective haploid induction. In wheat, rice, barley, brassica, and other crops, a common method for inducing haploids is distant hybridization with maize pollen. For example, maize pollen can be used on wheat, millet pollen on wheat, barley pollen on other barley species, or any other method of distant hybridization. In those cases of gynogenetic haploid induction, it is preferable that the paternal line contains an editing molecular system, because the paternal (pollen-derived) DNA is eliminated during haploid induction. In wheat, haploid induction can be achieved through distant hybridization with maize pollen, regardless of parental genotype or pedigree; almost any wheat variety can be hybridized with almost any maize pollen.
[0099] In maize, the most commonly used method for inducing haploidy is through the use of an intraspecific haploid inducing line paternal line, primarily induced by rearrangements, mutations, and / or recombinations, insertions, or deletions within quantitative trait loci (“QTLs”) on chromosome 1, particularly the MATRILINEAL (MATL) gene, also known as NOT LIKE DAD1 (NLD1) and phospholipase A1 (PLA1) (the most notable exception is ig1-type haploid induction, which results from a mutation in the INDETERMINATE GAMETOPHYTE1 gene on chromosome 3). HI maize lines contain a QTL on chromosome 1 that is responsible for at least 66% of haploid induction variation. The QTL produces haploid induction at varying rates when introgressed into different backgrounds. All maize haploid inducing lines used in the seed industry are derivatives of the established HI line (called Stock6) and all carry a chromosome 1 QTL mutation in the haploid inducing line. In wheat, the most common method for inducing haploidy is through distant hybridization with maize pollen. Regardless of parental genotype or lineage, almost any wheat variety can be crossed with almost any corn pollen.
[0100] In some embodiments, the maize plant used in the methods provided in this disclosure contains the HI allele at the MATRILINEAL (MATL) gene, which is the potato tuber-specific phospholipase A2α gene (PLPA2α, maize B73 gene ID GRMZM2G471240 on chromosome 1; also known as Zm00001d029412 [B73_v5]; also known as NOT LIKE DAD (NLD) and phospholipase A1 (PLA1; ZmPLA1)). In some embodiments, the HI allele is a loss-of-function mutation in MATL (commonly referred to as matl). In some embodiments, the variant allele contains a four-base-pair insertion frameshift mutation in the MATL coding sequence. In some embodiments, the four-base-pair insertion corresponds to four nucleotides at positions 1146-1149 of SEQ ID NO:7. In some embodiments, the variant allele contains different mutations (i.e., other than the four-base-pair insertion mutation) or different mutations that result in loss of function of the protein product encoded by MATL. Any assay capable of identifying loss-of-function mutations in MATL can be used to identify the plants described herein. Exemplary methods for identifying plants with loss-of-function mutations in MATL are described in PCT / US2022 / 022271, filed May 22, 2022, which is incorporated herein by reference in its entirety.
[0101] In some embodiments, the maize plants used in the methods provided in this disclosure contain an HI allele at at least one quantitative trait locus (QTL) allele associated with enhanced haploid induction (HI-QTL). In some embodiments, the maize plants are at least heterozygous (e.g., heterozygous or homozygous) for the HI allele at at least one HI-QTL. In some embodiments, the maize plants are homozygous for the HI allele at at least one HI-QTL. In some embodiments, maize plants homozygous for the HI allele at the HI-QTL show more effective haploid induction compared to maize plants that are heterozygous for the HI allele at the HI-QTL. In some embodiments, the maize plants contain an HI allele at the qhir8 HI-QTL on chromosome 9, as described, for example, in PCT / US2022 / 022271.
[0102] In androgen-induced haploidy, the editing molecular system will be optimally present in the maternal parent due to the elimination of maternal chromosomes during haploidy induction. In some embodiments, haploid plants can be generated via seeds by manipulating a single centromere protein (i.e., the centromere-specific histone CENH3). See Maruthachalam and Chan 2010; Wang et al. 2021. In some embodiments, the plant contains a mutation in the CENH3 gene, the representative cDNA sequence of which is shown in SEQ ID NO:8. When a haploid-induced line with a cenh3 null mutant expressing altered CENH3 protein is crossed with a wild-type, chromosomes from the haploid-induced line are eliminated. Genomic elimination may be caused by centromere failure due to CENH3 dilution during postmeiotic cell division prior to gamete formation. The cenh3 method can be used to produce paternal haploids, and also maternal haploids.
[0103] In some embodiments, the pollen donor plant of the provided method is a haploid inducible line. For example, the pollen donor plant may be a paternal haploid inducible line. In some embodiments, the paternal haploid inducible line contains a knockout mutation in the MATL gene.
[0104] In some embodiments, the egg cell donor plant of the provided method is a maternal haploid induction line. In some embodiments, the maternal haploid induction line contains a mutation in the CENH3 gene. In some embodiments, the maternal haploid induction line is heterozygous for the mutation in the CENH3 gene.
[0105] Following HI, haploid embryos or seeds are typically isolated from diploid and aneuploid sister plants using phenotypic or genetic marker screening and allowed to grow or be cultured into haploid plants. These plants are then naturally or chemically transformed into double haploid (DH) plants using anti-microtubule agents such as colchicine, acetylene-methyl, fluthion, or trifluralin, which then produce self-pollinated seeds.
[0106] The emergence of DH plants allows plant breeders to obtain inbred lines without multiple generations of self-pollination, thus reducing the time required to produce homozygous plants. DH plants provide plant breeders with invaluable tools, particularly for generating inbred lines, mapping quantitative trait loci (QTLs), cytoplasmic transformation, trait introgression, and F2 screening for high-throughput trait improvement. Because homozygous lines can be generated essentially within one generation, significant time is saved by eliminating the need for multiple generations of single-seed propagation (traditional self-pollination). In particular, because DH plants are completely homozygous, they are well-suited for quantitative genetics research.
[0107] In some embodiments, heat treatment improves the HIR of the HI-editing method. Because heat treatment can cause chromatin opening or relaxation, it can lead to improvements in both HIR and HER in the context of different expression cassettes and their components, events, and species. In some embodiments, heat treatment causes chromatin relaxation and / or unwinding. HI efficiency can be expressed as haploid induction rate (HIR), which is the percentage of haploid progeny embryos from a hybrid between a haploid induction line and another line that contain edits directed by a gene-editing molecule system expressed by one of the donor plant parents. As discussed above, haploid induction is typically a trait of moderate to low penetrance in the induction line—thus, not all progeny from the hybrid are haploid.
[0108] For example, in maize, HIR refers to the number of haploid kernels divided by the total number of kernels produced after pollination. For instance, the HIR in maize can be determined by harvesting testcross ears after pollination (e.g., approximately 15 to 20 days post-pollination). Embryos from the kernels can be isolated and incubated in a suitable medium (called embryo rescue medium) to maintain embryo viability. In some embodiments, the rescue medium for HIR determination comprises 4.43 g of vitamin-containing Murashige and Skog basal medium, 30 g of sucrose, and 70 mg of salicylic acid. Embryos in the rescue medium can be placed under conditions that allow the expression of marker genes such as color indicator genes (e.g., R1, R1-SCM2, R1-nj, GUS, PMI, PAT, GFP, RFP, CFP, B1, CI, or anthocyanin pigments). In an exemplary embodiment, where the marker gene is the R1-SCM2 gene, embryos are placed at 22°C-31°C under 100-400 μmol light for 16-24 hours until some embryos turn purple due to R1-SCM2 gene expression. See exemplary schemes, for example, as described in WO 2015 / 104358. Purple (diploid) and cream-colored (haploid) embryos can be counted from each ear. HIR (haploid frequency) can be determined based on the proportion of haploids (with R1-SCM2 color marker variation) to the total number of embryos. The number of true haploids can be confirmed by genotyping using, for example, TaqMan® target site assays (Applied Biosystems) or next-generation sequencing (NGS). NGS data can be used to confirm haploid editing and identify the edited sequence, and can be used to calculate the final HER. B. Heat Treatment
[0109] Heat treatment can be applied before, during, and / or after a pollination event between two plants. In some embodiments, heat treatment is applied to the egg cell donor plant before pollination. In some embodiments, heat treatment is applied to the pollen donor plant before pollination. In some embodiments, heat treatment is applied to the egg cell donor plant after the pollination step, i.e., after the egg cell donor plant has been pollinated. In some embodiments, heat treatment is applied to the pollen from the pollen donor plant before the pollination step.
[0110] In some embodiments, heat treatment is applied during a “HI-editing window” that covers the period during which editing may occur before genome elimination. The treatment duration ranges from several hours to three days after pollination. In some embodiments, the heat treatment is applied for at least 10 hours, at least 15 hours, at least 20 hours, at least 25 hours, or at least 30 hours. In some embodiments, the heat treatment is applied for about 0-10 hours, about 10-20 hours, or about 20-30 hours. In some embodiments, heat treatment is applied in cycles of about 15 hours at 25°C-30°C and about 9 hours at 16°C-20°C, wherein the cycles may be repeated 0, 1, 2, or more times.
[0111] As will be understood by those skilled in the art, there are many methods for applying heat treatment to plants, such that the heat is maintained at approximately a constant temperature and applied uniformly to the plant parts. For example, the temperature of an incubator or room temperature (e.g., a greenhouse) can be set at a target temperature. In another instance, a heat source is placed in close proximity to or attached to the plant part or organ where haploid induction is occurring. Insulating materials or insulation layers can be used to aid in the application of heat. In some embodiments, a heat source is placed in close proximity to or attached to the plant egg cells and / or plant pollen. In some embodiments, the plant is maize; therefore, in some embodiments, a heat source is placed in close proximity to or attached to the maize husks, ears, tassels, pollen, kernels, and / or egg cells.
[0112] In some embodiments, a heating pack is used. Commercial heating packs are readily available to those skilled in the art, such as Thermacare® Muscle Pain Therapy Heat Wraps, thermacare.com / heat-wraps / muscle-pain-therapy (last accessed: August 15, 2023). In the case of a heating pack, it can be replaced from time to time (e.g., every 4 hours, every 8 hours, every 12 hours, every 16 hours, etc.) to maintain approximately constant heat application. In some embodiments, the heating pack is attached around the plant or around the part of the plant being pollinated. For example, in some embodiments, for corn, the heating pack may be attached around the corn husk. For example, in some embodiments, for corn, the heating pack may be attached to the corn ear.
[0113] In some embodiments, heat is applied at approximately 16°C–20°C, approximately 20°C–25°C, approximately 25°C–30°C, and approximately 30°C–36°C. In some embodiments, temperatures are maintained at approximately 23°C, approximately 24°C, approximately 25°C, approximately 26°C, approximately 27°C, 28°C, approximately 29°C, approximately 30°C, approximately 31°C, approximately 32°C, approximately 33°C, approximately 34°C, approximately 35°C, approximately 36°C, approximately 37°C, approximately 38°C, approximately 39°C, or approximately 40°C. In some embodiments, daytime temperatures are maintained at approximately 23°C, approximately 24°C, approximately 25°C, approximately 26°C, approximately 27°C, 28°C, approximately 29°C, approximately 30°C, approximately 31°C, approximately 32°C, approximately 33°C, approximately 34°C, approximately 35°C, approximately 36°C, approximately 37°C, approximately 38°C, approximately 39°C, or approximately 40°C. In some embodiments, nighttime temperatures are maintained at approximately 23°C, approximately 24°C, approximately 25°C, approximately 26°C, approximately 27°C, approximately 28°C, approximately 29°C, approximately 30°C, approximately 31°C, approximately 32°C, approximately 33°C, approximately 34°C, approximately 35°C, approximately 36°C, approximately 37°C, approximately 38°C, approximately 39°C, or approximately 40°C. In some embodiments, heat is applied within a target temperature of approximately 5°C.
[0114] In some embodiments, the internal temperature of the plant or plant part to which heat treatment is applied is maintained within a target temperature of about 5°C. In some embodiments, the internal temperature of the plant or plant part to which heat treatment is applied is about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, or about 40°C. For example, in the case of a maize plant, the internal temperature mentioned herein could be the internal temperature of a maize ear. C. Donor Plants
[0115] The methods and compositions disclosed herein can be used to edit the genomic DNA of a variety of plants. In some embodiments, the egg cell donor plant is a monocotyledonous or dicotyledonous plant. In some embodiments, the pollen donor plant is a monocotyledonous or dicotyledonous plant. Exemplary monocotyledonous plants include maize, wheat, rice, barley, oats, triticale, sorghum, pearl millet, Mexican corn, bamboo, sugarcane, asparagus, onion, and garlic.
[0116] In some embodiments, the pollen donor plant is corn, wheat, rice, soybean, sunflower, tomato, Arabidopsis thaliana, cucumber, barley, oats, triticale, sorghum, pearl millet, asparagus, onion, garlic, Mexican corn, bamboo, or sugarcane. In some embodiments, the egg cell donor plant is corn, wheat, rice, soybean, sunflower, tomato, Arabidopsis thaliana, cucumber, barley, oats, triticale, sorghum, pearl millet, asparagus, onion or garlic, Mexican corn, bamboo, or sugarcane. In some embodiments, the offspring produced by the provided method are corn, wheat, rice, soybean, sunflower, tomato, Arabidopsis thaliana, cucumber, barley, oats, triticale, sorghum, pearl millet, asparagus, onion or garlic, Mexican corn, bamboo, or sugarcane.
[0117] In some embodiments, the plant is maize. Maize plants can be derived from any known heterotic group. A heterotic group is a group of genetically related genotypes that exhibit similar hybrid performance when crossed with individuals from a genetically different germplasm group (Melchinger, AE, and Gumber, RK (1998). Overview of Heterosis and Heterotic Groups in Agronomic Crops. Published in: Concepts and Breeding of Heterosis in Crop Plants (edited by KR Larnkey and JE Staub); doi: 10.2135 / cssaspecpub25.c3). Besides trait introgression, the goal of plant breeding is to achieve genetic improvement in both varietal lines and hybrid parental lines. Effective hybridization breeding programs genetically improve the parental lines in both the maternal and paternal heterotic groups of the hybrid. Therefore, it is advantageous to achieve genetic improvement in all heterotic groups used in the breeding program. Table 1 below shows the common heterotic groups to which different germplasms belong. Maize plants from one heterotic group can be used to hybridize with maize plants from any other heterotic group to edit their genome and improve their traits.
[0118] In some embodiments, the paternal and / or maternal parents described above belong to any of the heterotic groups in Table 1 above. In some embodiments, the paternal and maternal parents belong to different heterotic groups. In some embodiments, maize plants comprise sturdy stalk germplasm, non-sturdy stalk germplasm, non-sturdy iodent germplasm, tropical germplasm, or subtropical germplasm. In other embodiments, the maize plant comprises germplasm classified into any other heterotic group known to those skilled in the art (see, for example, L. Reid et al., 2011, “Genetic diversity analysis of 119 Canadian maize inbred lines based on pedigree and simple sequence repeat markers,” Can. J. Plant Sci. 91: 651-661 and M. Mikel and J. Dudley, 2006, “Evolution of North American DentCorn from Public to Proprietary Germplasm,” Crop Sci. 46: 1193-1205, each incorporated herein by reference in its entirety). The maize plant disclosed herein may also be derived from any known or proprietary line. In some embodiments, the maize plants are derived from any of the lines Stock 6, RWK, RWS, UH400, NP2222RS, and / or NP2222. In other embodiments, the maize plants are derived from any other target line.
[0119] In some embodiments, the maize plant described herein contains at least one selective marker to facilitate screening and selection of desired progeny (e.g., kernels of progeny that have become haploid). As used herein, the term selective marker encompasses screening or reporting markers (e.g., color indicators that can be used for visual screening of desired progeny) and selective markers (e.g., antibiotic-mediated enrichment of antibiotic resistance genes that can be used in desired progeny). In some embodiments, the plant contains a selective marker gene. The selective marker gene can be, for example, an endogenous gene or a mutation of a transgene. In some embodiments, the selective marker gene encodes a detectable protein product. In some embodiments, the plant is heterozygous for the selective marker. In some embodiments, the plant is homozygous for the selective marker. In some embodiments, the selective marker gene encodes a pigment or other detectable product that is present only in diploid embryos, facilitating selection of haploid embryos, as detailed below and in examples. In some embodiments, selective markers may include any one of GUS, PMI, PAT, GFP, RFP, CFP, B1, CI, NPTII, HPT, ACC3, AADA, high oil content (see, for example, Melchinger et al. 2013. Sci. Reports 3:2129 and Chaikam et al. 2019. Theor. and Appl. Genet. 132:3227-3243), R-navajo (R-nj), R1-scutellaria (R1-SCM2), and / or anthocyanin pigments. Other selective marker genes are known to those skilled in the art (see, for example, Ziemienowicz. 2001. Acta Physiologiae Plantarum 23:363-374). In some embodiments, selective markers include antibiotic resistance genes. D. Site-directed nucleases
[0120] Gene editing in the hot editing methods disclosed herein can be performed using a variety of site-directed nucleases (SDNs). Typically, the desired outcome in SDN-mediated genome editing is 1) targeting the SDN to cleave DNA at specific genomic sites in the host (e.g., plant cells), and 2) introducing specific genomic changes at the cleavage sites using the host's natural repair mechanisms. These changes can include small deletions, substitutions, or additions of a few nucleotides. Such targeted editing can produce new and desired traits (e.g., enhanced nutrient uptake or reduced allergen production) and / or reduce undesirable traits (e.g., herbicide sensitivity).
[0121] SDN applications are generally classified into three categories: SDN-1, SDN-2, and SDN-3. SDN-1 generates double-strand breaks in the genome without adding exogenous DNA. When such breaks are repaired by the host (e.g., via non-homologous end joining; NHEJ), mutations or deletions can be introduced. If these mutations or deletions are in a gene, the gene can be silenced or knocked out. SDN-2 uses template DNA to introduce predicted modifications at target cleavage sites (e.g., via HDR) without resulting in the insertion of recombinant DNA. SDN-3 also uses template DNA to introduce recombinant or exogenous DNA templates (e.g., transgenes) at target cleavage sites.
[0122] Suitable SDNs include, but are not limited to, CRISPR-associated (Cas) proteins or Cas nucleases, meganucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), RNA-binding proteins (RBP), CRISPR-associated RNA-binding proteins, recombinases, flipases, transposases, Argonaute (Ago) proteins (e.g., prokaryotic Argonaute (pAgo), archaea Argonaute (aAgo), eukaryotic Argonaute (eAgo), and Natronobacterium gregoryi Argonaute (NgAgo)), RNA-acting adenosine deaminases (ADAR), CRISPR-Cas-induced RNA targeting (CIRT) systems, Pumilio / fem-3 binding factor (PUF), homing endonucleases or any functional fragments thereof, any derivatives thereof, any variants thereof, and any fragments thereof. Exemplary SDNs suitable for use are further described below.
[0123] In some embodiments, the SDN is a naturally occurring SDN. Exemplary naturally occurring SDNs are known in the art (see, for example, Makarova et al., 2017, Cell [Cell] 168:328-328.e1 and Shmakov et al., 2017, NatRev Microbiol [Nature Reviews Microbiology] 15(3):169-182). In some embodiments, the SDN binds to DNA-targeting polynucleotides (e.g., guide RNA), thereby being directed to a specific sequence within the target DNA and cleaving the target DNA.
[0124] Gene-editing molecular systems introduced into plants (e.g., DNA-modifying enzymes such as SDN and optional guide nucleic acids) can be controlled by any promoter capable of driving the expression of recombinant genes in the plant. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a tissue-specific promoter, such as a pollen-specific promoter or a sperm cell-specific promoter, a zygote-specific promoter, or a promoter highly expressed in sperm, egg cells, and zygotes (e.g., prOsActin1). Suitable promoters are disclosed in U.S. Patent No. 10,519,456 and International Application No. PCT / CN2023 / 110941. Exemplary promoters are shown in Table 2 below. Promoters can be used to drive the expression of editing molecular systems in highly spermated cells in transgenes to improve the efficiency of simultaneous editing and double haploid induction (SEDHI). 1. CRISPR-Cas system
[0125] In some embodiments, haploid inducible lines express a CRISPR-Cas system. The CRISPR-Cas system may comprise at least one guide nucleic acid (e.g., guide RNA (gRNA)) complexed with a DNA-modifying enzyme (e.g., a Cas protein) for targeted regulation of gene expression and / or activity or nucleic acid editing. The RNA-guided Cas protein (e.g., a Cas nuclease such as Cas9 or Cas12 nuclease) may specifically bind to a target polynucleotide (e.g., DNA) in a sequence-dependent manner. If Cas proteins possess nuclease activity, they can cleave DNA (Gasiunas, G. et al., "Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria," ProcNatl Acad Sci USA (2012) 109:E2579-E286; Jinek, M. et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity," Science (2012) 337:816-821; Sternberg, SH et al., "DNA interrogation by the CRISPR RNA-guided endonuclease Cas9," Nature (2014) 507:62; Deltcheva, E. et al., “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III,” Nature (2011) 471:602-607. DNA cleavage (e.g., double-strand breaks) can generate DNA break repair, thereby allowing the introduction of one or more gene modifications (e.g., nucleic acid editing). DNA break repair can occur via non-homologous end joining (NHEJ), microhomologous-mediated end joining (MMEJ), or homology-directed repair (HDR).CRISPR-Cas systems have been widely used for programmable genome editing in a variety of organisms and model systems (Cong, L. et al., “Multiplex genome engineering using CRISPR-Cas systems,” Science (2013) 339:819-823; Jiang, W. et al., “RNA-guided editing of bacterial genomes using CRISPR-Cas systems,” Nat. Biotechnol. (2013) 31:233-239; Sander, JD and Joung, J. K., “CRISPR-Cas systems for editing, regulating and targeting genomes,” Nature Biotechnol. (2014) 32:347-355).
[0126] In some embodiments, the Cas protein forms a complex with a guide nucleic acid. In some embodiments, the Cas protein includes an RNA-binding protein (RBP) that optionally complexes with a guide nucleic acid (e.g., guide RNA (gRNA)) capable of forming a complex with the Cas protein. In some cases, RNA-guided Cas proteins recognize a DNA target complementary to a portion of the gRNA (called a CRISPR RNA (crRNA) sequence). The target sequence is often called the prototype spacer, and the portion of the crRNA sequence complementary to the prototype spacer is often called the spacer. To function (e.g., to cleave DNA), many Cas proteins also require a specific prototype spacer adjacent motif (PAM) (a DNA sequence of approximately 2 to 6 base pairs) immediately following the prototype spacer sequence.
[0127] Any suitable CRISPR-Cas system can be used. Multiple nomenclature systems can be used to refer to CRISPR-Cas systems. Exemplary nomenclature systems are provided in Makarova, KS et al., “An updated evolutionary classification of CRISPR-Cas systems,” NatRev Microbiol (2015) 13:722-736 and Shmakov, S. et al., “Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems,” Mol Cell (2015) 60:1-13. A CRISPR-Cas system can be a type I, II, III, IV, V, VI system, or any other suitable CRISPR-Cas system. The CRISPR-Cas system used herein can be a class 1, class 2, or any other suitable classification of CRISPR / Cas system. Class 1 or class 2 can be determined based on genes encoding effector modules. Class 1 CRISPR-Cas systems typically possess multi-subunit crRNA-effector complexes, while Class 2 systems typically possess a single protein, such as Cas9, Cpfl, C2c1, C2c2, C2c3, or a crRNA-effector complex. Class 1 CRISPR-Cas systems can utilize complexes of multiple Cas proteins for regulation. Class 1 CRISPR-Cas systems can include, for example, type I (e.g., I, IA, IB, IC, ID, IE, IF, IU), type III (e.g., III, IIIA, IIIB, IIIC, IIID), and type IV (e.g., IV, IVA, IVB) CRISPR-Cas types. Class 2 CRISPR-Cas systems can utilize a single large Cas protein for regulation. Class 2 CRISPR-Cas systems can include, for example, type II (e.g., II, IIA, IIB) and type V CRISPR-Cas types. CRISPR systems can be complementary to each other and / or can utilize trans-functional units to facilitate CRISPR locus targeting. (a) Cas protein
[0128] Cas proteins can originate from any suitable organism. Non-limiting examples of suitable organisms include *Streptococcus pyogenes*, *Streptococcus thermophilus*, *Streptococcus* sp., *Staphylococcus aureus*, *Nocardiopsis dassonvillei*, *Streptomyces pristinaespiralis*, *Streptomyces viridochromogenes*, *Streptomyces viridochromogenes*, *Streptosporangium roseum*, *Streptosporangium roseum*, *Alicyclobacillus sacidocaldarius*, *Bacillus pseudomycoides*, and *Bacillus selenium-reducing*. * *Selenitireducens*, *Exiguobacterium sibiricum*, *Lactobacillus delbrueckii*, *Lactobacillus salivarius*, *Microscilla marina*, *Burkholderiales bacterium*, *Polaromonas naphthalenivorans*, *Polaromonas* sp., *Crocosphaera watsonii*, *Cyanothece* sp., *Microcystis aeruginosa*, *Pseudomonas aeruginosa*, and *Synechococcus* sp.), Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus wari * *Watsoni*, *Pseudoalteromonas haloplanktis*, *Ktedonobacter racemifer*, *Methanohalobium evestigatum*, *Anabaena variabilis*, *Nodularia spumigena*, *Nostoc* sp., *Arthrospira maxima*, *Arthrospira platensis*, *Arthrospira* sp., *Lyngbyasp.*, *Microcoleus chthonoplastes*, *Oscillatoriasp.*, *Petrotoga mobilis*, *Thermosipho africanus*, *Acaryochloris marina*, *Leptotrichia* shahii) and the new culprit, Francisella novicida. In some embodiments, the organism is Streptococcus pyogenes (S. spp.).In some embodiments, the organism is *Staphylococcus aureus*. In some embodiments, the organism is *Streptococcus thermophilus*.
[0129] Cas proteins can be derived from a variety of bacterial species, including but not limited to Lachnospiraceae bacterium, Veillonella atypical, Fusobacterium nucleatum, Filifactor alocis, Solobacterium moorei, Coprococcus catus, Treponema denticola, Peptoniphilus duerdenii, Catenibacterium mitsuokai, Streptococcus mutans, Listeria innocua, Staphylococcus pseudintermedius, Acidaminococcus intestine, Olsenella uli, and Oenococcus. The following bacteria are listed: *Bifidobacterium bifidum*, *Lactobacillus rhamnosus*, *Lactobacillus gasseri*, *Finegoldia magna*, *Mycoplasma mobile*, *Mycoplasma gallisepticum*, *Mycoplasma ovipneumoniae*, *Mycoplasma canis*, *Mycoplasma synoviae*, *Eubacterium rectale*, *Streptococcus thermophilus*, *Eubacterium dolichum*, and *Lactobacillus coryniformis subsp.*Torquens, Ilyobacter polytropus, Ruminococcus albus, Akkermansia muciniphila, Acidothermus cellulolyticus, Bifidobacterium longum, Bifidobacterium dentium, Corynebacterium diphtheria, Elusimicrobium minutum, Nitratifractorsalsuginis, Sphaerochaeta globus, Fibrobacter succinogenes subsp. Succinogenes, Bacteroides fragilis, Capnocytophaga ochracea, Rhodopseudomonas The following bacteria are listed: *Plasmustris*, *Prevotella micans*, *Prevotella ruminicola*, *Flavobacterium columnare*, *Aminomonas paucivorans*, *Rhodospirillum rubrum*, *Candidatus Puniceispirillum marinum*, *Verminephrobactereiseniae*, *Ralstonia syzygii*, *Dinoroseobacter shibae*, *Azospirillum*, *Nitrobacter hamburgensis*, *Bradyrhizobium*, *Wolinella succinogenes*, and *Campylobacter jejuni* subsp.Jejuni, Helicobacter mustelae, Bacillus cereus, Acidovorax ebreus, Clostridium perfringens, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria meningitidis, Pasteurella multocida subsp. Multocida, Sutterella wadsworthensis, Proteobacterium, Legionella pneumophila, Parasutterella excrementihominis, Wolinella succinogenes, and Francisella novicida. In some embodiments, the organism is a bacterium belonging to the family Trichophyceae.
[0130] Non-limiting examples of Cas proteins include c2c1, C2c2, c2c3, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8, Cas8a, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csx12), Cas10, Cas10d, Cas12a, Cas12b, Cas12i, Cas12j, Cas12L, Cas12e, Cas12c, Cas12d, Cas12g, Cas12h, TnpB, Cas13a, Cas13b, C The Cas proteins are as14, CasF, CasG, CasH, Cpfl, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csxl, Csx15, Csfl, Csf2, Csf3, Csf4, Cul966, and their homologs or modified forms. In some embodiments, the Cas protein is the Cas9 protein. In some embodiments, the Cas protein is the Cas12a protein. In some embodiments, the Cas protein is a nicking enzyme that creates single-stranded cuts in DNA. In some embodiments, the Cas protein is the Cas9 nicking enzyme or the Cas12a nicking enzyme.
[0131] Cas proteins may contain one or more domains. Non-limiting examples of domains include a domain that directs nucleic acid recognition and / or binding, a nuclease domain (e.g., a DNase or RNase domain, RuvC and HNH), a DNA-binding domain, an RNA-binding domain, a helicase domain, a protein-protein interaction domain, and a dimerization domain. The domain that directs nucleic acid recognition and / or binding may interact with the directing nucleic acid. The nuclease domain may include catalytic activity for nucleic acid cleavage. The nuclease domain may lack catalytic activity to prevent nucleic acid cleavage. Cas proteins may be chimeric Cas proteins fused with other proteins or peptides. Cas proteins may be chimeras of various Cas proteins, such as those containing domains from different Cas proteins. In some embodiments, the Cas protein is Cas9 fused with a heterologous domain or Cas12a fused with a heterologous domain.
[0132] The Cas protein used herein may be an active variant, inactive variant, or fragment of a wild-type or modified Cas protein. Relative to the wild-type form of the Cas protein, the Cas protein may contain amino acid alterations, such as deletions, truncations, insertions, substitutions, variants, mutations, fusions, chimeras, or any combination thereof. The Cas protein may be a polypeptide having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity or sequence similarity to the wild-type exemplary Cas protein. The Cas protein may be a polypeptide having at most about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or sequence similarity to the wild-type exemplary Cas protein. Variant or fragment may contain at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity or sequence similarity to wild-type or modified Cas proteins or portions thereof. Variant or fragment may be targeted to nucleic acid loci that guide nucleic acid complexation while lacking nucleic acid cleavage activity.
[0133] In some embodiments, the modified Cas protein has reduced functionality relative to its unmodified form. In some embodiments, the modified Cas protein is a functionally defective form of the unmodified form. For example, a nuclease-deficient Cas protein retains the ability to bind DNA but lacks or has reduced nucleic acid cleavage activity. Cas nucleases (e.g., retaining wild-type nuclease activity, having reduced nuclease activity, and / or lacking nuclease activity) can function in a CRISPR / Cas system to regulate the level and / or activity (e.g., decrease, increase, or eliminate) of target genes or proteins. Cas proteins can bind target polynucleotides and prevent transcription to produce nonfunctional gene products by physically blocking or editing nucleic acid sequences. In some embodiments, the modified Cas protein has no more than 90%, no more than 80%, no more than 70%, no more than 60%, no more than 50%, no more than 40%, no more than 30%, no more than 20%, no more than 10%, no more than 5%, or no more than 1% of the function (e.g., nuclease activity) of a wild-type Cas protein (e.g., Cas9a or Cas12a). In some embodiments, the modified Cas protein does not have the substantial function of a wild-type Cas protein. When a Cas protein is a modified form that does not possess substantial nucleic acid cleavage activity, it can be referred to as non-enzymatic, non-nuclease-active, and / or "dead" (abbreviated as "d"). Dead Cas proteins (e.g., dCas, dCas12a) can bind to target polynucleotides but cannot cleave them. In some embodiments, the Cas9 protein provided herein is a non-nuclease-active Cas9 protein. In some embodiments, the Cas12a protein provided herein is a non-nuclease-active Cas12a protein.
[0134] In some embodiments, the modified Cas protein can be a modified Cas "base editor". Base editing enables the direct and irreversible conversion of one target DNA base to another in a programmable manner without the need for DNA cleavage or donor DNA molecules. For example, Komor et al. (2016, Nature, 533:420-424) taught a Cas9-cytidine deaminase fusion in which Cas9 was engineered to be inactive and did not induce double-strand DNA breaks. Additionally, Gaudelli et al. (2017, Nature, doi:10.1038 / nature24644) taught a Cas9 with reduced catalytic activity fused with tRNA adenosine deaminase, which can mediate the A / T to G / C conversion in the target DNA sequence. In some embodiments, the Cas12a protein provided herein is a modified Cas12a base editor.
[0135] Cas proteins can be modified to optimize the regulation of gene expression. Cas proteins can be modified to increase or decrease nucleic acid binding affinity, nucleic acid binding specificity, and / or enzyme activity. Cas proteins can also be modified to alter any other activity or property of the protein, such as stability. For example, one or more nuclease domains of a Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains unnecessary for protein function or to optimize (e.g., enhance or reduce) the activity of the Cas protein to regulate gene expression. In some embodiments, the Cas protein is a modified Cas protein containing one or more artificially induced mutations. An exemplary modified Cas12a protein is described, for example, in International Application No. PCT / CN2023 / 073486.
[0136] One or more nuclease domains (e.g., RuvC, HNH) of a Cas protein can be deleted or mutated, rendering them nonfunctional or containing reduced nuclease activity. For example, in Cas proteins containing at least two nuclease domains (e.g., Cas9, Cas12a), if one nuclease domain is deleted or mutated, the resulting Cas protein, called a nickase, can produce single-strand breaks at CRISPR RNA (crRNA) recognition sequences within double-stranded DNA, but not double-strand breaks. Such a nickase can cleave either the complementary or non-complementary strands, but not both simultaneously. In some embodiments, the specificity for targeting double-strand breaks is improved by targeting the nickase to opposite strands at two loci. If the nickase cleaves the single strands at both loci, a double-strand break is formed and can be repaired as described herein. If all nuclease domains of a Cas protein (e.g., the RuvC nuclease domain in the Cas12a protein) are deleted or mutated, the resulting Cas protein may have a reduced ability to cleave both strands of double-stranded DNA or no such ability. In some embodiments, the Cas9 protein described herein is a Cas9 nickase protein. In some embodiments, the Cas12a protein provided herein is a Cas12a cleavage enzyme protein.
[0137] This document also provides fusion proteins comprising any of the aforementioned Cas proteins and heterologous domains. As used throughout, a “fusion protein” is a protein comprising two distinct polypeptide sequences (e.g., a Cas9 or Cas12a protein sequence and a heterologous polypeptide sequence as described above) joined or linked to form a single polypeptide. In some embodiments, the two amino acid sequences are encoded by separate nucleic acid sequences that have been joined such that they are transcribed and translated to produce a single polypeptide. The Cas9 or Cas12a protein and the heterologous domain can be linked in any order and orientation relative to each other. For example, the C' terminus of the Cas9 or Cas12a protein can be linked to the N' or C' terminus of the heterologous domain. The Cas9 or Cas12a protein and the heterologous domain can also be separated by one or more additional fusion protein domains, as described below.
[0138] Exemplary heterologous domains include deaminase domains, transcription factor domains, nuclease domains, reverse transcriptase domains, transposase domains, integrase domains, uracil DNA glycosylase inhibitor domains, recombinase domains, nickase domains, methyltransferase domains, methyltransferase domains, acetyltransferase domains, transcription activator domains, and transcription repressor domains. See, for example, WO 2021 / 061507. In some embodiments, the heterologous domain is a Trex domain or a Cro domain. Exemplary Cas fusion proteins having these heterologous domains are described in international applications PCT / US2023 / 068974 and PCT / US2023 / 068977.
[0139] In some embodiments, the fusion proteins provided herein comprise one or more linkers. As used herein, a linker (also referred to as a spacer) is a flexible molecule or flexible molecular segment that joins or connects two parts (e.g., domains) of a fusion protein or variant of Cas9 or Cas12a protein provided herein. In some embodiments, the linker is a polypeptide. A protein having domains linked by a polypeptide linker is called a fusion protein. In some embodiments, the linker is a non-peptide linker. A protein having domains linked by a polypeptide linker is called a modified protein. It should be understood that modified proteins are generally contemplated (where feasible) as fusion proteins are discussed throughout this disclosure. Linkers can be short or long, flexible or rigid. See, for example, WO 2021 / 061507, WO 2020 / 168102, and US 2021 / 0017506. Exemplary linkers are described, for example, in international applications PCT / US2023 / 068974 and PCT / US2023 / 068977. (b) Guiding nucleic acid testing
[0140] In some embodiments, the Cas protein may be complexed with at least one guide RNA polynucleotide. In some embodiments, the polynucleotide may be deoxyribonucleic acid (DNA). In some cases, the DNA sequence may be single-stranded or double-stranded. In some embodiments, the polynucleotide is ribonucleic acid, i.e., guide RNA (gRNA). In some embodiments, the gRNA is expressed from a gRNA cassette.
[0141] In some embodiments, the Cas protein may be complexed with at least one guide RNA polynucleotide. The at least one guide RNA polynucleotide may contain a nucleic acid targeting region comprising a sequence complementary to a nucleic acid sequence on a targeting polynucleotide (e.g., a targeting genomic locus or gene) to confer sequence specificity to the Cas protein. In some embodiments, the at least one guide RNA polynucleotide may comprise two separate nucleic acid molecules (which may be referred to as dual guide RNAs) or a single nucleic acid molecule (which may be referred to as a single guide RNA (e.g., a single guide RNA or sgRNA)).
[0142] In some embodiments, the guiding nucleic acid is a single guiding nucleic acid comprising a fused CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA). The crRNA may contain a nucleic acid targeting region (e.g., a spacer region) of the guiding nucleic acid and a nucleotide segment that can form one half of a double-stranded double helix of the Cas protein-binding region of the guiding nucleic acid. The tracrRNA may contain the other half of a double-stranded double helix of the Cas protein-binding region of the gRNA. The nucleotide segment of the crRNA may be complementary to and hybridize with the nucleotide segment of the tracrRNA to form a double-stranded double helix of the Cas protein-binding domain of the guiding nucleic acid.
[0143] In some embodiments, the guiding nucleic acid is a single guiding nucleic acid that includes crRNA but lacks tracrRNA. In some embodiments, the guiding nucleic acid is a dual guiding nucleic acid that includes non-fusion crRNA and tracrRNA. Exemplary dual guiding nucleic acids may include crRNA-like molecules and tracrRNA-like molecules. Exemplary single guiding nucleic acids may include crRNA-like molecules. Exemplary single guiding nucleic acids may include fused crRNA-like molecules and tracrRNA-like molecules.
[0144] Whether the Cas protein requires only crRNA molecules or both crRNA and tracrRNA molecules (whether covalently linked or not) depends on the CRISPR-associated Cas protein used.
[0145] In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid can be between 18 and 72 nucleotides. The length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid can be from about 12 nucleotides to about 100 nucleotides. For example, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid can be from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, from about 12 nt to about 19 nt, from about 12 nt to about 18 nt, from about 12 nt to about 17 nt, from about 12 nt to about 16 nt, or from about 12 nt to about 15 nt. Alternatively, the length of the DNA targeting region can be from about 18 nt to about 20 nt, from about 18 nt to about 25 nt, from about 18 nt to about 30 nt, from about 18 nt to about 35 nt, from about 18 nt to about 40 nt, from about 18 nt to about 45 nt, from about 18 nt to about 50 nt, from about 18 nt to about 60 nt, from about 18 nt to about 70 nt, from about 18 nt to about 80 nt, from about 18 nt to about 90 nt, from about 18 nt to about 100 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, from about 20 nt to about 60 nt, from about 20 nt to about 70 nt. The length of the nucleic acid target region (e.g., spacer region) can be at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The length of the nucleic acid target region (e.g., spacer sequence) can be at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45 or more nucleotides.
[0146] In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 20 nucleotides. In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 19 nucleotides. In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 18 nucleotides. In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 17 nucleotides. In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 16 nucleotides. In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 21 nucleotides. In some embodiments, the length of the nucleic acid targeting region (e.g., spacer region) guiding the nucleic acid is 22 nucleotides.
[0147] The length of the nucleotide sequence of the guide nucleic acid complementary to the nucleotide sequence of the target nucleic acid (target sequence) can be, for example, at least about 12 nucleotides (nt), at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt, or at least about 40 nt. The length of the guide nucleic acid complementary to the nucleotide sequence of the target nucleic acid (target sequence) can be from about 12 nt to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 45 nt, from about 12 nt to about 40 nt, from about 12 nt to about 35 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, from about 12 nt to about 19 nt, from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt. nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt or from about 20 nt to about 60 nt.
[0148] Prototype spacer sequences (i.e., target sequences) targeting polynucleotides (e.g., on plant genomic DNA) can be identified by identifying the prototype spacer adjacent motif (PAM) within the target region and selecting a region of desired size upstream or downstream of the PAM as the prototype spacer. The corresponding spacer sequence can be designed by determining the complementary sequence of the prototype spacer region.
[0149] Spacer sequences (i.e., nucleic acid target regions) can be identified using computer programs (e.g., machine-readable code). These programs can use variables such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic background, chromatin accessibility, GC%, genomic occurrence frequency, methylation status, and SNP presence.
[0150] The percentage of complementarity between the nucleic acid targeting sequence (e.g., at least one spacer sequence of a guiding polynucleotide as disclosed herein) and the target nucleic acid (e.g., a prototype spacer sequence of one or more target loci as disclosed herein) can be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%. The percentage of complementarity between the nucleic acid targeting sequence and the target nucleic acid can be at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% over about 20 consecutive nucleotides.
[0151] The length of the Cas protein-binding region that guides nucleic acid binding can range from about 10 nucleotides to about 100 nucleotides, for example, from about 10 nucleotides (nt) to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt. For example, the length of the Cas protein-binding region that guides nucleic acid binding can range from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt.
[0152] The length of the dsRNA double strand of the Cas protein-binding region that guides nucleic acid binding can range from about 6 base pairs (bp) to about 50 bp. For example, the length of the dsRNA double strand of the protein-binding region can range from about 6 bp to about 40 bp, from about 6 bp to about 30 bp, from about 6 bp to about 25 bp, from about 6 bp to about 20 bp, from about 6 bp to about 15 bp, from about 8 bp to about 40 bp, from about 8 bp to about 30 bp, from about 8 bp to about 25 bp, from about 8 bp to about 20 bp, or from about 8 bp to about 15 bp. For example, the length of the dsRNA double strand of the Cas protein binding region can be from about 8 bp to about 10 bp, from about 10 bp to about 15 bp, from about 15 bp to about 18 bp, from about 18 bp to about 20 bp, from about 20 bp to about 25 bp, from about 25 bp to about 30 bp, from about 30 bp to about 35 bp, from about 35 bp to about 40 bp, or from about 40 bp to about 50 bp.
[0153] The percentage of complementarity between the nucleotide sequences of the dsRNA duplexes forming the protein-binding region can be at least about 60%. For example, the percentage of complementarity between the nucleotide sequences of the dsRNA duplexes forming the protein-binding region can be at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%. In some cases, the percentage of complementarity between the nucleotide sequences of the dsRNA duplexes forming the protein-binding region is 100%.
[0154] Guided nucleic acids may include modifications or sequences that provide additional desired characteristics, such as stability, subcellular targeting, tracking with fluorescent labeling, binding sites for proteins or protein complexes, etc. Examples of such modifications include, for example, a 5' cap (7-methylguanylate cap (m7G)); a 3' polyadenylated tail (3' poly(A) tail); riboswitch sequences (e.g., to allow for the regulation of protein and / or protein complex stability and / or accessibility); stability control sequences; sequences that form dsRNA double strands (hairpins); modifications or sequences that target RNA to subcellular locations (e.g., the nucleus, mitochondria, chloroplasts, etc.); modifications or sequences that provide tracking (e.g., direct conjugation to fluorescent molecules, conjugation to a portion that promotes fluorescence detection, sequences that allow for fluorescence detection, etc.); and modifications or sequences that provide binding sites for proteins (e.g., proteins that act on DNA, including transcription activators, transcription repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and combinations thereof).
[0155] The guiding nucleic acid can contain one or more modifications (e.g., base modifications, backbone modifications) to provide a nucleic acid with novel or enhanced characteristics (e.g., improved stability). The guiding nucleic acid can contain a nucleic acid affinity tag. The nucleoside can be a base-sugar combination. The base moiety of the nucleotide can be a heterocyclic base. The two most common types of such heterocyclic bases are purines and pyrimidines. The nucleotide can be a nucleoside that further includes a phosphate ester group covalently linked to the sugar moiety of the nucleoside. For those nucleosides containing pentofuranosyl sugars, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. In forming the guiding nucleic acid, the phosphate ester group can covalently link adjacent nucleosides to form a linear polymer compound. Furthermore, the corresponding ends of this linear polymer compound can be further linked to form a cyclic compound; however, a linear compound may be suitable. Additionally, the linear compound can have internal nucleotide base complementarity and thus can be folded in a manner that facilitates the formation of fully or partially double-stranded compounds. Furthermore, within the guiding nucleic acid, the phosphate ester group can often be involved in forming the inter-nucleoside backbone of the guiding nucleic acid. The binding or backbone of the nucleic acid can be 3' to 5' phosphodiester binding.
[0156] Other guidelines for nucleic acid modification are described, for example, in international application numbers PCT / US2023 / 068974 and PCT / US2023 / 068977.
[0157] In some embodiments, at least one gRNA polynucleotide disclosed herein may bind to at least a portion of a genome (e.g., a plant genome) or a gene (e.g., a plant gene). In some cases, at least one gRNA polynucleotide is capable of forming a complex with a Cas protein to guide the Cas protein to target a portion of a target nucleic acid (e.g., a site in the genome or a gene). 2. Meganuclease (MN)
[0158] In some embodiments, SDN is a meganuclease (MN). A meganuclease generally refers to a rare cleaving endonuclease or a homing endonuclease that can be highly specific. MN can recognize DNA target sites ranging in length from at least 12 base pairs (e.g., from 12 to 40 base pairs, 12 to 50 base pairs, or 12 to 60 base pairs). MN can be a modular DNA-binding nuclease, such as any fusion protein containing at least one catalytic domain of the endonuclease and at least one DNA-binding domain, or a protein specifying a nucleic acid target sequence. The DNA-binding domain may contain at least one motif that recognizes single-stranded or double-stranded DNA. MN can generate double-strand breaks. Double-strand breaks in DNA can generate DNA break repair, thereby allowing the introduction of one or more gene modifications (e.g., nucleic acid editing). DNA break repair can occur via NHEJ or HDR. In HDR, a donor DNA repair template or template polynucleotide containing a homologous arm flanking the target DNA site can be provided. MN can be monomeric or dimer. In some embodiments, MN is naturally occurring (found in nature) or wild-type, and in other embodiments, MN is non-natural, artificial, engineered, synthetic, rationally designed, or man-made. In some embodiments, the MN disclosed herein includes I-CreI MN, I-CeuI MN, I-Msol MN, I-SceI MN, its variants, its derivatives, and fragments thereof. Detailed descriptions of useful large MNs and their applications in gene editing can be found in, for example, the following literature: Silva et al., Curr Gene Ther [Current Gene Therapy], 2011, 11(1):11-27; Zaslavoskiy et al., BMC Bioinformatics [BMC Bioinformatics], 2014, 15:191; Takeuchi et al., Proc Natl Acad SciUSA [Proceedings of the National Academy of Sciences of the United States of America], 2014, 111(11):4061-4066 and U.S. Patent Nos. 7,842,489; 7,897,372; 8,021,867; 8,163,514; 8,133,697; 8,021,867; 8,119,361; 8,119,381; 8,124,36; and 8,129,134. 3. Zinc finger nucleases (ZFN)
[0159] In some embodiments, SDN is a zinc finger nuclease (ZFN). A ZFN is a fusion between a cleavage domain (such as the cleavage domain of Fokl) and at least one zinc finger motif (e.g., at least 2, 3, 4, or 5 zinc finger motifs) that can bind polynucleotides (such as DNA and RNA). Heterodimerization at certain positions in the polynucleotides of two separate ZFNs at certain orientations and intervals can lead to the cleavage of the polynucleotides. For example, a ZFN bound to DNA can induce double-strand breaks in DNA. To dimerize the two cleavage domains and cleave DNA, two separate ZFNs can bind to the opposite strand of DNA through their C-termini at a distance from each other. In some cases, the linker sequence between the zinc finger domain and the cleavage domain may require the 5' edges of each binding site to be separated by about 5-7 base pairs. In some cases, the cleavage domain is fused to the C-terminus of each zinc finger domain. Exemplary ZFNs include, but are not limited to, those described in the following literature: Urnov et al., Nature Reviews Genetics, 2010, 11:636-646; Gaj et al., Nat Methods [Natural Methods], 2012, 9(8):805-7; U.S. Patent Nos. 6,534,261; 6,607,882; 6,746,838; 6,794,136; 6,824,978; 6,866,997; 6,933,113; 6,979,539; 7,013,219; 7,030,215; 7,220,719; 7,241,573; 7,241,574; 7,585,849; 7,595,376; 6,903,185; 6,479,626; and U.S. Publications Nos. 2003 / 0232410 and 2009 / 0203140.
[0160] In some embodiments, an SDN containing a ZFN can induce double-strand breaks in a target polynucleotide, such as DNA. Double-strand breaks in DNA can lead to DNA break repair, thereby allowing the introduction of one or more gene modifications (e.g., nucleic acid editing). DNA break repair can occur via NHEJ or HDR. In HDR, a donor DNA repair template or template polynucleotide containing a homologous arm flanking the target DNA can be provided. In some embodiments, the ZFN is a zinc finger nickase that induces site-specific single-strand DNA breaks or nicks, thus generating HR. Descriptions of zinc finger nickases can be found, for example, in Ramirez et al., NuclAcids Res [Nucleic Acid Research], 2012, 40(12):5560-8; and Kim et al., Genome Res [Genome Research], 2012, 22(7):1327-33. 4. Transcription activator-like effector nucleases (TALENs)
[0161] In some embodiments, SDN is a transcription activator-like effector nuclease (TALEN). TALEN refers to an engineered transcription activator-like effector nuclease that typically contains a central domain and a cleavage domain of a DNA-binding tandem repeat sequence. TALENs can be generated by fusing the TAL effector DNA-binding domain with the DNA cleavage domain. In some cases, the DNA-binding tandem repeat sequence contains 33-35 amino acids in length and two hypervariable amino acid residues at positions 12 and 13 that can recognize at least one specific DNA base pair. Transcription activator-like effector (TALE) proteins can be fused with nucleases such as wild-type or mutant Fok1 endonuclease or the catalytic domain of Fok1. Several mutations have been made into Fok1 for use in TALENs, such as those improving cleavage specificity or activity. Such TALENs can be engineered to bind any desired DNA sequence. TALENs can be used to generate gene modifications (e.g., nucleic acid sequence editing) by creating double-strand breaks in the target DNA sequence, subsequently undergoing NHEJ or HR. Double-strand breaks in DNA can trigger DNA break repair, allowing the introduction of one or more gene modifications (e.g., nucleic acid editing). DNA break repair can occur via NHEJ or HDR. In HDR, a donor DNA repair template or template polynucleotide containing a homologous arm flanking the target DNA can be provided. In some cases, a single-stranded donor DNA repair template is provided to facilitate HR. Detailed descriptions of TALEN and its use in gene editing can be found in, for example, the following: U.S. Patent Nos. 8,440,431; 8,440,432; 8,450,471; 8,586,363; and 8,697,853; Scharenberg et al., Curr GeneTher [Current Gene Therapy], 2013, 13(4):291-303; Gaj et al., Nat Methods [Nature Methods], 2012, 9(8):805-7; Beurdeley et al., Nat Commun [Nature Communications], 2013, 4:1762; and Joung and Sander, Nat Rev Mol Cell Biol [Nature Reviews: Molecular Cell Biology], 2013, 14(1):49-55. IV. Recombinant nucleic acids
[0162] This document also provides recombinant nucleic acids, i.e., DNA constructs, that can be used with the methods disclosed herein (e.g., hot editing methods). Each DNA construct is a vector envisioned to have essential functional elements that guide and regulate the transcription of the inserted nucleic acid. These functional elements include, but are not limited to, promoters, regions upstream or downstream of the promoter (such as enhancers and terminators that can regulate the transcriptional activity of the promoter), origin of replication, appropriate restriction sites for promoting the cloning of the inserted sequence adjacent to the promoter, antibiotic resistance genes or other markers that can be used to select cells containing the vector or vectors containing the inserted sequence, RNA splicing junctions, transcription termination regions, or any other regions that can be used to promote the expression of the inserted gene or hybrid gene. See generally Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2012. Vectors may be, for example, plasmids. In some embodiments of the DNA constructs and vectors provided herein, the constructs and vectors comprise one or more elements disclosed in Tables 10-18 and any combination of these elements. In some embodiments, the carrier is construct 27145 (SEQ ID NO: 1), 27146 (SEQ ID NO: 2), 27680 (SEQ ID NO: 3), 28255 (SEQ ID NO: 9), 28291 (SEQ ID NO: 10), 28292 (SEQ ID NO: 11), 28293 (SEQ ID NO: 12), 28294 (SEQ ID NO: 13), 25072 (SEQ ID NO: 14), 28825 (SEQ ID NO: 15), or 28834 (SEQ ID NO: 16). V. Conversion Methods
[0163] The recombinant nucleic acids disclosed herein can also be used for the transformation of transgenic cells, plant cells, plants, and / or plant parts. Cell transformation can be stable or transient. "Transformation" can refer to the transfer of nucleic acid molecules into the genome of a host cell, resulting in genetically stable inheritance. In some embodiments, the introduction into plants, plant parts, and / or plant cells is carried out via bacterial-mediated transformation, particle bombardment transformation, calcium phosphate-mediated transformation, cyclodextrin-mediated transformation, electroporation, liposome-mediated transformation, nanoparticle-mediated transformation, polymer-mediated transformation, virus-mediated nucleic acid delivery, whisker-mediated nucleic acid delivery, microinjection, sonication, infiltration, polyethylene glycol-mediated transformation, protoplast transformation, or any other electrical, chemical, physical, and / or biological mechanism or any combination thereof that introduces nucleic acids into plants, plant parts, and / or their cells.
[0164] Procedures for transforming plants are well-known and conventional in the art and are commonly described in the literature. Non-limiting examples of methods for plant transformation include transformation via: bacterial-mediated nucleic acid delivery (e.g., via bacteria from the genus Agrobacterium), virus-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker-mediated nucleic acid delivery, liposome-mediated nucleic acid delivery, microinjection, microparticle bombardment, calcium phosphate-mediated transformation, cyclodextrin-mediated transformation, electroporation, nanoparticle-mediated transformation, sonication, infiltration, PEG-mediated nucleic acid uptake, and any other electrical, chemical, physical (mechanical), and / or biological mechanisms, including any combination thereof, that introduce nucleic acids into plant cells. General guidelines for plant transformation methods known in the art include Miki et al. (“Procedures for Introducing Foreign DNA into Plants” in Methods in Plant Molecular Biology and Biotechnology, edited by Glick, BR and Thompson, JE (CRC Press, Inc., Pocaraton, 1993), pp. 67-88) and Rakowoczy-Trojanowska (Cell Mol Biol Lett 7:849-858 (2002)).
[0165] Agrobacterium-mediated transformation is a common method for transforming plants due to its high transformation efficiency and its wide applicability to many different species. Agrobacterium-mediated transformation typically involves the transfer of a binary vector carrying the target foreign DNA into a suitable Agrobacterium strain, which may depend on the complement of the vir gene carried by the host Agrobacterium strain on a co-existing Ti plasmid or chromosomally (Uknes et al., 1993, Plant Cell 5:159-169). The transfer of the recombinant binary vector into Agrobacterium can be achieved using a three-parental mating procedure with an Escherichia coli carrying the recombinant binary vector, an assistant E. coli strain (carrying a plasmid capable of moving the recombinant binary vector into the target Agrobacterium strain), and a helper E. coli strain. Alternatively, the recombinant binary vector can be transferred into Agrobacterium via nucleic acid transformation (Höfgenh and Willmitzer 1988, Nucleic Acids Res 16:9877).
[0166] Plant transformation via recombinant Agrobacterium typically involves co-culturing Agrobacterium with explants from plants, following methods well-known in the art. Typically, the transformed tissues are regenerated on selective media carrying antibiotic or herbicide resistance markers located between the boundaries of the binary plasmid T-DNA.
[0167] Another method for transforming plants, plant parts, and plant cells involves advancing inert or biologically active particles onto plant tissues and cells. See, for example, U.S. Patent Nos. 4,945,050; 5,036,006, and 5,100,792. Typically, this method involves advancing inert or biologically active particles onto plant cells under conditions that are effective in penetrating the outer surface of the cells and providing incorporation within them. When using inert particles, the particles can be introduced into the cells by coating the particles with a carrier containing the target nucleic acid. Alternatively, one or more cells can be surrounded by a carrier such that the carrier is carried into the cells by excitation of the particles. Biologically active particles (e.g., dried yeast cells, dried bacteria, or bacteriophages, each containing one or more nucleic acids to be introduced) can also be advanced into plant tissues. As used herein, the phrase “gene gun conversion” refers to a method of directly introducing RNA or DNA into cells (e.g., plant cells), wherein the RNA or DNA is mixed with heavy metal particles (e.g., tungsten or gold) and released into the cells (e.g., plant cells) using high-speed pressure to allow the RNA or DNA to penetrate the cells (e.g., penetrate the plant cell wall). VI. Methods of Genotyping
[0168] Genotyping of individuals (e.g., plants) can be performed using various methods to determine whether an HI event has occurred. Genotypes at target polymorphic sites (e.g., genes (e.g., MATL, CENH3), QTLs, or mitochondrial genomic loci) can be determined using various methods. In some embodiments, genotyping is used to determine whether a sample (e.g., a nucleic acid sample) contains a specific variant allele (e.g., genome editing, mutation, or QTL marker) or haplotype. For example, enzymatic amplification of nucleic acids from an individual can be conveniently used to obtain nucleic acids for subsequent analysis. The presence or absence of a specific variant allele (e.g., mutation, or QTL marker) or haplotype at one or more target loci can also be determined directly from the individual's nucleic acids without enzymatic amplification. In some embodiments, individuals are genotyped at one, two, three, four, five, or more polymorphic sites (e.g., single nucleotide polymorphisms (SNPs) at one or more target loci). In some embodiments, individuals are genotyped at one, two, three, four, five or more polymorphic sites at one or more target loci in the mitochondrial genome (e.g., to distinguish NA cellular individuals from other cellular individuals).
[0169] Genotyping of nucleic acids from an individual (whether amplified or not) can be performed using any of a variety of techniques. Useful techniques include, but are not limited to, assays such as polymerase chain reaction (PCR)-based assays, sequence analysis assays, electrophoresis assays, restriction length polymorphism (RLP) assays, hybridization assays, allele-specific hybridization, oligonucleotide ligation, allele-specific extension / ligation, allele-specific amplification, single-base extension, molecular inversion probes, invasive cleavage, selective termination, restriction length polymorphism, sequencing, single-strand conformation polymorphism (SSCP), single-strand polymorphism, mismatch cleavage, and denaturing gradient gel electrophoresis; all of these techniques can be used alone or in combination.
[0170] Nucleic acid-containing materials are routinely obtained from individual plants. Such materials can be any biological material from which nucleic acids can be prepared. As a non-limiting example, the material can be a plant part (e.g., leaf, stem, root, flower or flower part, fruit, pollen, egg cell, zygote, seed, cutting, cell or tissue culture, or any other part or product of the plant) or any plant tissue or other plant part containing nucleic acids. In one embodiment, by practicing the methods disclosed herein through perforation of leaves from seedlings (e.g., in Example 4 below), seedlings can be readily obtained by non-invasive means and used to prepare genomic and / or mitochondrial DNA. In another embodiment, genotyping involves amplifying the nucleic acids of an individual using polymerase chain reaction (PCR).
[0171] Any of a variety of primers can be used to amplify the nucleic acids of an individual by PCR to determine the presence or absence of variant alleles (e.g., mutations or QTL markers) in the plant or method disclosed herein. As will be understood by those skilled in the art, primers used for PCR analysis can be designed based on sequences flanking a target polymorphic site in the target gene. As a non-limiting example, sequence primers may comprise a sequence of about 15 to about 30 nucleotides upstream or downstream of the target polymorphic site in the target gene or locus. Such primers are typically designed to have sufficient guanine and cytosine content to achieve a high melting temperature, which stabilizes the annealing step in the amplification reaction. Several computer programs, such as primer selection, can be used to assist in the design of PCR primers.
[0172] Allele identification assays (e.g., the TaqMan® assay available from Applied Biosystems) can be used to genotype individuals at polymorphic sites, thereby determining the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus. In the TaqMan® allele identification assay, probes labeled with specific fluorescent dyes are constructed for each allele. The probes contain different fluorescent reporter dyes (e.g., FAM and TET) to identify the amplification of each allele. Additionally, each probe has a quenching dye at one end that quenches fluorescence via fluorescence resonance energy transfer. During PCR, each probe specifically anneals to a complementary sequence in the nucleic acid from the individual. The 5' nuclease activity of Taq polymerase is used only to cleave probes that hybridize to the alleles. Cleavage separates the reporter dye from the quenching dye, resulting in enhanced fluorescence through the reporter dye. Therefore, the fluorescent signal generated by PCR amplification indicates which alleles are present in the sample. Mismatches between probes and alleles reduce the efficiency of probe hybridization and cleavage by Taq polymerase, resulting in almost no fluorescent signal. Those skilled in the art will understand that enhanced specificity in allele identification assays can be achieved by conjugating DNA minor groove binder (MGB) groups to DNA probes, as described, for example, in Kutyavin et al., Nuc. Acids Research 28:655-661 (2000). Minor groove binders include, but are not limited to, compounds such as dihydrocyclopyrroloindole tripeptide (DPI3).
[0173] Sequence analysis can also be used to genotype individuals according to the methods described herein to determine the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus. As is known to those skilled in the art, the target variant allele can be detected by sequence analysis using suitable primers designed based on sequences flanking the target polymorphic site in the target gene or locus. For example, variant alleles in a target gene or locus can be detected by sequence analysis using primers designed by those skilled in the art. Additional or alternative sequence primers may contain sequences of about 15 to about 30 nucleotides corresponding to sequences of about 40 to about 400 base pairs upstream or downstream of the target polymorphic site in the target gene or locus. Such primers are typically designed with sufficient guanine and cytosine content to achieve high melting temperatures, which allow for a stable annealing step in the sequencing reaction. Sequence analysis can be performed by any manual or automated method for determining the nucleotide sequence in nucleic acids, including but not limited to chemical and enzymatic methods.
[0174] Electrophoretic analysis can also be used to genotype individuals according to the methods disclosed herein to determine the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus. Electrophoretic analysis involves the process of moving charged molecules (e.g., one or more amplified fragments of nucleic acids) through a stationary medium under the influence of an electric field. Methods of electrophoretic analysis and variations thereof are well known in the art, as described in Ausubel et al., Current Protocols in Molecular Biology, Chapter 2 (Supplement 45), John Wiley & Sons, Inc., New York (1999).
[0175] Restriction fragment length polymorphism (RFLP) analysis can also be used to genotype individuals according to the methods disclosed herein to determine the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus (Jarcho et al. in Dracopoli et al., Current Protocols in Human Genetics, pp. 2.7.1–2.7.5, John Wiley & Sons, New York; Innis et al. (eds.), PCR Protocols, San Diego: Academic Press, Inc. (1990)). RFLP analysis can be performed on PCR amplification products.
[0176] Additionally, allele-specific oligonucleotide hybridization can be used for genotyping of individuals in plants, or as described herein, to determine the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus. Allele-specific oligonucleotide hybridization is based on the use of a labeled oligonucleotide probe having a sequence, for example, perfectly complementary to the sequence covering the variant allele. Under appropriate conditions, the variant allele-specific probe hybridizes with the nucleic acid containing the variant allele, but not with one or more other alleles that have one or more nucleotide mismatches compared to the probe. If desired, a second allele-specific oligonucleotide probe matching an alternative (e.g., wild-type) allele may also be used. Similarly, allele-specific oligonucleotide amplification techniques can be used to selectively amplify, for example, variant alleles, by using allele-specific oligonucleotide primers that are perfectly complementary to the nucleotide sequence of the variant allele but have one or more mismatches compared to other alleles (Mulli et al., ibid.). Those skilled in the art will understand that one or more nucleotide mismatches that distinguish variant alleles from other alleles are typically located at the center of the allele-specific oligonucleotide primers used in allele-specific oligonucleotide hybridization. Conversely, allele-specific oligonucleotide primers used for PCR amplification typically contain one or more nucleotide mismatches at the 3' end of the primer that distinguish variants from other alleles.
[0177] Heteroduplex migration assay (HMA) is another well-known assay that can be used in the plants or methods disclosed herein for genotyping to determine the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus. HMA can be used to detect the presence of variant alleles because mismatched DNA duplexes have reduced migration in polyacrylamide gels compared to duplexes with perfect base pairing (see Delwart et al., Science, 262:1257-1261 (1993); White et al., Genomics, 12:301-306 (1992)).
[0178] Single-strand conformational polymorphism (SSCP) techniques can also be used for genotyping in the plants or methods described herein to determine the presence or absence of specific variant alleles (e.g., mutations or QTL markers) or haplotypes in a target gene or locus (see, Hayashi, Methods Applic., 1:34-38 (1991)). This technique is used to detect variant alleles that differ in the secondary structure of single-stranded DNA, resulting in altered electrophoretic mobility during non-denaturing gel electrophoresis. Variant alleles are detected by comparing the electrophoretic pattern of the test fragment with a corresponding standard fragment containing known alleles.
[0179] Denaturing gradient gel electrophoresis (DGGE) can also be used in the plants or methods disclosed herein to determine the presence or absence of a specific variant allele (e.g., a mutation or QTL marker) or haplotype in a target gene or locus. In DGGE, double-stranded DNA is electrophoresed in a gel containing increasing concentrations of a denaturing agent; double-stranded fragments made from mismatched alleles have fragments that unwind more quickly, causing such fragments to migrate differently compared to perfectly complementary sequences (see, Sheffield et al., “Identifying DNA Polymorphisms by Denaturing Gradient Gel Electrophoresis” in Innis et al., ibid., 1990).
[0180] Other molecular methods for individual genotyping are known in the art and can be used in the plants or methods disclosed herein. Such known genotyping methods include, but are not limited to, automated sequencing and RNase mismatch techniques (see Winter et al., Proc. Natl. Acad. Sci., 82:7575-7579 (1985)). Furthermore, those skilled in the art will understand that when determining the presence or absence of multiple variant alleles, a single variant allele can be detected by any combination of molecular methods. Generally, see Birren et al. (ed.) Genome Analysis: A Laboratory Manual, Volume 1 (DNA Analysis), New York: Cold Spring Harbor Laboratory Press (1997). Additionally, those skilled in the art will understand that multiple variant alleles can be detected in individual reactions or in a single reaction (“multiplex” assay). VII. Plants
[0181] On the other hand, plants, plant parts, or seeds produced by the thermal editing methods provided in this disclosure are provided. The plants produced as described above can be propagated to produce progeny plants, and progeny plants whose genomes have been stably incorporated with gene-edited molecules introduced via one of the donor parent plants can be selected for further propagation if desired. In some embodiments, plant cells, seeds, or plant parts or harvested products can be obtained from the plants produced as described above, and plant cells, seeds, or plant parts can be screened for evidence of gene editing.
[0182] In some embodiments, plant products may be harvested from the plants disclosed above and processed to produce processed products such as flour, coarse flour, oil, starch, etc. These processed products are also within the scope of the invention, provided they contain gene editing introduced by the methods disclosed herein. Other plant products include, but are not limited to, protein concentrates, protein isolates, seed coats, coarse flour, flowers, and oils. VIII. Exemplary Embodiments
[0183] As used below, any reference to a series of embodiments should be understood as a separate reference to each of those embodiments (e.g., "Embodiments 1-4" should be understood as "Embodiments 1, 2, 3 or 4").
[0184] Example 1 is a method for improving editing efficiency in plant cells, the method comprising applying heat treatment to the cells, wherein the cells contain plant genomic DNA, site-directed nucleases, and guide nucleic acids; wherein the editing efficiency of the heat-treated plant cells is improved compared to control plant cells; and wherein the plant cells are haploid plant cells.
[0185] Example 2 is the method described in Example 1, wherein the site-directed nuclease is selected from the group consisting of: meganuclease (MN), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and Cas nuclease.
[0186] Example 3 is the method described in Example 2, wherein the Cas nuclease is a type II Cas nuclease, a type IV Cas nuclease, or a type V Cas nuclease.
[0187] Example 4 describes the method as described in Example 3, wherein the type II Cas nuclease is a Cas9 nuclease, a Cas9 nickase, a Cas9 without nuclease activity, or a Cas9 fused with a heterologous domain.
[0188] Example 5 is the method described in Example 3, wherein the V-type Cas nuclease is a Cas12a nuclease, a Cas12a nickase, a Cas12a without nuclease activity, or a Cas12a fused with a heterologous domain.
[0189] Example 6 is a method as described in any one of Examples 1-5, wherein the guiding nucleic acid is guiding RNA.
[0190] Example 7 is the method as described in Example 1, wherein the haploid plant cell is obtained by hybridizing the donor plant with a haploid inducing line plant.
[0191] Example 8 is the method described in Example 7, wherein the haploid induction line plant is a maternal haploid induction line plant.
[0192] Example 9 is the method as described in Example 8, wherein the maternal haploid inducible line plant contains a knockout mutation in the MATL gene.
[0193] Example 10 is the method described in Example 7, wherein the haploid induction line plant is a paternal haploid induction line plant.
[0194] Example 11 is the method as described in Example 10, wherein the paternal haploid inducible line contains a heterozygous mutation in the CENH3 gene.
[0195] Example 12 is the method described in Example 1, wherein the haploid cell is treated with a chromosome doubling agent to produce double haploid cells.
[0196] Example 13 is the method described in Example 12, wherein the chromosome doubling agent is colchicine, acetylene oxychloride, fluthionine, trifluralin, or other known antimicrotubule agents.
[0197] Example 14 is the method as described in Example 1, wherein the heat treatment includes a temperature between 30°C and 40°C, including the extreme values.
[0198] Example 15 is the method as described in Example 14, wherein the heat treatment includes a temperature between 34°C and 39°C.
[0199] Example 16 is the method as described in Example 15, wherein the heat treatment includes a temperature of 35°C.
[0200] Example 17 is the method as described in Example 1, wherein the heat treatment includes a duration between 12 hours and 72 hours.
[0201] Example 18 is the method as described in Example 17, wherein the heat treatment includes a duration of 24 hours.
[0202] Example 19 is the method as described in Example 1, wherein the heat treatment includes placing the cell in a chamber with an elevated ambient temperature.
[0203] Example 20 is the method as described in Example 1, wherein the heat treatment includes applying a heating pack.
[0204] Example 21 is a method for editing plant genomic DNA, the method comprising: providing an egg cell donor plant containing plant genomic DNA to be edited; pollinating the egg cell donor plant with a pollen donor plant, wherein the pollen donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid; subjecting the pollinated egg cell donor plant of step b to heat treatment; and generating at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor haploid inducing line plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the pollen donor haploid inducing line plant.
[0205] Example 22 is a method for editing plant genomic DNA, the method comprising: providing a pollen donor plant expressing a DNA-modifying enzyme and optionally a guide nucleic acid; subjecting pollen from the pollen donor plant to heat treatment; pollinating an egg cell donor plant with the heat-treated pollen from the pollen donor plant, wherein the egg cell donor plant contains plant genomic DNA to be edited; and generating at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the pollen donor plant.
[0206] Example 23 is the method as described in Example 21 or 22, wherein the pollen donor plant is a haploid inducible line plant.
[0207] Example 24 is the method as described in Example 21 or 22, wherein the pollen donor plant is a maternal haploid inducible line plant.
[0208] Example 25 is the method as described in Example 24, wherein the maternal haploid inducible line contains a knockout mutation in the MATL gene.
[0209] Example 26 is a method for editing plant genomic DNA, the method comprising: providing a pollen donor plant containing plant genomic DNA to be edited; pollinating an egg cell donor plant with pollen from the pollen donor plant, wherein the egg cell donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid; subjecting the pollinated egg cell donor plant of step b to heat treatment; and generating at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the pollen donor plant and does not contain the genome of the egg cell donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and optionally the guide nucleic acid delivered by the egg cell donor plant.
[0210] Example 27 is a method for editing plant genomic DNA, the method comprising: providing a pollen donor plant containing plant genomic DNA to be edited; subjecting pollen from the pollen donor plant to heat treatment; pollinating an egg cell donor plant with the heat-treated pollen from the pollen donor plant, wherein the egg cell donor plant expresses a DNA-modifying enzyme and optionally a guide nucleic acid; and generating at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the pollen donor plant and does not contain the genome of the egg cell donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and the optional guide nucleic acid delivered by the egg cell donor plant.
[0211] Example 28 is the method as described in Example 26 or 27, wherein the egg cell donor plant is a haploid inducible line plant.
[0212] Example 29 is the method as described in Example 26 or 27, wherein the egg cell donor plant is a paternal haploid inducible line plant.
[0213] Example 30 is the method described in Example 29, wherein the paternal haploid inducible line contains a mutation in the CENH3 gene.
[0214] Example 31 is the method as described in Example 30, wherein the paternal haploid inducible line plant is heterozygous for the mutation in the CENH3 gene.
[0215] Example 32 is the method as described in any one of Examples 21-31, wherein at least one of the egg cell donor plant or the pollen donor plant is a maize plant.
[0216] Example 33 is the method as described in Example 32, wherein the maize plant is selected from and / or derived from strains Stock6, RWK, RWS, UH400, NP2222RS, or NP2222.
[0217] Example 34 is the method as described in any one of Examples 21-33, wherein the pollen donor plant is a maize plant.
[0218] Example 35 is the method as described in any one of Examples 21-33, wherein the egg cell donor plant is a maize plant.
[0219] Example 36 is a method as described in any one of Examples 21-35, wherein the DNA-modifying enzyme is a site-directed nuclease selected from the group consisting of: meganuclease (MN), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and Cas nuclease.
[0220] Example 37 is the method described in Example 36, wherein the Cas nuclease is a type II Cas nuclease, a type IV Cas nuclease, or a type V Cas nuclease.
[0221] Example 38 is the method described in Example 37, wherein the type II Cas nuclease is a Cas9 nuclease, a Cas9 nickase, a Cas9 without nuclease activity, or a Cas9 fused with a heterologous domain.
[0222] Example 39 is the method described in Example 38, wherein the V-type Cas nuclease is a Cas12a nuclease, a Cas12a nickase, a Cas12a without nuclease activity, or a Cas12a fused with a heterologous domain.
[0223] Example 40 is the method as described in any one of Examples 21-39, wherein the guiding nucleic acid is guiding RNA.
[0224] Example 41 is a method as described in any one of Examples 21-40, wherein the haploid offspring is treated with a chromosome doubling agent to produce edited double haploid offspring.
[0225] Example 42 is the method described in Example 41, wherein the chromosome doubling agent is colchicine, acetylene oxychloride, fluthionine, trifluralin, or other known antimicrotubule agents.
[0226] Example 43 is the method as described in any one of Examples 21-42, wherein the pollen donor plant expresses a marker gene.
[0227] Example 44 is the method as described in Example 43, wherein the marker gene is selected from the group consisting of: R1, R1-SCM2, R1-nj, GUS, PMI, PAT, GFP, RFP, CFP, B1, CI, anthocyanin pigments or any other marker gene.
[0228] Example 45 is an edited haploid plant produced by the method described in any one of Examples 21-44.
[0229] Example 46 is a progeny plant of an edited haploid plant as described in Example 45. Example
[0230] The following examples involve testing post-pollination environmental conditions to improve overall haploid induction rate (HIR) and haploid editing rate (HER). Applying heat in the HI-editing method has been of particular interest. Example 1. Chromatin is not very dense at high temperatures.
[0231] To test whether heating loosens chromatin or otherwise de-denses it, maize pollen grains were imaged with 4′,6-diamidinyl-2-phenylindole (DAPI) to examine the effect on control ( Figure 1 A) and heat treatment ( Figure 1 B) Sperm nucleus size and morphology. Fresh maize pollen was mixed with mineral oil at a ratio of 1:10 v / v and incubated at room temperature (RT, control) or at 45°C for one hour, then fixed in 3:1 ethanol:acetic acid, subjected to a series of dehydrations, and stained with DAPI according to the protocol provided by S. Heuer et al. MADS box gene ZmMADS2 is specifically expressed in maize pollen and during pollen tube growth, SEXUAL PLANT REPRODUCTION 13:21-27 (2000). Heat treatment resulted in enlargement of the sperm nucleus ( Figure 1 (B), which is consistent with the hypothesis that heat treatment during HI-editing may relax the dense chromatin unique to the sperm nucleus. Example 2. Heating improves haploid editing rate (HER).
[0232] To test whether heat treatment improved haploid induction rate (“HIR”) or haploid editing rate (“HER”), constructs with several CRISPR editing events and HI-editing efficiencies were compared under control or heat treatment. Treatment timeframes ranged from several hours to three days post-pollination. This range, termed the “HI-editing window,” covers the period during which editing could occur before genome elimination. Normal growth conditions were used for control experiments: 25°C–30°C for 15 hours during the day and 16°C–20°C for 9 hours at night.
[0233] Two heat treatment conditions were tested. In the first treatment, termed "heat pack treatment," a heat pack was attached to the corn ear, the husks were wrapped with an insulating layer between the heat pack and the ear, and the pack was replaced every 12 hours to maintain the heat treatment. The heat pack used was a consumer product capable of reaching a temperature of approximately 50°C for approximately 12 hours. See, for example, Thermacare® Muscle Pain Therapy Heat Wrap, thermacare.com / heat-wraps / muscle-pain-therapy / (last accessed: August 15, 2023). In this method, the internal temperature of the ear reached approximately 35°C. The results are shown in Tables 3-4 below.
[0234] In the second heat treatment, known as the “greenhouse warming treatment,” the daytime temperature of the greenhouse was raised to 35°C, and the nighttime temperature was 25°C. The results are shown in Table 5 below.
[0235] Three different constructs were tested: 27145, 27146, and 27680 (Table 10-12). All three constructs contained a Cas12a box, a phosphomannose isomerase (PMI) selective marker box, and a gRNA box expressing gRNA that can complex with the Cas12a protein to edit the Waxy1 gene in maize.
[0236] The inducing line used was NP3003RS, a paternal inducing line containing the matl, dmp haploid inducing genes and the R1-SCM2 color marker gene. Testcrosses were Testcross 8 and Testcross 2, one for stiff stalks and the other for non-stiff stalks. In the control treatment, at least 16, typically more than 20 ears were pollinated, harvested, and embryo rescued to identify the edited haploids. In the heat treatment, six to ten ears were tested per treatment. HIR was calculated based on changes in the R1-SCM2 color marker. Haploids were then sampled using TaqMan® target site assays (Applied Biosystems) and sequenced for the putative edited haploids via next-generation sequencing (NGS). TaqMan® data confirmed true haploids using genotyping results (haploids identified by >99% color change using genotyping were considered true haploids). NGS sequencing data were used to confirm haploid editing and identify the edited sequence, and were used to calculate the final HER.
[0237] The results of experiments using the NP3003RS paternal haploid inducible line for editing at the Waxy1 gRNA site and the GL2 gRNA control site are shown in Tables 3-5 below. Tables 3-5 show the maternal haploid induction rate, haploidity per ear, and haploid editing rate (HER) from heat-treated ears / plants and from the control. HER was determined as described in WO 2015 / 104358.
[0238] Compared to the control (GL2 HER), Waxy1 HER (HI-editing efficiency) was significantly improved in both the heating pack and greenhouse heating treatments—approximately five-fold improvement in the greenhouse heating treatment (Table 5) and more than eight-fold improvement in the heating pack treatment (Tables 3-4). The significant improvement in editing efficiency is surprising.
[0239] In the heat pack treatment, HER jumped in all three events (Table 3), increasing on average from less than 1% in the control to more than 8% in the testcross 2 background. In the testcross 8 background, HER was 5%, compared to 0.2% in its control (Table 2). Therefore, the heat pack treatment had a positive and significant effect on each event. Seed setting rate was lost in both heat pack treatments, but HIR was unaffected. Given published reports of heat treatment increasing HIR in the CENH3 mutant in Arabidopsis, the corresponding negative HIR result is surprising (see Jin et al., ibid.). The reduction in seed setting rate during heat treatment could be mitigated by a more concentrated heat treatment period (e.g., 10 to 34 hours (1 day) post-pollination rather than the approximately 3 to 75 hours (3 days) post-pollination used in this example).
[0240] The improvement in HER was particularly surprising, as it far exceeded the edit rate improvements observed during heat treatment during transformation. The fact that this treatment worked across different boxes and events suggests that it can improve HI-editing efficiency based on box design, the promoter used, or the specific construct tested. Without being bound by theory, the data suggest that the HER improvement may be due to a combination of higher enzymatic activity and higher expression of the CRISPR transgene. Example 3. Another HER test.
[0241] Using the same experimental design as in Example 2, testcross 2 was used to test additional constructs listed in Table 6, containing Cas12a coding sequences linked with different combinations of promoters and terminators, with controls and heat treatment. Each construct carried the same gRNA (Waxy and GL2). For controls, at least 170 haplotypes were tested for each event, and the number of haplotypes treated ranged from 38 to 166 (Table 6). The data again showed a significant increase in haplotype editing rate, a key driver of HI-editing efficiency. Haplotype selection and editing event detection (TaqMan® and NGS) were performed as described in Example 2 above.
[0242] Certain events from the first trial (focusing on the prZmRZDP, prZmVSP, and prSoUbi4 promoters) were selected for re-treatment as controls and heat packs, assuming they had sufficient seed for experiments after selecting the expected homozygous Cas12a-positive events. Testcrosses remained Testcross 2 and Testcross 8. For controls, at least 129 haplotypes were tested for each testcross x-event combination, while for heat treatment, 1 to 226 haplotypes were tested. Haplotype selection and editing event detection (TaqMan® and NGS) were performed as described in Example 2 above. Results are shown in Table 7 (Testcross 8) and Table 8 (Testcross 2) below. Example 4. Paternal Haploid Induction System
[0243] Transformable CENH3 paternal haploid inducible lines were transformed with vector 27241, previously described in international applications PCT / US2017 / 064512, PCT / CN2023 / 110941, and PCT / US2021 / 036605. Vector 27241 carries Cas12a, PMI, and two gRNA cassettes designed for editing genes such as WAXY1. The CENH3 paternal haploid inducible lines are heterozygous (cenh3 + / -) for a 19 bp mutation in the cenh3 coding sequence (generated via Cas12a editing), resulting in a frameshift and premature stop codon. While the CENH3 paternal haploid inducible lines isolated the CENH3 paternal haploid inducible alleles, the lines lacked the maternal inducible alleles. However, they carried the R1-SCM2 color marker under homozygous conditions, allowing for color-based haploid selection. Due to the CENH3 + / - state, when used as a female parent for crossbreeding, the strain has a HIR of 2% to 12%.
[0244] Genotyping of donor plants used to produce immature embryos for transformation of 27241 was performed using a assay called TaqMan® Quantitative PCR Assay 3895, targeting the CENH3 mutant gRNA cleavage site. The primers used in the assay were TCCTTCCGTCTTTTGCAG (SEQ ID NO: 4) and AAGGCAAAAGGAGGGAACTGAT (SEQ ID NO: 5); the TaqMan® probe sequence was TACCTCGGCGACGCC (SEQ ID NO: 6). Transformation donor plants from lines PlantHIe75 and PlantHIe78 without the CENH3 mutation were selected, while those from line PlantHIe77 with the CENH3 mutation were selected. The basic principle was to determine whether the presence of the CENH3 knockout allele under heterozygous conditions affected the transformation efficiency. The transformation efficiencies obtained in the experiments are shown in Table 9.
[0245] The T0 events derived from PlantHIe79 and PlantHIe80 were both wild-type CENH3 mutations, but the event from PlantHIe81 was a mixture of wild-type (12) and heterozygous (8), demonstrating that CENH3+ / - embryos were transformable to some extent, albeit with lower efficiency. However, the CENH3 mutation under heterozygous conditions had a significantly lower transformation rate (2.7%) and a lower seed set rate (explant / heading) compared to experiments using CENH3+ / + donors. The advantage of generating T0 events is that no reintroduction of the knockout allele is required; self-pollination of the T0 event yields CENH3+ / - and CRISPR transgenic homozygous T1 plants. In contrast, the T0 event for CENH3+ / + requires reintroduction of the mutation. Therefore, many events from all four experiments that did not have the CENH3 mutation were retained. To reintroduce the CENH3 mutation into the CENH3+ / + T0 from all three experiments, the ears of the T0 event were pollinated with CENH3(+ / -) plants from lines PlantHIe75 and PlantHIe78. This served to reintroduce the CENH3 mutation into those CRISPR+ lines, but the resulting F1 offspring were only hemizygous for the CRISPR transgene.
[0246] Although those F1 progeny could theoretically be used for HI-editing, the expected 1:1 segregation of the CRISPR molecular system would mean that 50% of the haploid progeny would have no chance of being edited. Therefore, the events shown in Table 10 are advanced to the next generation by self-pollinating Cas12a+ (27241), CENH3+ / - plants (type A) and using those plants as pollen donors to pollinate the fruit spikes of Cas12a+ (27241), CENH3+ / + (type B) plants. This method produces Cas12a and CENH3 segregated seeds. Then, HI-editing donors (Cas12a homozygous, CENH3+ / -) are selected in the next generation.
[0247] In producing seeds for the HI-editing experiments, type B plants (from Table 5) were used as maternal parents and testcrosses 2 and 8 as paternal parents for F1 zygotic assays on some events. This assay is a reliable surrogate indicator of HI-editing haploid editing rate and was therefore used as a means of selecting events with higher HI-editing efficiency. Type B plants from Table 8 were crossed as maternal parents with testcrosses 2 or 8 as paternal parents to produce F1 seeds. These seeds were germinated, and leaves were taken from V2 stage seedlings for TaqMan® assays to identify individuals carrying the Cas12a transgene and edited at gRNA target sites. Plants carrying Cas12a that showed new editing at the Waxy1 site (i.e., no or very little amplification in the “wild-type” assay of Waxy1) were then subjected to PCR and NGS analysis of Waxy1 and other target sites. It was determined that parental editing at the target sites was stably present in the F1 progeny, with read abundance of approximately 50%. The criterion for zygotic editing is the discovery of new edits with a reading abundance >30% in addition to parental edits. Based on this criterion, the average zygotic editing rate for the Waxy1 target is 30%.
[0248] The eight events in Table 11 were prioritized for F1 zygote analysis. This priority was based on consistent editing of Waxy and other target sites seen in the previous generation of TaqMan® data (shown in Table 8 above). Note that, unlike the F1 zygote test where the maternal inducing line was used as the paternal parent, the CRISPR transgenic plant was the maternal parent in this F1 zygote test because, in CENH3 HI-editing, the CRISPR molecular system originates from the maternal side of the hybridization (i.e., the egg cell). This is important because for F1 zygote data to be a relevant surrogate indicator of HI-editing rate, the hybridization direction needs to be the same as the direction that occurred during the HI-editing experiment. Based on the information in Table 9 and the seed availability data shown in Table 5, events PlantHIe94, PlantHIe85, and PlantHIe84 were selected for the HI-editing experiment.
[0249] In the HI-editing efficiency test, four testcrosses representing different maize germplasms (one stiff stalk (testcross 8), two non-stiff stalks (testcross 2 and testcross 9), and one tropical line (testcross 10)) were used as male parents and crossed with T2 Cas12a homozygous, CENH3 + / - knockout ears from three selection events. Haploid selection was determined using color markers, and the ears were then germinated and sampled for sequencing. Haploid editing rate, haploid induction rate, and seed setting rate were measured. A subset of ears were heat-treated using either a room temperature control or a heat pack method (heat packs were wrapped around the ears).
[0250] For each of the three cenh3+ / - HI- editing events in the hybridization matrix, our goal is to generate 100 Cas12a homozygous, cenh3+ / - plants. For each of the 100 plants in each event, our objective is to hybridize each of the four testcross lines with 25 plants, with each plant expected to produce 1 or 2 spikelets. This means our goal is to harvest 30–40 pollinated spikelets per testcross in each event. Each spikelet is expected to produce 20–70 haploids / spittlelets, which will then be subjected to three different heat treatments (heated greenhouse, heated pad, or control), starting immediately after pollination. These numbers will allow us to achieve our objective of assessing the haploid editing rate among more than 300 haploids analyzed from the three events using four testcross lines and three treatments.
[0251] Due to segregation aberrations, the segregation rate of cenh3+ / - progeny plants from cenh3+ / - parents is approximately 10% to 40%. To obtain at least 100 homozygous cenh3+ / - plants, at least 400 seeds from spikelets of Cas12a-HOM, cenh3+ / - parents and at least 1600 seeds from spikelets of Cas12a-HET, cenh3+ / - parents are required.
[0252] For event PlantHIe85, sufficient T2 seeds (over 1000) were produced that were homozygous positive for Cas12a (“Cas12a+-HOM”) and segregated for CENH3, resulting in at least 100 Cas12a-HOM, cenh3+ / - HI-editing plants. For event PlantHIe89, over 1600 F2 seeds were planted to have enough plants to select 100 HI-editing donors. These plants were robust and healthy.
[0253] In the HI-editing efficiency test, four testcross lines were used as male parents and crossed with ears from three selection events (Cas12a homozygous, cenh3 + / - HI-editing donor ears). The induced ears were heat-treated starting about 6 to 10 hours after pollination (the control was not heat-treated).
[0254] In the heated greenhouse treatment, plants were moved to a greenhouse (where the temperature was set at 39°C (compared to the control greenhouse's 26.6°C)) for 24 hours. After treatment, the plants were moved back to the control greenhouse. Ear temperature was monitored using a VersaLog WF-TH 8-channel thermistor data logger. The VersaLog data logger was equipped with eight 10KOHM 3969K NTC thermistors (part number MA100GG103BN, Amphenol Thermometrics). One thermistor was used to monitor the greenhouse air temperature. Additional thermistors were used to monitor the temperature of individual ear temperatures. Representative subsamples of the main or secondary ear were monitored. These additional thermistors were installed between the embryo and the inner husk of the ear. To install the ear thermistors, a 3 mm hole was punctured in the husk at the base of the ear, and the thermistor was inserted upwards into the middle of the ear. The average temperature of the fruit bunches in the heated greenhouse reaches 29.98℃ at night and 32.08℃ during the day.
[0255] In the heating pad treatment, the ears of fruit were directly treated with a heating pad set to 34°C, wrapped around the ears. Heating was regulated using a temperature controller (Drok XY-T01) with a hysteresis setting of 0.5°C. A 10K OHM 3969K NTC thermistor (part number MA100GG103BN) was installed on the temperature controller. The temperature controller thermistor was inserted into the ear, located between the embryo and the inner husk. The heating pad consisted of two 14 cm × 5 cm electric heating pads (ADAFRUIT product number 4308) (connected in parallel and covered with aluminum foil tape). The temperature controller supplied 5V DC power to the heating pad elements. The heating pad was removed after 24 hours of heat treatment. During this treatment, the average internal temperature of the ear was measured to be 32.16°C at night and 33.12°C during the day. The internal temperature of the ear was independently monitored using a VersaLog WF-TH 8-channel thermistor data logger. Monitor representative sub-samples of the main ear or secondary ear.
[0256] Induced ears were harvested approximately 15 days after direct pollination (DAP) and sent to the embryo rescue laboratory for processing. Total grain counts were obtained to calculate haploid induction rate (HIR) and haploid editing rate (HER). After extraction, embryos were sown on Murashige and Skoog (MS) media and placed under continuous light (150 μmol / m²) at 28°C. −2 s −1 The embryos were cultured for 24 hours in a Percival growing room. The total number of embryos (seeds) per ear was recorded. Colorless putative haploid embryos were advanced, and haploid induction rate was determined. After averaging the events and testcrosses, the heating pads reduced the number of seeds per ear compared to the control, resulting in a decrease in haploids per ear. The heated greenhouse, while slightly reducing the seed setting rate, also slightly increased the haploid induction rate, generally leading to an increase in the average number of haploids per ear, depending on the specific event and hybridization.
[0257] Contrary to the mixed results of haploid yield, haploid editing rate (HER) was significantly increased in both the heated greenhouse and heated pad treatments compared to the control. On average, the haploid editing rate was approximately 3-fold higher in the heated greenhouse compared to the control (no heating), and approximately 4-fold higher in the heated pad treatment compared to the control. This was observed in all events and testcross combinations in both the heated greenhouse and heated pad treatments (Tables 13 and 14, based on embryos sent for genotyping).
[0258] Heat treatment significantly improved haploid editing rates, a finding applicable to both Waxy1 and UPL3 gRNAs. This applies not only to embryomes directly placed in 96-well plates but also to plants that have already germinated and been sent to a greenhouse for leaf sampling (Table 15). "HR" indicates the need for heated greenhouse treatment. Example 5. Cas-UBA fusion.
[0259] Most plant proteins are degraded via the ubiquitin / 26S proteasome pathway. Proteins destined for degradation are first covalently tagged with ubiquitin (“UBI”). The UBI receptor delivers the ubiquitinated substrate to the 26S proteasome, where it is degraded. See Dikic, I., Wakatsuki, S., and Walters, KJ (2009). Ubiquitin-binding domains -from structures to functions. Nature Reviews Molecular Cell Biology, 10(10), 659-671. doi.org / 10.1038 / nrm2767. The UBI receptor (UBL-UBA) is highly stable and has a long half-life, protecting these receptors from proteasome degradation by inhibiting the assembly of polyubiquitin chains or preventing the generation of degradation initiation sites. Some studies of UBI chimeric proteins have identified that UBI domains can be used to enhance the stability of target proteins, prolong their half-life, and successfully improve their activity. See, for example, In-Cheol Jang et al., The Plant Journal, 2012 and Xuelian Zheng et al., Frontiers in Plant Science, 2020.
[0260] We tested whether fusing the UBA2 domain of AtRAD23 could improve the stability of Cas12a and assess whether it could enhance HER (haploid editing rate) during HI-editing. Stability events were generated using two constructs: 27680 (encoding LbCas12a and gRNA targeting ZmWx1 and ZmGl2) as a control and 28825 (encoding the LbCas12a-UBA2 fusion and the same gRNA) as the fusion. Editing rates were tested in paternal and maternal inducing lines. In the paternal haploid inducing line NP3003RS, E0 editing rate was measured to demonstrate the functionality of the Cas12a-UBA2 fusion, and E0-F1 zygotic editing rate (ZER%) was measured to observe whether the UBA2 fusion conferred a higher ZER. E1 ZER and HER data were measured by crossing homozygous Cas12a plants as paternal parents with testcrosses 2 and 8. From the maternal side, E1 Cas12a homozygous plants were crossed with testcrosses 2 and 8, and the ZER% at the ZmWx1 locus was measured. No significant differences were observed at the E0 stage (88.2% for Cas12a versus 88.9% for the Casb12a-UBA2 fusion), indicating that the Cas12a-UBA2 fusion is functional. However, the E0-F1 ZER showed significant differences between individual Cas12a and the Cas12a-UBA2 fusion.
[0261] The results showed that, when used as the parent, the Cas12a-UBA2 fusion significantly improved HER% and ZER% (27680) compared to Cas12a alone. Haploid editing quality was unaffected. Applying heat treatment significantly improved ZER%, HER% and haploid editing quality. See Tables 18 and 19. When used as the parent, the Cas12a-UBA2 fusion conferred approximately a 20% increase in ZER% across all treatments. See Table 20. References 1. Blomme, J., et al., "The heat is on: a simple method to increase genome editing efficiency in plants," BMC Plant Biol. 2022 Mar 24;22(1):142. 2.Kurokawa,S.,et al.,“A Simple Heat Treatment Increases SpCas9-Mediated Mutation Efficiency in Arabidopsis,” Plant Cell Physiol (2021). 3.Malzahn,A.A.,et al.,“Application of CRISPR-Cas12a temperaturesensitivity for improved genome editing in rice,maize,and Arabidopsis,” BMCBiol. 17:9 (2019). 4.Li,B.,et al.,“The application of temperature sensitivity CRISPR / LbCpf1 (LbCas12a) mediated genome editing in allotetraploid cotton (G.hirsutum) and creation of nontrans- genic,gossypol-free cotton,” PlantBiotechnol J. 19:221–3 (2021). 5.An,Y.,“Efficient Genome Editing in Populus Using CRISPR / Cas12a,”Front Plant Sci.,Vol. 11,Article 593938 (2020);doi:10.3389 / fpls.2020.593938. 6.Milner,M.J.,et al.. “Turning Up the Temperature on CRISPR:IncreasedTemperature Can Improve the Editing Efficiency of Wheat Using CRISPR / Cas9,”Front Plant Sci. 2020;Vol. 11,Article 583374 (2020);doi:10.3389 / fpls.2020.583374. 7.Huang,Y.,et al.,“HSFA1a modulates plant heat stress responses andalters the 3D chromatin organization of enhancer-promoter interactions,”Nature Communications 14:469 (2023);doi:10.1038 / s41467-023-36227-3. 8.Liang,Z.,“Reorganization of the 3D chromatin architecture of ricegenomes during heat stress,” BMC Biol Vol. 19,Article 53 (2021);doi:10.1186 / s12915-021-00996-4. 9.Das,J.R. & S. Mathur,S.,“HSFA1a:the quarterback of heat stressresponse and 3D-chromatin organization,” Trends Plant Sci. Vol 28,Issue 11,pp. 1198-1200 (2023);doi:10.1016 / j.tplants.2023.07.008. 10.Perrella,G.,et al.,“Epigenetic regulation of thermomorphogenesisand heat stress tolerance,” New Phytologist Vol. 234,Issue 4,pp. 1144-1160(2022);doi:10.1111 / nph.17970. 11.Wang,Z.,et al.,“A simple and highly efficient strategy to induceboth paternal and maternal haploids through temperature manipulation,” Nat.Plants Vol. 9,Issue 5,pp. 699–705 (2023);doi.org / 10.1038 / s41477-023-01389-x. 12.Maruthachalam,M. & Simon W L Chan,S.W.. “Haploid plants producedby centromere-mediated genome elimination.” Nature,Vol. 464,No. 7288,pp. 615-618 (2010);doi:10.1038 / nature08842. 13.Wang,N. et al. “Haploid induction by a maize cenh3 null mutant.”Science Advances,Vol. 7,No. 4,Article eabe2299 (2021);doi:10.1126 / sciadv.abe2299. 14.Jin,C.,et al.,“Heat stress promotes haploid formation duringCENH3-mediated genome elimination in Arabidopsis,” PLANT REPROD 36,147–155(2023);doi:10.1007 / s00497-023-00457-8. 15.Ahmadli, U., et al., "High temperature increases centromere-mediatedgenome elimination frequency and enhances haploid induction in Arabidopsis," PLANT COMMUNICATIONS Vol. 4, Issue 3, Article 100507 (2023), doi: 10.1016 / j.xplc.2022.100507. Components and components
[0262] All patents, patent publications, patent applications, journal articles, books, technical references, etc., discussed in this disclosure are incorporated herein by reference in their entirety for all purposes.
[0263] It should be understood that the figures and descriptions in this disclosure have been simplified to illustrate and clearly understand the elements relevant to this disclosure. It should be understood that the figures are for illustrative purposes and not presented as structural diagrams. Omitted details and modifications or alternative embodiments are within the knowledge of those skilled in the art.
[0264] It is understood that, in certain aspects of this disclosure, a single component may be replaced by multiple components, and multiple components may be replaced by a single component, to provide an element or structure or to perform a given one or more functions. Such substitution is considered to be within the scope of this disclosure unless it would render certain embodiments of this disclosure inoperable.
[0265] The examples presented herein are intended to illustrate potential and specific implementations of this disclosure. It will be understood that these examples are primarily intended for the purpose of explaining this disclosure to those skilled in the art. Variations may be made to these figures or the operations described herein without departing from the spirit of this disclosure. For example, in some cases, method steps or operations may be performed or carried out in a different order, or operations may be added, deleted, or modified.
[0266] Where a numerical range is provided, it should be understood that, unless the context explicitly specifies otherwise, each intermediate value (the smallest fractional value accurate to the lower limit unit) between the upper and lower limits of the range is also specifically disclosed. This covers any smaller range between any stated or non-statement intermediate value in the stated range and any other stated or intermediate value in the stated range. The upper and lower limits of these smaller ranges may be independently included or excluded from the range, and each range in which no one or both limit values are included is also covered by this technique, depending on any limit values specifically excluded from the stated range. Where the stated range includes one or both limit values, it also includes ranges that exclude one or both of those included limit values.
[0267] Numerous specific details have been set forth in the foregoing description to provide a more thorough understanding of the invention. However, it will be apparent to those skilled in the art that the invention described herein can be practiced without one or more of these specific details. In other instances, features and procedures well-known to those skilled in the art have not been described to avoid obscuring the invention. Embodiments of this disclosure have been described for illustrative and not restrictive purposes. While the invention has been described primarily with reference to specific embodiments, other embodiments are contemplated to become apparent to those skilled in the art upon reading this disclosure, and it is intended that such embodiments be included within the methods of the invention. Therefore, this disclosure is not limited to the embodiments depicted above or in the accompanying drawings, and various embodiments and modifications may be made without departing from the scope of the following claims.
Claims
1. A method for editing plant genomic DNA, the method comprising: a. Provide an egg cell donor plant containing the plant genomic DNA to be edited; b. Pollinating the egg cell donor plant with a pollen donor plant, wherein the pollen donor plant expresses DNA-modifying enzymes and optionally directing nucleic acids; c. Apply heat treatment to the pollinated egg cell donor plant from step b; and d. Produce at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor haploid inducing line plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme delivered by the pollen donor haploid inducing line plant and optionally by the guiding nucleic acid.
2. A method for editing plant genomic DNA, the method comprising: a. Provide a pollen donor plant that expresses DNA-modifying enzymes and optionally directs nucleic acids; b. Apply heat treatment to the pollen from the pollen donor plant; c. Pollinating an egg cell donor plant with heat-treated pollen from the pollen donor plant, wherein the egg cell donor plant contains the plant genomic DNA to be edited; and d. Produce at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the egg cell donor plant and does not contain the genome of the pollen donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme delivered by the pollen donor plant and optionally by the guiding nucleic acid.
3. The method of claim 1 or 2, wherein the pollen donor plant is a haploid inducible line plant.
4. The method of claim 1 or 2, wherein the pollen donor plant is a maternal haploid inducible line plant.
5. The method of claim 4, wherein the maternal haploid inducible line contains a knockout mutation in the MATL gene.
6. A method for editing plant genomic DNA, the method comprising: a. Provide pollen donor plants containing plant genomic DNA to be edited; b. Pollinating an egg cell donor plant with pollen from the pollen donor plant, wherein the egg cell donor plant expresses DNA-modifying enzymes and optionally directing nucleic acids; c. Apply heat treatment to the pollinated egg cell donor plant from step b; and d. Produce at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the pollen donor plant and does not contain the genome of the egg cell donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme delivered by the egg cell donor plant and optionally by the guiding nucleic acid.
7. A method for editing plant genomic DNA, the method comprising: a. Provide pollen donor plants containing plant genomic DNA to be edited; b. Apply heat treatment to the pollen from the pollen donor plant; c. Pollinating an egg cell donor plant with heat-treated pollen from the pollen donor plant, wherein the egg cell donor plant expresses DNA-modifying enzymes and optionally directing nucleic acids; and d. Produce at least one edited haploid progeny, wherein (i) the haploid progeny contains the genome of the pollen donor plant and not the genome of the egg cell donor plant, and (ii) the genome of the haploid progeny has been modified by the DNA-modifying enzyme and the optional guide nucleic acid delivered by the egg cell donor plant.
8. The method of claim 6 or 7, wherein the egg cell donor plant is a haploid inducible line plant.
9. The method of claim 6 or 7, wherein the egg cell donor plant is a paternal haploid inducible line plant.
10. The method of claim 9, wherein the paternal haploid inducer plant contains a mutation in the CENH3 gene.
11. The method of claim 10, wherein the paternal haploid inducible line is heterozygous for the mutation in the CENH3 gene.
12. The method according to any one of claims 1-11, wherein at least one of the egg cell donor plant or the pollen donor plant is a maize plant.
13. The method of claim 12, wherein the maize plant is selected from and / or derived from strains Stock 6, RWK, RWS, UH400, NP2222RS, or NP2222.
14. The method of any one of claims 1-13, wherein the pollen donor plant is a maize plant.
15. The method of any one of claims 1-13, wherein the egg cell donor plant is a maize plant.
16. The method of any one of claims 1-15, wherein the DNA-modifying enzyme is a site-directed nuclease selected from the group consisting of: meganucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and Cas nucleases.
17. The method of claim 16, wherein the Cas nuclease is a type II Cas nuclease, a type IV Cas nuclease, or a type V Cas nuclease.
18. The method of claim 17, wherein the type II Cas nuclease is a Cas9 nuclease, a Cas9 nickase, a Cas9 without nuclease activity, or a Cas9 fused with a heterologous domain.
19. The method of claim 18, wherein the V-type Cas nuclease is a Cas12a nuclease, a Cas12a nickase, a Cas12a without nuclease activity, or a Cas12a fused with a heterologous domain.
20. The method of any one of claims 1-19, wherein the guiding nucleic acid is guiding RNA.
21. The method of any one of claims 1-20, wherein the haploid offspring is treated with a chromosome doubling agent to produce edited double haploid offspring.
22. The method of claim 21, wherein the chromosome doubling agent is colchicine, acetylene oxychloride, fluthionine, trifluralin, or other known antimicrotubule agents.
23. The method of any one of claims 1-22, wherein the pollen donor plant expresses a marker gene.
24. The method of claim 23, wherein the marker gene is selected from the group consisting of: R1, R1-SCM2, R1-nj, GUS, PMI, PAT, GFP, RFP, CFP, B1, CI, anthocyanins, and any other marker gene.
25. An edited haploid plant produced by the method described in any one of claims 1-24.
26. A progeny plant of the edited haploid plant as described in claim 25.