Straw fermentation methanogenic saccharomyces cerevisiae engineering bacteria and preparation method and application thereof
By knocking out the ALD6 and ADH1/ADH4 genes in Saccharomyces cerevisiae, an engineered strain of Saccharomyces cerevisiae was constructed. By regulating ethanol and acetaldehyde metabolism, the problem of low methane production efficiency in anaerobic fermentation of wheat straw was solved, and efficient resource utilization of straw and improved gas production stability were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
- Filing Date
- 2026-06-04
- Publication Date
- 2026-07-03
Smart Images

Figure CN122326418A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial engineering technology, and in particular relates to an engineered strain of brewer's yeast that produces methanates through straw fermentation, its preparation method, and its application. Background Technology
[0002] Currently, anaerobic fermentation technology for methanogenesis from wheat straw suffers from technical bottlenecks such as low substrate hydrolysis efficiency, long methanogenesis cycles, and low methane and biogas yields, which are the core factors restricting its large-scale industrial application. Saccharomyces cerevisiae possesses an ethanol-acetic acid metabolic pathway, with the ADH1 and ALD6 genes serving as key hydrolysis genes in this pathway. These genes catalyze the oxidation of ethanol to acetaldehyde and the conversion of acetaldehyde to acetic acid, respectively. Acetic acid is the core direct substrate for methanogens. Acetic acid is further converted to methane via ACS gene catalysis to form acetyl-CoA. Therefore, Saccharomyces cerevisiae is considered a potential biofortification agent to improve the efficiency of methanogenesis from anaerobic fermentation of wheat straw. However, current research on Saccharomyces cerevisiae largely focuses on overexpression modification of hydrolysis genes. It is generally believed that enhancing the ethanol-acetic acid pathway can increase acetic acid production, thereby improving methanogen activity and methane yield. Knocking out key hydrolysis genes blocks the ethanol-acetic acid conversion, reducing the fortification effect of Saccharomyces cerevisiae. However, in practical applications, it has been found that this understanding deviates significantly from the actual fermentation effect. No research has yet systematically confirmed the differentiated enhancement effects of Saccharomyces cerevisiae, Saccharomyces cerevisiae with knockout of hydrolytic genes, and Saccharomyces cerevisiae with overexpression of hydrolytic genes on the methanogenesis of wheat straw through anaerobic fermentation. There is also a lack of supporting biofortification methods and special microbial agents that can significantly improve the efficiency of anaerobic fermentation of wheat straw.
[0003] Therefore, developing an engineered Saccharomyces cerevisiae strain that effectively enhances methanogenesis through anaerobic fermentation of wheat straw, clarifying the enhancement effects of different genetically modified Saccharomyces cerevisiae, and developing a simple and efficient fermentation method to overcome the technical bottlenecks of existing anaerobic fermentation of wheat straw have become the current research focus and application demand in this field. Summary of the Invention
[0004] Therefore, the purpose of this invention is to provide an engineered brewing yeast strain for producing methanogens from straw fermentation, its preparation method, and its application.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a brewer's yeast engineered strain that produces methanates through straw fermentation. The brewer's yeast engineered strain is constructed by knocking out one or more of the ALD6, ADH1, and ADH4 genes of brewer's yeast BY4741.
[0006] Preferably, the engineered Saccharomyces cerevisiae is constructed by knocking out the ALD6 gene of Saccharomyces cerevisiae BY4741 and is named ALD6 gene single knockout strain; the engineered Saccharomyces cerevisiae is constructed by knocking out the ADH1 and ADH4 genes of Saccharomyces cerevisiae BY4741 and is named ADH1 / ADH4 double gene knockout strain.
[0007] This invention provides a method for preparing the above-mentioned engineered brewer's yeast, comprising the following steps: Saccharomyces cerevisiae engineered strains were prepared by knocking out one or more of the ALD6, ADH1, and ADH4 genes in Saccharomyces cerevisiae BY4741 using a screening marker replacement method combined with homologous recombination technology.
[0008] Preferably, when the engineered Saccharomyces cerevisiae is an ALD6 gene knockout strain, the preparation method of the ALD6 gene knockout strain includes: Using a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.6 and SEQ ID NO.7 to obtain the first round of PCR products; Using the first-round PCR product as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.10 and SEQ ID NO.11 to obtain the second-round PCR product, which yielded the ALD6 gene knockout fragment. The ALD6 gene knockout fragment was transformed into Saccharomyces cerevisiae BY4741 competent cells to obtain ALD6 gene knockout strain.
[0009] Preferably, when the engineered Saccharomyces cerevisiae is an ADH1 / ADH4 double gene knockout strain, the preparation method of the ADH1 / ADH4 double gene knockout strain includes: Using a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.14 and SEQ ID NO.15, to obtain the first round of PCR product a; Using the first-round PCR product a as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.18 and SEQ ID NO.19 to obtain the second-round PCR product a, which yielded the ADH1 gene knockout fragment. Using a universal plasmid of Saccharomyces cerevisiae carrying the his3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences shown in SEQ ID NO.24 and SEQ ID NO.25, to obtain the first round of PCR product b; Using the first-round PCR product b as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.28 and SEQ ID NO.29 to obtain the second-round PCR product b, which yielded the ADH4 gene knockout fragment. The ADH4 gene knockout fragment was transformed into Saccharomyces cerevisiae BY4741 competent cells to obtain ADH4 gene knockout bacteria. The ADH1 gene knockout fragment was transformed into competent cells of ADH4 gene knockout bacteria to obtain ADH1 / ADH4 dual gene knockout bacteria.
[0010] This invention provides the application of Saccharomyces cerevisiae BY4741, the above-mentioned engineered Saccharomyces cerevisiae, or the engineered Saccharomyces cerevisiae prepared by the above preparation method in the preparation of methane.
[0011] Preferably, the viable count of either the brewer's yeast BY4741 or the engineered brewer's yeast strain is ≥1×10⁻⁶. 8 CFU / mL.
[0012] This invention provides a method for producing methane through straw fermentation, comprising the following steps: The brewing yeast BY4741, the above-mentioned engineered brewing yeast strains, or the engineered brewing yeast strains prepared by the above-mentioned preparation method are mixed with the fermentation substrate for fermentation. The fermentation substrate is straw and anaerobic activated sludge.
[0013] Preferably, the mass ratio of straw to anaerobic activated sludge is 25~30:155~165; the straw is wheat straw; the raw material for the anaerobic activated sludge is activated sludge from a wastewater treatment plant; the total TS of the anaerobic activated sludge is 12.55%±0.10%, and the total VS is 5.44%±0.02%; the total TS of the fermentation substrate is 12%~17%, and the total VS is 9.5%~10%; the fermentation is anaerobic fermentation; the fermentation temperature is 32~37℃, and the fermentation time is 20~28 days.
[0014] Preferably, the wheat straw is wheat straw powder that has been pulverized through a 15-25 mesh sieve; the TS of the wheat straw powder is 91.34%±0.04%, and the VS is 74.57%±0.31%; the preparation method of the anaerobic activated sludge includes the following steps: mixing the activated sludge from the wastewater treatment plant with water, anaerobically incubating at 32-37℃ for 10-15 days, stirring once every 1-3 days to obtain anaerobic activated sludge.
[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an engineered brewer's yeast strain for methanogenesis through straw fermentation. This engineered brewer's yeast strain can effectively regulate the dynamic balance between acid production and acid consumption in the fermentation system, alleviate acidification inhibition in the early stage of fermentation, improve the stability of the system's microenvironment, provide suitable conditions for the growth and metabolism of methanogenic bacteria, and optimize the coupling and matching degree between substrate hydrolysis efficiency and methanogenesis efficiency, significantly improving the cumulative methanogenesis and gas production stability of straw anaerobic fermentation.
[0016] This invention provides a method for preparing engineered brewing yeast strains that produce methanates through straw fermentation. This method is simple and easy to scale up for production.
[0017] The method for producing methane from straw fermentation provided by this invention is convenient, requires no additional pH adjustment of the fermentation system, is compatible with industrial straw anaerobic fermentation processes, and can realize the efficient resource utilization of agricultural waste such as wheat straw. It has both economic and environmental value and has broad prospects for promotion and application. Attached Figure Description
[0018] Figure 1 This is an electrophoresis image for PCR verification of a single knockout strain of the ALD6 gene (IALD). Lanes 1-4 are candidate IALD strains, lane 5 is the wild-type BY4741 control, and lane 6 is the DNA molecular weight standard.
[0019] Figure 2The images show two-step PCR verification electrophoresis results for ADH1 / ADH4 double gene knockout strains. (A) shows the verification electrophoresis results for ADH4 single knockout strains. In the positive screening results, lanes 1, 3, and 6 are non-positive transformants; lanes 2, 4, 5, 7, and 8 are candidate ADH4 single knockout strains; lane 9 is the wild-type BY4741 control; and lane 10 is the DNA molecular weight standard. In the reverse screening results, lanes 1 and 20 are the DNA molecular weight standards; and lanes 2, 4, 7, and 11 are... Lanes 1, 13, and 16 (corresponding to lanes 1, 3, and 6 in the positive screening results) are non-positive transformants still containing the ADH4 wild-type sequence; lanes 3, 5, 6, 8, 9, 12, 14, 15, 17, and 18 (corresponding to lanes 2, 4, 5, 7, and 8 in the positive screening results) are positive transformants without the ADH4 wild-type band, i.e., candidate ADH4 single knockout strains; lanes 10 and 19 are wild-type BY4741 controls; (B) is the ADH1 / ADH4 double knockout strain AD H1 verification electrophoresis results show that in the positive screening results, lanes 1-5 are candidate ADH1 knockout strains, lane 6 is the wild-type BY4741 control, and lane 7 is the DNA molecular weight standard. In the reverse screening results, lanes 1, 3, 4, 5, 6, 10, 12, 13, 14, and 15 are candidate ADH1 knockout strains, lanes 2, 7, 11, and 16 are non-positive transformants still containing the wild-type ADH1 sequence, and lanes 8 and 17 are the wild-type BY4741 control. 9 and 18 are DNA molecular weight standards; (C) is the verification electrophoresis diagram of ADH1 / ADH4 double knockout strain ADH4. In the positive screening results, lanes 1-5 are candidate ADH4 knockout strains, lane 6 is wild-type BY4741 control, and lane 7 is DNA molecular weight standard; in the reverse screening results, lanes 1-5 and 8-12 are candidate ADH4 knockout strains, lanes 6 and 13 are wild-type BY4741 control, and lanes 7 and 14 are DNA molecular weight standards.
[0020] Figure 3 Electrophoresis images for insertion verification of the ALD6 overexpression cassette on chromosome XI of Saccharomyces cerevisiae: (A) Electrophoresis image for verification of the HL-ALD6 interface, lanes 1-20 are ALD6 overexpression cassette transformants, lane 21 is the DNA molecular weight standard; (B) Electrophoresis image for verification of the GAP-CYC1 interface, lanes 1-4 are ALD6 overexpression cassette transformants, lane 5 is the DNA molecular weight standard; (C) Electrophoresis image for verification of the ALD6-HR interface, lanes 1-4 are ALD6 overexpression cassette transformants, lane 5 is the DNA molecular weight standard.
[0021] Figure 4 The effect of different groups on pH during anaerobic fermentation of wheat straw.
[0022] Figure 5 The effect of different groups on the daily methane concentration produced by anaerobic fermentation of wheat straw.
[0023] Figure 6 The effect of different groups on the daily methane production from anaerobic fermentation of wheat straw.
[0024] Figure 7 The effect of different groups on the cumulative methanogenesis of wheat straw anaerobic fermentation is shown in the figure. Different letters indicate significant differences between groups, p < 0.05.
[0025] Figure 8 The effect of different groups on the degradation rate of wheat straw by anaerobic fermentation TS.
[0026] Figure 9 The effects of different groups on the anaerobic fermentation and degradation rate of wheat straw. Detailed Implementation
[0027] This invention provides a brewer's yeast engineered strain that produces methanates through straw fermentation. The brewer's yeast engineered strain is constructed by knocking out one or more of the ALD6, ADH1, and ADH4 genes of brewer's yeast BY4741.
[0028] In this invention, gene editing technology is used to modify the genes of Saccharomyces cerevisiae that regulate the metabolism of compounds such as ethanol and acetaldehyde (ALD6, ADH1 and ADH4 genes), and combined with wild-type Saccharomyces cerevisiae BY4741, to provide a variety of engineered Saccharomyces cerevisiae strains adapted to anaerobic fermentation of straw. This breaks through the bottleneck of the current method of using only wild-type Saccharomyces cerevisiae to enhance the effect of straw fermentation and methanogenesis, and achieves precise control of the fermentation system.
[0029] In this invention, the engineered Saccharomyces cerevisiae strain is preferably constructed by knocking out the ALD6 gene of Saccharomyces cerevisiae BY4741, and is named ALD6 gene knockout strain; the engineered Saccharomyces cerevisiae strain is preferably constructed by knocking out both the ADH1 and ADH4 genes of Saccharomyces cerevisiae BY4741, and is named ADH1 / ADH4 double gene knockout strain. This invention has found that the ALD6 gene knockout strain (IALD) or the ADH1 / ADH4 double gene knockout strain exhibits better methane production through straw fermentation than the wild-type Saccharomyces cerevisiae BY4741, with the ALD6 gene knockout strain producing the highest cumulative methane yield, achieving optimal efficiency of "low hydrolysis and high gas production." The wild-type Saccharomyces cerevisiae BY4741 strain, on the other hand, has the advantages of low cost and simple cultivation.
[0030] This invention provides a method for preparing the above-mentioned engineered brewer's yeast, comprising the following steps: Saccharomyces cerevisiae engineered strains were prepared by knocking out one or more of the ALD6, ADH1, and ADH4 genes in Saccharomyces cerevisiae BY4741 using a screening marker replacement method combined with homologous recombination technology.
[0031] In this invention, when the engineered Saccharomyces cerevisiae is an ALD6 gene knockout strain, the preparation method of the ALD6 gene knockout strain includes: using a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker as a DNA template, and using upstream and downstream primers with sequences as shown in SEQ ID NO.6 and SEQ ID NO.7 to perform a first round of PCR amplification to obtain the first round of PCR products; Using the first-round PCR product as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.10 and SEQ ID NO.11 to obtain the second-round PCR product, which yielded the ALD6 gene knockout fragment. The ALD6 gene knockout fragment was transformed into Saccharomyces cerevisiae BY4741 competent cells to obtain ALD6 gene knockout strain.
[0032] In this invention, the sequence of the universal plasmid (pRS416) carrying the ura3 selection marker for *Saccharomyces cerevisiae* is shown in SEQ ID NO. 3. The system for the first round of PCR amplification was as follows: 7.5 μL of 2× high-fidelity KOD, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of 10 ng / μL *Saccharomyces cerevisiae* universal plasmid carrying the ura3 selection marker as DNA template, and sterile ddH2O to a final volume of 15 μL. The program for the first round of PCR amplification was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 68℃ extension for 50 s, 30 cycles; 98℃ denaturation for 10 s, final extension for 5 min. The second round of PCR amplification consisted of: 7.5 μL of 2× high-fidelity KOD enzyme, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of template (10-fold diluted first-round PCR purified product), and sterile ddH2O to a final volume of 15 μL. The procedure for the second round of PCR amplification was the same as that for the first round. The competent cells of *Saccharomyces cerevisiae* BY4741 were prepared from *Saccharomyces cerevisiae* BY4741 using a LiAC / PEG-mediated method. This invention does not impose any specific limitations on the LiAC / PEG-mediated method; conventional methods in the art can be used.
[0033] In this invention, when the engineered Saccharomyces cerevisiae is preferably an ADH1 / ADH4 double gene knockout strain, the preparation method of the ADH1 / ADH4 double gene knockout strain includes: Using a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.14 and SEQ ID NO.15, to obtain the first round of PCR product a; Using the first-round PCR product a as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.18 and SEQ ID NO.19 to obtain the second-round PCR product a, which yielded the ADH1 gene knockout fragment. Using a universal plasmid of Saccharomyces cerevisiae carrying the his3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences shown in SEQ ID NO.24 and SEQ ID NO.25, to obtain the first round of PCR product b; Using the first-round PCR product b as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.28 and SEQ ID NO.29 to obtain the second-round PCR product b, which yielded the ADH4 gene knockout fragment. The ADH4 gene knockout fragment was transformed into Saccharomyces cerevisiae BY4741 competent cells to obtain ADH4 gene knockout bacteria. The ADH1 gene knockout fragment was transformed into competent cells of ADH4 gene knockout bacteria to obtain ADH1 / ADH4 dual gene knockout bacteria.
[0034] In this invention, the sequence of the universal plasmid (pRS416) carrying the ura3 selection marker for *Saccharomyces cerevisiae* is shown in SEQ ID NO. 3. During the amplification of the ADH1 gene knockout fragment, the first round of PCR amplification consisted of: 7.5 μL of 2× high-fidelity KOD, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of 10 ng / μL *Saccharomyces cerevisiae* universal plasmid carrying the ura3 selection marker as DNA template, and sterile ddH2O to a final volume of 15 μL. The program for the first round of PCR amplification was: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 68℃ extension for 50 s, 30 cycles; 98℃ denaturation for 10 s, final extension for 5 min. The second round of PCR amplification consisted of: 7.5 μL of 2× high-fidelity KOD enzyme, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of template (10-fold diluted first-round PCR purified product), and sterile ddH2O to a final volume of 15 μL. The procedure for the second round of PCR amplification was the same as that for the first round.
[0035] In this invention, the universal plasmid of *Saccharomyces cerevisiae* carrying the his3 selection marker (pRS413) is shown in SEQ ID NO. 21. When amplifying the ADH4 gene knockout fragment, the first round of PCR amplification consisted of: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of 10 ng / μL *Saccharomyces cerevisiae* universal plasmid carrying the his3 selection marker as template, and sterile ddH2O to a final volume of 15 μL. The program for the first round of PCR amplification was: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 68℃ extension for 50 s, 30 cycles; 98℃ denaturation for 10 s, final extension for 5 min. The second round of PCR amplification consisted of: 7.5 μL of 2× high-fidelity KOD enzyme, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of template (10-fold diluted first-round PCR purified product), and sterile ddH2O to a final volume of 15 μL. The procedure for the second round of PCR amplification was the same as that for the first round.
[0036] This invention provides the application of Saccharomyces cerevisiae BY4741, the above-mentioned engineered Saccharomyces cerevisiae, or the engineered Saccharomyces cerevisiae prepared by the above preparation method in the preparation of methane.
[0037] In this invention, the viable count of either the brewer's yeast BY4741 or the engineered brewer's yeast strain is ≥1×10⁻⁶. 8 CFU / mL.
[0038] This invention provides a method for producing methane through straw fermentation, comprising the following steps: The brewing yeast BY4741, the above-mentioned engineered brewing yeast strains, or the engineered brewing yeast strains prepared by the above-mentioned preparation method are mixed with the fermentation substrate for fermentation. The fermentation substrate is straw and anaerobic activated sludge.
[0039] In this invention, the preferred mass ratio of straw to anaerobic activated sludge is 25-30:155-165, more preferably 26-29:158-162, and even more preferably 27.26:160.15; the straw is wheat straw, preferably wheat straw powder pulverized through a 15-25 mesh sieve, more preferably wheat straw powder pulverized through a 17-23 mesh sieve, and even more preferably wheat straw powder pulverized through a 20 mesh sieve; the TS of the wheat straw powder is 91.34%±0.04%, and the VS is 74.57%±0.31%. The raw material for the anaerobic activated sludge is activated sludge from a wastewater treatment plant; the total sludge (TS) of the anaerobic activated sludge is 12.55% ± 0.10%, and the total sludge volume (VS) is 5.44% ± 0.02%; the total TS of the fermentation substrate is 12%~17%, such as 15%, and the total VS is 9.5%~10%, such as 9.68%; the fermentation is anaerobic fermentation; the fermentation temperature is preferably 32~37℃, more preferably 33~36℃, and even more preferably 35℃; the fermentation time is 20~28 days, more preferably 22~26 days, and even more preferably 24 days. The preparation method of the anaerobic activated sludge includes the following steps: mixing the activated sludge from the wastewater treatment plant with water, anaerobically incubating at 32~37℃ for 10~15 days, stirring once every 1~3 days, to obtain the anaerobic activated sludge. The mass-to-volume ratio of activated sludge to water in the wastewater treatment plant is 4.0-5.0 kg: 200-300 mL, more preferably 4.2-4.5 kg: 250-280 mL; the anaerobic culture is further preferably conducted at 33-36℃ for 12-15 days. As a preferred embodiment, 4.54 kg of activated sludge from the wastewater treatment plant is mixed with 270 mL of water and anaerobic cultured at 35℃ for 15 days, with stirring every 2 days, to obtain anaerobic activated sludge. The viable count of the *Saccharomyces cerevisiae* BY4741 and the aforementioned engineered *Saccharomyces cerevisiae* strains is ≥1×10⁻⁶. 8 CFU / mL. The mass ratio of the brewer's yeast BY4741, the above-mentioned engineered brewer's yeast, straw, and anaerobic activated sludge is 8~8.5:8~8.5:25~30:155~165, more preferably 8.1:8.1:27.26:160.15.
[0040] The method for producing methane from straw fermentation of the present invention does not require additional pH adjustment throughout the entire process.
[0041] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.
[0042] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0043] In the following embodiments, the *Saccharomyces cerevisiae* BY4741 is the strain described in Wang X, Zhao Y, Hou Z, Chen X, Jiang S, Liu W, et al. Large-scale pathway reconstruction and colorimetric screening accelerate cellular metabolism engineering. Metabolic Engineering, 2023; 80:107–118. S. cerevisiae strain BY4741 (MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0).
[0044] The complete limit culture medium (CM) per liter consists of the following components: 6.7g of amino acid-free yeast nitrogen source (Sangon Biotech (Shanghai) Co., Ltd., product name: Yeast Nitrogen Source, amino acid-free, alias: YNB, product number A610507-0500), 20g of glucose, 150mg of threonine, 30mg of tyrosine, 150mg of valine, 30mg of lysine, 100mg of glutamic acid, 150mg of serine, 100mg of aspartic acid, 20mg of methionine, 50mg of phenylalanine, 30mg of isoleucine, 20mg of arginine, 50mg of adenine, 50mg of uracil, 100mg of histidine, 100mg of leucine, and 100mg of tryptophan. The pH is natural. The medium is brought to a final volume of 1000mL with deionized water.
[0045] The complete limit solid medium is prepared by adding 20g of agar powder to 1 liter of complete limit medium and mixing well.
[0046] The difference between CM-U deficient solid medium (uracil-deficient) and complete limit solid medium is that CM-U deficient solid medium does not contain uracil, while other components and their contents are the same as those of complete limit solid medium. It is used for screening gene knockout positive strains.
[0047] The difference between CM-H deficient solid medium (histidine deficient) and complete limit solid medium is that CM-H deficient solid medium does not contain histidine, while other components and their contents are the same as those of complete limit solid medium. It is used for screening gene overexpression positive strains.
[0048] The competent cells of Saccharomyces cerevisiae BY4741 were prepared by the LiAC / PEG-mediated method. The present invention does not have any particular limitation on the specific method of the LiAC / PEG-mediated method, and conventional methods in the field can be used.
[0049] Salmon sperm DNA is a commercially available double-stranded DNA reagent extracted and purified from salmon sperm, and it is also a universal standard carrier DNA in the LiAc / PEG chemical transformation method of Saccharomyces cerevisiae.
[0050] Example 1 Construction and testing of gene knockout engineered strains of Saccharomyces cerevisiae In this embodiment, Saccharomyces cerevisiae BY4741 was used as the chassis strain. The ura3 selection marker replacement method combined with homologous recombination technology was used to construct an ALD6 gene single knockout strain (IALD) and an ADH1 / ADH4 double gene knockout strain (double knockout). The specific steps are as follows: 1.1 PCR amplification of gene substitution fragments containing homologous arms of the target gene 1.1.1 Amplification of the ALD6 gene knockout fragment Using a universal plasmid of *Saccharomyces cerevisiae* carrying the ura3 selection marker (pRS416) as a DNA template, homologous arms of the ALD6 gene (NCBI reference sequence of the ALD6 gene: NC_001148.4) were added to the ura3 fragment through two rounds of PCR. The amplified ura3 functional fragment was generated sequentially from the core promoter region of the *Saccharomyces cerevisiae* URA3 gene (the nucleotide sequence of the core promoter of the *Saccharomyces cerevisiae* URA3 gene is: 5'-CGAAGATAAATCATGTCGAAAGC-3' (SEQ ID NO).1)) and the complete coding region (the nucleotide sequence of the complete coding region is: 5'--3' (SEQ ID NO.2)) are combined to obtain the ura3 replacement fragment with 80bp homologous arms of the ALD6 gene at each end. The relevant two rounds of PCR amplification steps are as follows: The sequence of the universal plasmid (pRS416) carrying the ura3 selection marker for Saccharomyces cerevisiae is as follows:
[0051] First round of PCR: Primers were designed with 40bp homologous arms of the ALD6 gene added to both ends of the ura3 fragment, upstream and downstream of the fragment. The forward sequence of the upstream 40 bp homologous arm of the first round ALD6 gene is: 5'-CAATTCGAAGTGTTCAGTCTTTTACTTCTCTTGTTTTATA-3' (SEQ ID NO.4); The forward sequence of the 40 bp downstream homologous arm of the first round ALD6 gene is: 5'-CACAAAATACTTTCATATAAACTTACTTGGTCTTACGTCA-3' (SEQ ID NO.5).
[0052] The upstream primer sequence for the first round of PCR was: 5'-CAATTCGAAGTGTTCAGTCTTTTACTTCTCTTGTTTTATAGATTGTACTGAGAGTGCAC-3' (SEQ ID NO.6); The downstream primer sequence for the first round of PCR is: 5'-TGACGTAAGACCAAGTAAGTTTATATGAAAGTATTTTGTGGTGCGGTATTTCACACCGC-3' (SEQ ID NO.7).
[0053] The 15μL first-round amplification system consisted of: 7.5μL of 2× high-fidelity enzyme KOD, 0.2μL of 10μM first-round PCR upstream primer, 0.2μL of 10μM first-round PCR downstream primer, 1μL of 10ng / μL ura3 gene plasmid (a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker) template, and sterile ddH2O to a final volume of 15μL. Amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 68℃ extension for 50 s, 30 cycles; 98℃ denaturation for 10 s, final extension for 5 min.
[0054] Second round PCR: Using the first round PCR product as a template, primers were designed to extend the homologous arms to 80 bp upstream and downstream, where: The second round of PCR added the forward sequence of the upstream 40bp homologous arm of the ALD6 gene: 5'-TGATATCATATATAAATGTAATAAGAAGTTTGGTAATATT-3' (SEQ ID NO.8); The second round of PCR added the forward sequence of the 40bp downstream homologous arm of the ALD6 gene: 5'-TAAATAAATATGTATACATATAAATTAAAAAATTTGGTTT-3' (SEQ ID NO.9).
[0055] The upstream primer sequence for the second round of PCR is: 5'-TGATATCATATATAAATGTAATAAGAAGTTTGGTAATATTCAATTCGAAGTGTTCAGTC-3' (SEQ ID NO.10); The downstream primer sequence for the second round of PCR is: 5'-AAACCAAATTTTTTAATTTATATGTATACATATTTATTTATGACGTAAGACCAAGTAAG-3' (SEQ ID NO.11).
[0056] The second round of PCR amplification used the purified product from the first round of PCR diluted 10-fold as the DNA template. A total of 6 parallel reactions were set up. The second round amplification system in a single tube was as follows: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM second round PCR upstream primer, 0.2 μL of 10 μM second round PCR downstream primer, 1 μL of the template product from the first round of PCR diluted 10-fold, and sterile ddH2O to a final volume of 15 μL. Amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 68℃ extension for 50 s, 30 cycles; 98℃ denaturation for 10 s, final extension for 5 min, to obtain the ura3 replacement fragment with 80 bp ALD6 homologous arms at each end. The second-round PCR product 1 was purified using a nucleic acid purification kit and brought to a final volume of 20 μL to obtain the purified second-round PCR product 1, which was stored at -20℃ for later use. The ALD6 gene knockout fragment is the purified second-round PCR product 1.
[0057] 1.1.2 Amplification of ADH1 / ADH4 double gene knockout fragment In this embodiment, knockout fragments were constructed using dual auxotrophic selection markers. Both fragments were amplified using the same two-round PCR method as described in 1.1.1, yielding specific knockout fragments for the ADH1 and ADH4 genes, as detailed below: 1.1.2.1 Amplification of ADH1 gene knockout fragment Using a universal plasmid of *Saccharomyces cerevisiae* carrying the ura3 selection marker (named pRS416, sequence shown in SEQ ID NO.3) as a DNA template, homologous arms of the ADH1 gene (NCBI reference sequence of the ADH1 gene: NC_001147.6) were added to the ura3 fragment through two rounds of PCR. The amplified ura3 functional fragment consisted of the core promoter region of the *Saccharomyces cerevisiae* URA3 gene (nucleotide sequence of the core promoter of the *Saccharomyces cerevisiae* URA3 gene shown in SEQ ID NO.1) and the complete coding region (nucleotide sequence of the complete coding region shown in SEQ ID NO.2), obtaining an ura3 replacement fragment with 80bp ADH1 homologous arms at each end. The relevant two rounds of PCR amplification steps are as follows: The forward sequence of the upstream 40 bp homologous arm of the first round ADH1 gene is: 5'-CTGCACAATATTTCAAGCTATACCAAGCATACAATCAACT-3' (SEQ ID NO.12); The forward sequence of the 40 bp downstream homologous arm of the first round ADH1 gene is: 5'-AAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGG-3' (SEQ ID NO.13).
[0058] The upstream primer sequence for the first round of PCR was: 5'-CTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTGATTGTACTGAGAGTGCAC-3' (SEQ ID NO.14); The downstream primer sequence for the first round of PCR is: 5'-CCTGACCTACAGGAAAGAGTTACTCAAGAATAAGAATTTTGTGCGGTATTTCACACCGC-3' (SEQ ID NO.15).
[0059] The first-round amplification system consisted of: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM upstream primer for the first-round PCR, 0.2 μL of 10 μM downstream primer for the first-round PCR, 1 μL of 10 ng / μL ura3 gene plasmid (a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker) template, and sterile ddH2O to a final volume of 15 μL.
[0060] The second round of PCR added the forward sequence of the upstream 40bp homologous arm of the ADH1 gene: 5'-TCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTT-3' (SEQ ID NO.16); The second round of PCR added the forward sequence of the 40bp downstream homologous arm of the ADH1 gene: 5'-TTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACC-3' (SEQ ID NO.17).
[0061] The upstream primer sequence for the second round of PCR is: 5'-TCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCT-3' (SEQ ID NO.18); The downstream primer sequence for the second round of PCR is: 5'-GGTCAATAAGAGCGACCTCATGCTATACCTGAGAAAGCAACCTGACCTACAGGAAAGAG-3' (SEQ ID NO.19).
[0062] The second round of PCR amplification used the purified product from the first round of PCR diluted 10-fold as the DNA template. A total of 6 parallel reactions were set up. The single-tube second round amplification system consisted of: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM second round PCR upstream primer, 0.2 μL of 10 μM second round PCR downstream primer, 1 μL of the template product from the first round of PCR diluted 10-fold, and sterile ddH2O to a final volume of 15 μL.
[0063] The amplification procedures for both rounds of PCR were consistent with 1.1.1, ultimately yielding the ura3 gene replacement fragment with 80bp ADH1 homologous arms at each end. The second-round PCR product 2 was purified using a nucleic acid purification kit, and the volume was adjusted to 20μL. The purified second-round PCR product 2 was stored at -20℃ for later use. The ADH1 gene knockout fragment is the purified second-round PCR product 2.
[0064] 1.1.2.2 Amplification of ADH4 gene knockout fragment Using a universal plasmid of *Saccharomyces cerevisiae* carrying the his3 selection marker (named pRS413) as a DNA template, homologous arms of the ADH4 gene (NCBI reference sequence of the ADH4 gene: NC_001139.9) were added to the his3 fragment via two rounds of PCR. The amplified his3 functional fragment coding region sequence was 5'-3' (SEQ ID NO.20), obtaining a his3 replacement fragment with 80bp ADH4 homologous arms at each end. The relevant two rounds of PCR amplification steps are as follows: The sequence of the universal plasmid for Saccharomyces cerevisiae carrying the his3 selection marker (pRS413) is as follows:
[0065] The forward sequence of the upstream 40bp homologous arm of the ADH4 gene is: 5'-TTTAGTTCGCGCATCACGAGGTACGTGTTTAATATGTCAG-3' (SEQ ID NO.22); The forward sequence of the 40bp downstream homologous arm of the ADH4 gene is: 5'-AAAAATCGAACGAACTCATAAACGTCAATTATGCGTGTGC-3' (SEQ ID NO.23).
[0066] The upstream primer sequence for the first round of PCR was: 5'-TTTAGTTCGCGCATCACGAGGTACGTGTTTAATATGTCAGGATTGTACTGAGAGTGCAC-3' (SEQ ID NO.24); The downstream primer sequence for the first round of PCR is: 5'-GCACACGCATAATTGACGTTTATGAGTTCGTTCGATTTTTGTGCGGTATTTCACACCGC-3' (SEQ ID NO.25).
[0067] The first-round amplification system consisted of: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM upstream primer for the first-round PCR, 0.2 μL of 10 μM downstream primer for the first-round PCR, 1 μL of 10 ng / μL Saccharomyces cerevisiae universal plasmid carrying the his3 selection marker as DNA template, and sterile ddH2O to a final volume of 15 μL.
[0068] The second round of PCR added the forward sequence of the upstream 40bp homologous arm of the ADH4 gene: 5'-GCAGTGGATTAGCTATGAAAAAAAAAAAAAAGAACTAGTT-3' (SEQ ID NO.26); The second round of PCR added the forward sequence of the 40bp downstream homologous arm of the ADH4 gene: 5'-CTTATTTATTTAGTTGTGCGTACAGTATAATGCACTTATT-3' (SEQ ID NO.27).
[0069] The upstream primer sequence for the second round of PCR is: 5'-GCAGTGGATTAGCTATGAAAAAAAAAAAAAAGAACTAGTTTTTAGTTCGCGCATCACGA-3' (SEQ ID NO.28); The downstream primer sequence for the second round of PCR is: 5'-AATAAGTGCATTATACTGTACGCACAACTAAATAAATAAGGCACACGCATAATTGACGT-3' (SEQ ID NO.29).
[0070] The second round of PCR amplification used the purified product from the first round of PCR diluted 10-fold as the DNA template. A total of 6 parallel reactions were set up. The single-tube second round amplification system consisted of: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM second round PCR upstream primer, 0.2 μL of 10 μM second round PCR downstream primer, 1 μL of the template product from the first round of PCR diluted 10-fold, and sterile ddH2O to a final volume of 15 μL.
[0071] The amplification procedure was consistent with 1.1.1, ultimately yielding a his3 gene replacement fragment with 80bp ADH4 homologous arms at each end. The second-round PCR product 3 was purified using a nucleic acid purification kit, and the volume was adjusted to 20μL to obtain the purified second-round PCR product 3, which was stored at -20℃ for later use. The ADH4 gene knockout fragment is the purified second-round PCR product 3.
[0072] 1.2 Chemical transformation of Saccharomyces cerevisiae BY4741 (LiAC / PEG-mediated method) 1.2.1 Construction of ALD6 gene knockout strain (IALD) The ALD6 gene knockout fragment prepared in 1.1.1 was transformed into Saccharomyces cerevisiae BY4741 competent cells using a general yeast chemical transformation method: (1) Seed culture: A single colony of Saccharomyces cerevisiae BY4741 was inoculated into 2 mL of YPD liquid medium and cultured overnight at 30°C and 220 rpm on a shaker. (2) Logarithmic phase culture: Transfer to 5 mL YPD medium and culture at 30℃ and 220 rpm until the logarithmic phase; (3) Preparation of competent cells: Centrifuge at 3500 rpm for 5 min to collect the colony pellet, resuspend in 1 mL ddH2O, centrifuge at 8000 rpm for 2 min and discard the supernatant; resuspend in 500 μL 0.1 M LiAC / TE buffer, centrifuge at 8000 rpm for 2 min and discard the supernatant; finally resuspend in 100 μL 0.1 M LiAC / TE buffer to obtain competent cells, and keep on ice for later use; (4) Transformation system preparation: salmon sperm DNA was heated in a metal bath at 100℃ for 5 min and cooled in an ice bath for 4 min to obtain denatured salmon sperm DNA; the transformation mix (85 μL / tube) was prepared: 62.4 μL 50% (w / v) PEG3350, 8.22 μL 1M LiAc, 9.58 μL DMSO, and 5 μL denatured salmon sperm DNA; 20 μL of purified target fragment (ALD6 gene knockout fragment) was added to the mix, followed by 20 μL of competent cells, and the mixture was stirred well. (5) Incubation and heat shock: Incubate in a water bath at 30℃ for 35 min, heat shock at 42℃ for 15 min, centrifuge at 8000 rpm for 2 min and discard the supernatant; (6) Screening culture: The bacterial cells were resuspended in 100 μL ddH2O and spread on CM-U Deficit Solid Medium. The cells were incubated upside down at 30℃ for 2 days. Once single colonies grew, positive knockout strains were screened to obtain ALD6 gene single knockout strains (IALD).
[0073] 1.2.2 Construction of ADH1 / ADH4 double gene knockout strain Construction process of double knockout strain: Following the method in 1.2.1, the ADH4 gene knockout fragment prepared in 1.1.2.2 is first transformed into competent cells to complete the ADH4 gene knockout and verify it, thus obtaining the ADH4 knockout strain. Then, using the ADH4 knockout strain as the chassis, the ADH1 gene knockout fragment prepared in 1.1.2.1 is transformed into competent cells of the ADH4 knockout strain to achieve double knockout of ADH1 / ADH4 genes. Positive knockout strains are screened to obtain the ADH1 / ADH4 double gene knockout strain.
[0074] 1.3 PCR Validation of Positive Knockout Strains 1.3.1 Initial screening by colony PCR ALD6 single knockout: Single colonies were picked from CM-U plates and PCR was performed using internal primers for the ALD6 gene and upstream and downstream primers for the genome. Wild-type Saccharomyces cerevisiae BY4741 was used as a control. The candidate positive strain (IALD) was the one that had no internal band and amplified the target band containing the ALD6 gene knockout fragment.
[0075] ADH1 / ADH4 double knockout: First verify ADH1 knockout, then verify ADH4 knockout. Use internal primers of the ADH1 and ADH4 genes and upstream and downstream primers of the genome to confirm that both genes have been replaced by the target fragment.
[0076] 1.3.2 Genome Validation Genomic DNA was extracted from candidate positive strains, and the above PCR verification was repeated. Figure 1The results showed that the amplified band size of the ALD6 gene knockout strain (IALD) was consistent with the expected knockout fragment, and there was no wild-type ALD6 band.
[0077] Lanes 1, 3, and 6 showed no target bands, indicating incorrect integration of the selection marker; these were non-positive transformants. Lanes 2, 4, 7, 11, 13, and 16 amplified bands consistent with the wild type, indicating non-positive transformants still containing the ADH4 wild-type sequence. Therefore, the ADH1 / ADH4 double-gene knockout strain, after verification by both positive and negative screening, amplified the corresponding replacement bands without any endogenous ADH1 or ADH4 bands (see...). Figure 2 The electrophoresis results were consistent with the initial screening, confirming the successful construction of the knockout strain.
[0078] 1.4 Preservation of bacterial strains The verified ALD6 gene knockout strain and ADH1 / ADH4 double gene knockout strain were inoculated into YPD liquid medium, cultured at 30°C for 24 h, and then stored in 60% glycerol tubes at -80°C for long-term preservation.
[0079] ALD6 gene knockout strains are denoted as IALD strains, and ADH1 / ADH4 double gene knockout strains are denoted as double knockout strains.
[0080] Example 2 Construction and Detection of Gene-Overexpressing Saccharomyces cerevisiae Engineered Strains In this embodiment, *Saccharomyces cerevisiae* BY4741 was used as the chassis strain. Four homologous fragments were co-transformed (HR-GAP, GAP-ALD6, ALD6-CYC1, CYC1-HL), and directly integrated into chromosome XI of *Saccharomyces cerevisiae* via homologous recombination to obtain an ALD6 overexpressing engineered strain (EALD). The specific steps are as follows: 2.1 PCR amplification and purification of homologous recombination fragments 2.1.1 Amplification of Four Core Fragments Using the genome of Saccharomyces cerevisiae BY4741 as a template, specific primers were designed, and PCR amplification yielded four homologous recombination fragments, each of which carried a homologous arm of the previous fragment. HR-GAP fragment: contains upstream homologous arm HR + HIS3 selection marker + GAP promoter, wherein the upstream homologous arm HR sequence is 5'--3' (SEQ ID NO.30); the sequence of the HIS3 selection marker is the same as the his3 functional fragment coding region sequence in the amplification of the partial ADH4 gene knockout fragment in 1.1.2.2 (SEQ ID NO.20).The GAP promoter sequence is 5'-3' (SEQ ID NO.31). The upstream primer sequence is 5'-CAGTCCGTCTCTCATCTTTGTTTGTTTATGTGTG-3' (SEQ ID NO.32), and the downstream primer sequence is 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO.33).
[0081] GAP-ALD6 fragment: contains GAP promoter + ALD6 gene coding region, wherein the GAP promoter sequence is the same as the GAP promoter sequence in the HR-GAP fragment, and the ALD6 gene sequence is the same as the ALD6 gene coding region sequence in the ALD6 gene knockout fragment amplification in 1.1.1 (the NCBI reference sequence number of the ALD6 gene is NC_001148.4, which is the sequence from position 432588 to 434090 on chromosome XVI of this sequence number).
[0082] The upstream primer sequence is 5'-CAGTCCGTCTCTAGCTGAATTCCCCGGGTCTAGAGGT-3' (SEQ ID NO. 34), and the downstream primer sequence is 5'-CAGTCCGTCTCTGCTACAACTTAATTCTGACAGCTTTTAC-3' (SEQ ID NO. 35).
[0083] The ALD6-CYC1 fragment consists of the ALD6 gene coding region and a CYC1 terminator, wherein the ALD6 gene coding region sequence is identical to that in the GAP-ALD6 fragment (NCBI reference sequence: NC_001148.4). The CYC1 terminator sequence is: 5'-GCAAATTAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGTTACATGCGTACACGCGTTTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATTAAAAAAAATAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGTGGGAGGAGGGGCGTGAATGTAAGCGTGACATAACTAATTACATGA-3' (SEQ ID NO.36). The upstream primer sequence is 5'-CAGTCCGTCTCTGATGACTAAGCTACACTTTGACAC-3' (SEQ ID NO.37), and the downstream primer sequence is 5'-CAGTCCGTCTCAGTGCCCTCGAGCTGCAGACCGGTACTA-3' (SEQ ID NO.38).
[0084] CYC1-HL fragment: CYC1 terminator + downstream homologous arm HL, where the CYC1 sequence is the same as the CYC1 sequence (SEQ ID NO.36) in the ALD6-CYC1 fragment, and the downstream homologous arm HL sequence is 5'-GCGAACTGGATCTTGCGATCGTTTTTGAAAGACGAAGTCAGGATGCTATACCAGGAATCATCATCACTGTCAAGTTCGTTGTAATTTGGTAGAAGGTAATCAGCGTCCCGCCCAAGTCCGTTACGCTGCGGTGAATTTGACCAGATAAACGTTATAATGATGATCTGCAGTAGAATCAGTGGAAGGAGAATGCGCCTTAATGGGTAGTGCTTGACACGCAGCAGGCCAGATAAGAACCGCCTGTGAAGTTTAGATGATATTCGCTGAAGCATAACTAATTAGTTTATTTGTGTGAAGGAATAGTGACGTTGTGATGCGGTGAGTTCGGCGGTTAGGGGAATGGTATATGATAAAAAACGGAAACGTGCTTCTTTAATTTAATTGTTTAATATTGTTGCAGATATATAAAAAGGGGGAAAGAACCAAAGATGTAATTATTTCTTTATTGCCTCAACCTAAAGCAAGCAATAAGGTATAGAGATCAGGACGTCTCGAGAGCTGATATCAAATTTGAAGCCACGCAAGTAACTACGTAGGTCAGAGGGCACAAGGAATAACACGTGACATTTTTCTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTGTTAGTCTTGGCTTCTGTGCCGTAGTCTGTATACGGTTTTAGATGCGGTATGTTTATCATCGCCCAGAAATTTGCGGGGTGCAAAGAAATAAAATCCGTGCTGAAACCCGTGCTGAAATCCGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGCGC-3' (SEQ ID NO.39). The upstream primer sequence is 5'-CAGTCCGTCTCGTAGCTCATGTAATTAGTTATGTCACG-3' (SEQ ID NO.40), and the downstream primer sequence is 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO.41).
[0085] The PCR amplification system for each fragment was as follows: 7.5 μL of 2× high-fidelity enzyme KOD, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of template DNA, and sterile ddH2O to a final volume of 15 μL.
[0086] Amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 68℃ extension (1 kb / 10 s), 30 cycles; 98℃ denaturation for 10 s, final extension for 5 min.
[0087] 2.1.2 Purification and Concentration The four fragments were purified separately using a nucleic acid purification kit, and each was brought to a final volume of 50 μL. After mixing, the fragments were concentrated to 20 μL by rotary evaporation to increase the fragment concentration and enhance the homologous recombination efficiency. They were then stored at -20°C for later use.
[0088] 2.2 Chemical transformation of Saccharomyces cerevisiae BY4741 Referring to the LiAC / PEG-mediated method in section 1.2 of Example 1, 20 μL of concentrated mixed homologous recombinant fragments (HR-GAP fragment, HR-GAP fragment, ALD6-CYC1 fragment, or CYC1-HL fragment) were transformed into BY4741 competent cells. The selection plate was replaced with CM-H deficient solid medium (histidine deficient), and the cells were incubated upside down at 30°C for 2 days until single colonies grew.
[0089] 2.3 PCR Validation of Positive Overexpression Strains 2.3.1 Interface PCR Validation Single colonies were selected from CM-H plates. Specific verification primers were designed for the three ligation interfaces of the four homologous recombination fragments. Colony PCR was performed, with wild-type BY4741 as a control. If the target band of the expected size was amplified at all three interfaces, the strain was identified as a candidate positive strain.
[0090] 2.3.2 Genome Validation The candidate positive strains were cultured in a larger scale, and the genomic DNA of the candidate ALD6 overexpressing strains was extracted. The DNA was then verified by PCR amplification of three key interfaces: HL-ALD6, GAP-CYC1, and ALD6-HR.
[0091] Figure 3 Electrophoresis results showed that both the HL-ALD6 and GAP-CYC1 interfaces amplified a single, clear target band, while the ALD6-HR interface amplified a main band of the expected size (with a small amount of non-specific amplification), indicating that the ALD6 overexpression cassette had been completely integrated into the Saccharomyces XI chromosome, resulting in an ALD6 gene overexpression positive strain (EALD).
[0092] 2.4 Strain Preservation The verified EALD strain was inoculated into YPD liquid medium, cultured at 30°C for 24 hours, and then stored in 60% glycerol tubes at -80°C for long-term preservation.
[0093] Example 3 Experiment on methanogenesis enhanced by brewer's yeast agent in wheat straw anaerobic fermentation This embodiment uses the standard strain of Saccharomyces cerevisiae BY4741, the IALD strain and double-knock strain constructed in Example 1, and the EALD strain constructed in Example 2 as raw materials to prepare microbial agents, verify their enhancing effect on methanogenesis by anaerobic fermentation of wheat straw, clarify the differences in enhancing effect among different strains, and provide experimental basis for practical application.
[0094] 3.1 Preparation of Saccharomyces cerevisiae inoculum Each *Saccharomyces cerevisiae* strain (standard strain BY4741, the IALD and double-knockout strains constructed in Example 1, and the EALD strain constructed in Example 2) from the cryopreserved tubes was inoculated into YPD medium and cultured at 35°C with shaking at 150 rpm for 24 h. The culture was then passaged twice. The cells were collected by centrifugation, washed 2-3 times with sterile physiological saline, and resuspended in sterile physiological saline. The effective viable count of each *Saccharomyces cerevisiae* strain was adjusted to approximately 1 × 10⁻⁶ cells / year. 8 CFU / mL yields corresponding inoculum preparations of wild-type Saccharomyces cerevisiae BY4741, ALD6 gene knockout strain, ADH1 / ADH4 double gene knockout strain, or ALD6 gene overexpression strain, which are stored at 4℃ for later use.
[0095] 3.2 Construction of Fermentation System and Experimental Grouping 3.2.1 Basic Fermentation System The fermentation substrate was wheat straw. The wheat straw was crushed and passed through a 20-mesh sieve. The total solids content (TS) of the wheat straw was controlled to be 91.34±0.04% and the VS to be 74.57±0.31%. No additional physical or chemical modification was required to obtain pretreated wheat straw.
[0096] The inoculum was taken from activated sludge from the long-term operating Yangling Wastewater Treatment Plant in Shaanxi Province. 4.54 kg of the activated sludge was added to 270 mL of sterile water, stirred thoroughly, and anaerobically cultured at 35°C for 15 days, with stirring every 2 days, to obtain sludge inoculum with high microbial activity (denoted as anaerobic activated sludge). The TS of the sludge inoculum was 12.55 ± 0.10%, and the VS was 5.44 ± 0.02%.
[0097] Take 500mL anaerobic serum bottles, add 27.26g of pretreated wheat straw and 160.15g of anaerobic activated sludge to each bottle, add sterile water to make up to 300mL, stir well, purge with high-purity nitrogen for 2min to remove oxygen from the bottle, seal and statically anaerobic ferment in a 35℃ constant temperature incubator for 24d. The total TS of the fermentation system is 15% and the total VS is 9.68%. The pH is not adjusted separately throughout the process (referred to as the sterile group).
[0098] 3.2.2 Experimental Grouping Five experimental groups were set up (sterile group, standard strain group, IALD group, double knockout group, and EALD group), with three replicates per group. Compared with the sterile group, the strain dosage for the standard strain group, IALD group, double knockout group, and EALD group was 2.7% (w / v, i.e., 8.1 g) of the total fermentation system. The strains for the standard strain group, IALD group, double knockout group, and EALD group were added after "adding sterile water to a final volume of 300 mL" as described in section 3.2.1, and before "stirring evenly." After thorough mixing, the mixture was placed in a static anaerobic incubator at 35℃ for 24 days. The total TS of the fermentation system was 15%, and the total VS was 9.68%. No additional pH adjustment was performed throughout the process. The specific groupings are as follows: Aseptic group: No brewer's yeast inoculant was added, serving as a blank control; Standard strain group: 8.1g of wild-type Saccharomyces cerevisiae BY4741 strain prepared in part 3.1 was added; IALD group: 8.1g of ALD6 gene knockout strain inoculum prepared in part 3.1 was added; Double knockout group: 8.1g of the ADH1 / ADH4 double gene knockout strain agent prepared in part 3.1 was added; EALD group: 8.1g of ALD6 gene overexpressing strain prepared in part 3.1 was added as an effect control.
[0099] 3.3 Detection Indicators The sterile group, standard strain group, IALD group, double knockout group, and EALD group were co-cultured and fermented simultaneously. Throughout the fermentation period, the pH value, daily methane concentration, and daily methane production of each fermentation system were measured every 2 days. The results are as follows: Figures 4-6 As shown; after fermentation, the cumulative methane production of each fermentation system was calculated, and the results are as follows. Figure 7 As shown; after fermentation, the total TS and VS values of the total fermentation system were measured, and the TS and VS degradation rates of the total fermentation system were calculated. The results are shown in the figure. Figure 8 , Figure 9 As shown.
[0100] 3.4 Test Results pH value can directly reflect the dynamic balance of acid production / consumption, substrate hydrolysis intensity, and microenvironment stability in an anaerobic fermentation system. It is a key indicator for evaluating whether a fermentation system is suitable for the growth and metabolism of methanogens.
[0101] Figure 4 The results showed that in the early stage of fermentation (0-2 days), the pH value decreased rapidly, and the rate of decrease could be ranked as follows: IALD > EALD > sterile > standard strain > double knockout. This indicates that both IALD and EALD promoted acid production, but this may be due to different metabolic pathways (acetaldehyde accumulation for emergency acid production / efficient acetic acid production but delayed initial acid consumption), resulting in a similar net accumulation of acidic products. This may provide more precursors for subsequent methanogenesis. The double knockout group significantly hindered substrate hydrolysis and reduced acid production due to the deletion of genes ADH1 / ADH4. The standard strain group showed a smaller decrease in pH than the sterile group. In the middle stage of fermentation (2-12 days), the pH of all groups recovered to the suitable range of 6.8-7.2 for methanogens, with the group with added Saccharomyces cerevisiae inoculum showing a better recovery. In the middle and late stages, the pH of the group with added Saccharomyces cerevisiae inoculum was significantly higher than that of the sterile group, which was more suitable for the growth and reproduction of methanogens, laying the microenvironmental foundation for subsequent efficient methanogenesis.
[0102] Figure 5 The results showed that the daily methane concentration in the IALD, double-knockout, and EALD groups was higher than that in the aseptic group throughout the fermentation process. At the peak gas production period (day 4), the daily methane concentration ranking was: double-knockout group > IALD group > EALD group > standard strain group, demonstrating the advantage of gene knockout strains in terms of less acidic product inhibition during the gas production burst. After the peak, the methane concentration in the double-knockout group decreased sharply, significantly lower than that in the IALD group; the methane concentration in the EALD group remained at a relatively low level throughout, indicating that the higher acidity in the early fermentation stage inhibited the growth of methanogenic bacteria. In the later fermentation stage (days 12-24), the methane concentrations in all Saccharomyces cerevisiae inoculum groups were higher than those in the aseptic group.
[0103] Figure 6 This indicates that the trend of daily methane production is highly consistent with the methane concentration. At the peak gas production period (day 4), the daily methane production of each group was ranked as follows: double-knock group > IALD group > EALD group > standard strain group. The double-knock group, with its stronger gas production burst, increased daily methane production by 73.23% compared to the standard strain group; the IALD group increased by 54.16% compared to the standard strain group; while the EALD group only increased by 26.20% compared to the standard strain group, indicating a weak enhancement effect. After the peak period, the daily methane production of the double-knock group rapidly declined, significantly lower than that of the IALD group; the daily methane production of the EALD group remained low throughout; the IALD group and the standard strain group maintained relatively stable gas production rates, with the IALD group showing a slower decline rate and superior sustained gas production capacity.
[0104] Figure 7The results showed that after 24 days of fermentation, the cumulative methanogenesis of the standard strain group, IALD group, double knockout group, and EALD group was significantly higher than that of the sterile group, clearly confirming the effectiveness of *Saccharomyces cerevisiae* in enhancing methanogenesis through anaerobic fermentation of wheat straw. However, the enhancement effect of the engineered strain differed from theoretical expectations. Theoretically, the hydrolysis gene knockout groups (IALD group and double knockout group) should have lower gas production than the standard strain group due to the blockage of the ethanol-acetic acid conversion pathway and the reduction of methanogenic precursor (acetic acid) production; the EALD group should have achieved the optimal cumulative methanogenesis by enhancing the ethanol-acetic acid conversion pathway and increasing the activity of methanogenic bacteria. However, the actual cumulative methanogenesis ranking was: IALD > double knockout > standard strain > EALD > sterile, demonstrating the complexity of microbial metabolic pathways. This also indicates that although the hydrolysis gene of *Saccharomyces cerevisiae* was knocked out, it may still exhibit an enhancing effect on methanogenesis through other metabolic pathways or due to the inhibition of lower acidity products. The cumulative methanogenesis of the standard strain group, IALD group, double knockout group, EALD group and sterile group after 24 days of fermentation were 21.13±4.18 mL / g·VS, 27.11±3.93 mL / g·VS, 22.51±2.76 mL / g·VS, 20.16±0.79 mL / g·VS and 14.24±3.34 mL / g·VS, respectively.
[0105] Figure 8 and Figure 9 The results showed that, after fermentation, except for the standard strain, the total TS and VS degradation rates of all fermentation systems exhibited a highly consistent trend. The EALD group had the highest TS and VS degradation rates among all groups, indicating that ALD6 gene overexpression significantly improved the hydrolysis efficiency of wheat straw. This is consistent with the severe acidification and low pH observed in this group during the initial fermentation stage. The IALD group and the double-knockout group had lower TS and VS degradation rates than the CK group and the sterile group, with the double-knockout group showing the lowest rate. This indicates that the knockout of the hydrolysis gene indeed hindered the substrate hydrolysis process. Therefore, the lower pH in the IALD group may be due to the activation of other acid-producing pathways, whose acid production is more favorable for methanogens.
[0106] The results indicate that all standard strains, the IALD group, the double knockout group, and the EALD group can enhance methanogenesis through anaerobic fermentation of wheat straw. The gene knockout Saccharomyces cerevisiae showed the best results, but the core mechanism is not simply dependent on the strength of the ethanol-acetic acid conversion pathway. Rather, it is achieved by regulating the coupling degree between hydrolysis efficiency and methanogenesis efficiency, as well as the stability of the fermentation microenvironment. Although the EALD group improved substrate hydrolysis efficiency through ALD6 overexpression, excessive acetic acid accumulation in the early stages of fermentation may cause irreversible activity inhibition of the methanogens, resulting in a large amount of hydrolysis products failing to be converted into methane, ultimately manifesting as "high hydrolysis, low gas production." The double knockout group, due to the knockout of the hydrolysis gene, reduced the hydrolysis rate, avoiding rapid accumulation of acidic products and alleviating initial acidification inhibition, allowing the methanogens to maintain high activity and achieve efficient conversion of hydrolysis products into methane, ultimately manifesting as "low hydrolysis, high gas production." The IALD group had a higher cumulative methanogenesis than the double knockout group. Considering economic factors, both the standard strain of Saccharomyces cerevisiae BY4741 and the engineered strain of Saccharomyces cerevisiae with the ALD6 gene knocked out can be selected as effective inoculum sources for preparing inoculum agents to enhance the anaerobic fermentation of wheat straw to produce methane.
[0107] In summary, this invention provides an engineered strain of Saccharomyces cerevisiae and its application and method in enhancing anaerobic fermentation of straw for methanogenesis. The engineered Saccharomyces cerevisiae described in this invention can significantly enhance anaerobic fermentation of straw for methanogenesis, effectively improve the cumulative gas production and the stability of the fermentation system, and has basic biofortification effects. It also provides a variety of biofortification agents for the resource utilization of agricultural waste through anaerobic fermentation.
[0108] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A type of engineered brewing yeast for methanogenesis from straw fermentation, characterized in that, The engineered Saccharomyces cerevisiae strain was constructed by knocking out one or more of the ALD6, ADH1, and ADH4 genes of Saccharomyces cerevisiae BY4741.
2. The engineered brewer's yeast according to claim 1, characterized in that, The engineered Saccharomyces cerevisiae strain was constructed by knocking out the ALD6 gene of Saccharomyces cerevisiae BY4741 and named the ALD6 gene single knockout strain; the engineered Saccharomyces cerevisiae strain was constructed by knocking out the ADH1 and ADH4 genes of Saccharomyces cerevisiae BY4741 and named the ADH1 / ADH4 double gene knockout strain.
3. The method for preparing engineered Saccharomyces cerevisiae according to claim 1 or 2, characterized in that, Includes the following steps: Saccharomyces cerevisiae engineered strains were prepared by knocking out one or more of the ALD6, ADH1, and ADH4 genes in Saccharomyces cerevisiae BY4741 using a screening marker replacement method combined with homologous recombination technology.
4. The preparation method according to claim 3, characterized in that, When the engineered Saccharomyces cerevisiae is an ALD6 gene knockout strain, the preparation method of the ALD6 gene knockout strain includes: Using a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences shown in SEQ ID NO.6 and SEQ ID NO.7 to obtain the first round of PCR products; Using the first-round PCR product as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.10 and SEQ ID NO.11 to obtain the second-round PCR product, which yielded the ALD6 gene knockout fragment. The ALD6 gene knockout fragment was transformed into Saccharomyces cerevisiae BY4741 competent cells to obtain ALD6 gene knockout strain.
5. The preparation method according to claim 3, characterized in that, When the engineered Saccharomyces cerevisiae is an ADH1 / ADH4 double gene knockout strain, the preparation method of the ADH1 / ADH4 double gene knockout strain includes: Using a universal plasmid of Saccharomyces cerevisiae carrying the ura3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences shown in SEQ ID NO.14 and SEQ ID NO.15, to obtain the first round of PCR product a; Using the first-round PCR product a as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.18 and SEQ ID NO.19 to obtain the second-round PCR product a, which yielded the ADH1 gene knockout fragment. Using a universal plasmid of Saccharomyces cerevisiae carrying the his3 selection marker as a DNA template, the first round of PCR amplification was performed using upstream and downstream primers with sequences shown in SEQ ID NO.24 and SEQ ID NO.25, to obtain the first round of PCR product b; Using the first-round PCR product b as a template, a second round of PCR amplification was performed using upstream and downstream primers with sequences as shown in SEQ ID NO.28 and SEQ ID NO.29 to obtain the second-round PCR product b, which yielded the ADH4 gene knockout fragment. The ADH4 gene knockout fragment was transformed into Saccharomyces cerevisiae BY4741 competent cells to obtain ADH4 gene knockout bacteria. The ADH1 gene knockout fragment was transformed into competent cells of ADH4 gene knockout bacteria to obtain ADH1 / ADH4 dual gene knockout bacteria.
6. The application of the engineered Saccharomyces cerevisiae BY4741, the engineered Saccharomyces cerevisiae according to claim 1 or 2, or the engineered Saccharomyces cerevisiae prepared by any one of claims 3 to 5, in the preparation of methane.
7. The application according to claim 6, characterized in that, The viable count of either the brewer's yeast BY4741 or the engineered brewer's yeast strain is ≥1×10⁻⁶. 8 CFU / mL.
8. A method for producing methane through straw fermentation, characterized in that, Includes the following steps: The engineered brewer's yeast prepared using the brewing yeast BY4741, the brewer's yeast engineered strain according to claim 1 or 2, or the preparation method according to any one of claims 3 to 5, is mixed with the fermentation substrate for fermentation. The fermentation substrate is straw and anaerobic activated sludge.
9. The method according to claim 8, characterized in that, The mass ratio of straw to anaerobic activated sludge is 25-30:155-165; the straw is wheat straw; the raw material for the anaerobic activated sludge is activated sludge from a wastewater treatment plant; the total sludge (TS) of the anaerobic activated sludge is 12.55%±0.10%, and the total sludge concentration (VS) is 5.44%±0.02%; the total TS of the fermentation substrate is 12%-17%, and the total VS is 9.5%-10%; the fermentation is anaerobic fermentation; the fermentation temperature is 32-37℃, and the fermentation time is 20-28 days.
10. The method according to claim 9, characterized in that, The wheat straw is wheat straw powder that has been pulverized through a 15-25 mesh sieve; the TS of the wheat straw powder is 91.34%±0.04%, and the VS is 74.57%±0.31%; the preparation method of the anaerobic activated sludge includes the following steps: mixing the activated sludge from the wastewater treatment plant with water, anaerobically incubating at 32-37℃ for 10-15 days, stirring once every 1-3 days to obtain anaerobic activated sludge.