Target nucleic acid detection method based on one-pot isothermal nucleic acid amplification

Abstract

This invention relates to a method for detecting target nucleic acids based on one-pot isothermal nucleic acid amplification. The invention provides a method for detecting target nucleic acids in a sample, comprising the following steps: a) placing a reaction component and a sample containing the target nucleic acid in the same reaction vessel for amplification reaction, wherein the reaction component comprises i) a single-stranded DNA padlock probe, comprising a first linker region at the 5' end, a second linker region at the 3' end, and an internal reporter region, wherein the first and second linker regions each contain a polynucleotide sequence complementary to the target nucleic acid sequence; optionally, the single-stranded DNA padlock probe is composed entirely of deoxyribonucleotides, or substantially composed of deoxyribonucleotides and containing no more than four consecutive ribonucleotides; ii) a ligase or a variant thereof; iii) a DNA polymerase or a variant thereof with strand displacement activity; and iv) a reaction buffer; b) detecting the amplification reaction product of step a). The invention also provides a kit suitable for the above method.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a target nucleic acid detection method based on one-pot isothermal nucleic acid amplification. Background Technology

[0002] Since Mullis invented PCR (PCR) in vitro, especially after the advent of real-time quantitative PCR, nucleic acid detection has become a crucial branch of in vitro diagnostics. Simultaneously, the emergence of various isothermal amplification techniques has propelled the rapid development of point-of-care testing (POC) based on nucleic acid amplification. Due to its high specificity and sensitivity, nucleic acid detection technology has become the gold standard for diagnosing many pathogenic pathogens, particularly for the diagnosis of emerging and re-emerging infectious disease pathogens. Therefore, developing nucleic acid diagnostic methods for pathogens with high specificity, high sensitivity, high stability, and high accuracy is of great significance.

[0003] In modern molecular biology research and related applications, Reactive Protein Amplification (RCA) is playing an increasingly important role as a powerful nucleic acid amplification technique. Traditional RCA methods typically divide the reaction process into two independent steps: first, a ligase catalyzes the cyclization of single-stranded nucleic acid molecules to form a circular template for amplification; then, under the action of a polymerase, an exponential amplification reaction occurs based on this circular template. While this step-by-step approach ensures the accuracy and controllability of the reaction to a certain extent, it also has drawbacks such as cumbersome procedures, long processing times, and susceptibility to external interference.

[0004] Therefore, improving the traditional RCA method and applying it to nucleic acid detection is of great significance. Summary of the Invention

[0005] As mentioned above, rolling circle amplification (RBA)-related nucleic acid amplification methods typically employ a two-step approach. First, single-stranded DNA is circularized to form a circular DNA structure. This step often requires specific enzymes (such as specific ligases) and suitable reaction conditions (such as appropriate buffer systems, temperature, and pH) to ensure accurate and efficient ligation between the ends of the single-stranded DNA to form a circular structure. 1-3 After successful circularization, the DNA is transferred to a reaction system specifically prepared for rolling circle amplification. Using this circular DNA as a template, key amplification enzymes such as Phi29 DNA polymerase and corresponding dNTPs are added. Under specific temperature and time conditions, rolling circle amplification is performed to achieve large-scale replication of nucleic acids to meet the needs of subsequent detection and other applications. 4, 5 .

[0006] These two steps are generally not suitable to be performed in the same system, mainly for three reasons: first, the different buffer solution environments affect enzyme activity; second, the difference in the optimal reaction temperature of the enzyme leads to differences in reaction efficiency; and third, the products interfere with the reaction. 6-9 Different enzymes have their own optimal reaction environments. Ligases used for DNA circularization may require a relatively mild, near-neutral buffer system with specific ion concentrations to ensure their ligation activity. Polymerases commonly used for rolling circle amplification (such as Phi29 DNA polymerase) often have stricter requirements regarding magnesium ion concentration and other conditions in the buffer system, and their tolerance to pH levels is not entirely the same as that of ligases. If they are placed in the same system, the buffer system may not be able to simultaneously meet the optimal activity requirements of both enzymes, leading to inhibited enzyme activity, low ligation efficiency, numerous uncircularized or incorrectly circularized cases, and interference between enzyme activities, preventing the reaction from starting or significantly impacting amplification efficiency. DNA circularization is generally best performed at a relatively moderate temperature (e.g., 37°C) to ensure ligase activity and the accuracy of the ligation reaction. However, during the rolling circle amplification phase, different polymerases often require different optimal temperatures. For example, Phi29 DNA polymerase generally exhibits good activity around 30°C, but in practice, to balance factors such as reaction rate, amplification may be performed in a slightly higher temperature range (e.g., 32-35°C). Such temperature differences can affect enzyme activity. 10-12 .

[0007] This invention integrates the preparation, ligation, and amplification of phosphorylated linear probes into a single reaction system, completing the process in one step. Its core lies in the compatible design of the buffer system and the synergistic regulation strategy of enzyme activity. Firstly, a Tris-HCl-HEPES double buffer architecture is designed to stabilize the system pH at 8.5 ± 0.5, while simultaneously regulating Mg... 2+ First, the concentration was increased to 2 mM to achieve ionic environment compatibility between the two enzymes. Second, a low-concentration suitable enzyme combination was selected and protective agents such as glycerol and pyrophosphatase (PPI) were added to eliminate steric hindrance and product inhibition of the enzyme protein. Third, the isothermal compatibility of each enzyme was screened and matched. Through the synergistic regulation of enzyme activity, probe preparation, ligation, and amplification were carried out efficiently and orderly at the same temperature, ultimately achieving a multi-step integrated isothermal reaction. Finally, seamless connection between nucleic acid molecule circularization and amplification was achieved in a single reaction tube, which not only simplified the experimental operation process but also shortened the overall reaction time from 4-6 h in the traditional step-by-step operation to 1.5-2 h, significantly improving the detection efficiency.

[0008] Therefore, the purpose of this invention is to provide a target nucleic acid detection method based on one-pot isothermal nucleic acid amplification, addressing the technical problems raised in the background art. The detection process of this invention requires no complex reagents or equipment, can be operated largely outside the laboratory environment, and presents the results in a visual manner, intuitively and specifically reflecting the presence or absence of the analyte and its approximate concentration range, enabling real-time detection and facilitating practical applications.

[0009] The present invention provides a method for detecting target nucleic acid in a sample, comprising the following steps: a) placing a reaction component and a sample containing the target nucleic acid in the same reaction vessel for amplification reaction, and b) detecting the amplification reaction product of step a); wherein the reaction component comprises i) a single-stranded DNA padlock probe, comprising a first linker region at the 5' end, a second linker region at the 3' end, and an internal reporter region, wherein the first linker region and the second linker region respectively comprise a polynucleotide sequence complementary to the target nucleic acid sequence; ii) a ligase or a variant thereof; iii) a DNA polymerase or a variant thereof with strand displacement activity; and iv) a reaction buffer.

[0010] In some implementations, the circularized single-stranded DNA padlock probe is composed entirely of deoxyribonucleotides.

[0011] In some implementations, the circularized single-stranded DNA padlock probe is essentially composed of deoxyribonucleotides and contains no more than four consecutive ribonucleotides.

[0012] In some embodiments, the first base of the first linker region contains a phosphorylation modification, which is added exogenously or generated in situ; preferably, when the phosphorylation modification is generated in situ, then (1) the reaction component further contains a polynucleotide kinase; or (2) the single-stranded DNA padlock probe further contains a valve region at the 5' end and the reaction component further contains a structure-specific nuclease, the valve region being not complementary to the target nucleic acid sequence and being cleavable by the structure-specific nuclease.

[0013] In some implementations, the length of the polynucleotide sequence complementary to the target nucleic acid sequence is 15-200 bases, 15-100 bases, or 15-40 bases.

[0014] In some implementations, the reporting area includes a specific nucleic acid binding region for visualizing the amplification product.

[0015] In some embodiments, the ligase is selected from T4 DNA ligase, T4 RNA ligase 1, T4 RNA ligase 2, PBCV-1 DNA ligase, 9°N™ DNA ligase, Circ Ligase ssDNA / RNA cyclase, and other ligases that use ATP or NAD+ as substrates for DNA / DNA and / or DNA / RNA ligation reactions.

[0016] In some embodiments, the DNA polymerase with strand substitution activity is selected from Phi29 DNA polymerase, Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, SD DNA polymerase, and other natural and / or artificially modified DNA polymerases with strand substitution activity that use deoxyribonucleotides as substrates and depend on DNA templates.

[0017] In some embodiments, the reaction buffer comprises 0.1-2 mM dNTP, 1-100 mM Tris-HCl, 1-300 mM HEPES, 5-25 mM MgCl2, 0-20 mM ATP, 0.5-10 mM DTT, 0-10% glycerol, and 0-3 U / μL PPI, and the pH of the reaction buffer is 8.0 to 9.0. In some preferred embodiments, the reaction buffer comprises 0.2 mM dNTP, 10 mM Tris-HCl, 100 mM HEPES, 10 mM MgCl2, 10 mM DTT, 5% glycerol, and 1 U / μL PPI, and the pH of the reaction buffer is 8.5.

[0018] In some embodiments, the amplification reaction is selected from rolling circle amplification (RCA), chain substitution amplification (CSA), cross primer amplification (CPA), chain substitution amplification (SDA), adjacent extension analysis (PEA) and variations thereof; rolling circle amplification is preferred.

[0019] In some embodiments, the reaction temperature of step a) is a constant temperature of 8°C to 65°C; preferably, the reaction temperature of step a) is 30°C to 37°C; more preferably, the reaction temperature of step a) is 37°C.

[0020] In some implementations, the reaction time of step a) is 5 minutes to 4 hours; preferably, the reaction time of step a) is 10 minutes to 60 minutes.

[0021] In some implementations, the reporting region is covalently or non-covalently bound to a fluorescently detectable tag comprising a nucleic acid dye, a fluorescently labeled nucleotide or oligonucleotide, or an antibody.

[0022] In some implementations, the target nucleic acid is selected from one or more of single-stranded DNA, double-stranded DNA, and single-stranded RNA.

[0023] In some implementations, the nucleic acid sequence of the target nucleic acid is derived from a virus, bacteria, fungus, animal, plant, or synthetic construct; the sample is derived from water, soil, blood, whole blood, leukocytes, peripheral blood, monocytes, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, papillary aspiration fluid, tracheal aspiration fluid, nasal aspiration, synovial fluid, joint aspiration fluid, cells, cell extracts, feces, tissue, tissue extracts, tissue biopsy, or cerebrospinal fluid.

[0024] In some implementations, the concentration of the target nucleic acid is as low as the pM level.

[0025] In some implementations, the single-stranded DNA padlock probe and the target nucleic acid do not require an annealing incubation step.

[0026] Another aspect of the present invention provides a kit for detecting target nucleic acids in a sample in the same reaction vessel. The kit comprises a single-stranded DNA padlock probe, which includes a first linker region at the 5' end, a second linker region at the 3' end, and an internal reporter region. The first and second linker regions respectively include a polynucleotide sequence complementary to the target nucleic acid sequence; a ligase or a variant thereof; a DNA polymerase or a variant thereof with strand displacement activity; and a reaction buffer.

[0027] In some embodiments, the kit further comprises a polynucleotide kinase.

[0028] In some embodiments, the 5' of the single-stranded DNA padlock probe further includes a valve region and the kit further includes a structure-specific nuclease, the valve region being non-complementary to the target nucleic acid sequence and cleavable by the structure-specific nuclease.

[0029] The objective of this invention can be achieved through the following technical solutions: This invention relates to a method for detecting target nucleic acids in a sample, which mainly includes the following steps: incubating a test sample containing one or more target nucleic acids, a single-stranded DNA padlock probe, a DNA ligase or a variant thereof, a DNA polymerase or a variant thereof with strand displacement activity, and a reaction buffer in the same reaction container at the same reaction temperature for a certain reaction time, and then detecting the amplification reaction product to detect the target nucleic acid in the sample.

[0030] Single-stranded DNA padlock probe Single-stranded DNA padlock probes contain a linker region and a reporter region.

[0031] The linker region is a polynucleotide sequence complementary to the target nucleic acid, located at the 5' end and interior, and the 3' end and interior, respectively, of the single-stranded DNA padlock probe. The linkerable 3' end and linkerable 5' end hybridize with the target nucleic acid sequence. The first base at the 5' end of the single-stranded DNA padlock probe at the linker site contains phosphorylation modification.

[0032] The reporting area is a specific nucleic acid binding region that allows for the visualization of the amplification product. This visualized nucleic acid binding region primarily detects the isothermal amplification product by detecting tags that are covalently or non-covalently bound to it. These tags can be fluorescent molecules bound to the isothermal amplification product, such as those present in primers used for probe amplification and the generation of the isothermal amplification product, or nucleic acid dyes that can bind to the product; or tags that are linked to nucleotides incorporated into the isothermal amplification product during probe amplification, or to fluorescently labeled oligonucleotides that hybridize with the isothermal amplification product; or tags that are molecules or chemical groups detectable by fluorescently labeled molecules, such as antibodies. The nucleic acid dye can be a class of small molecule compounds that significantly enhance fluorescence after binding to nucleic acids, such as SYBR Green, Hoechst, propidium iodide, ethidium bromide, and other artificially modified small molecules; the fluorescent label can be one or more of the following: fluorescent groups labeled at the 5' end, including FAM, FITC, Cy3, Cy5, VIC, ROX, Joe, and HEX; and the fluorescent quenching group labeled at the 3' end, including one or more of TAMRA, BHQ1, MGB, and BHQ2.

[0033] Single-stranded DNA padlock probes may also include a valve region located at the 5' end of the probe. The 5' linkable end of a single-stranded DNA padlock probe containing a valve region, or a portion thereof, can be phosphorylated by cleaving the probe during hybridization with the target molecule; cleavage is achieved via a structure-specific nuclease. When the target nucleic acid molecule hybridizes with the probe or a portion thereof, the valve region at the 5' end of the probe, which does not hybridize with the target nucleic acid molecule and forms a valve structure at the 5' end, is removed by cleavage, thereby forming a linkable 5' end. The valve region is an additional sequence of n nucleotides unrelated to the target, where n is an integer from 1 to 200; one or more nucleotides at the 3' end of the additional sequence are complementary to homologous nucleotides in the target nucleic acid molecule, wherein the nucleotides cannot hybridize simultaneously with the target nucleic acid molecule at the 3' linkable end of the probe; the valve region allows the probe to form a linkable end using the target nucleic acid molecule as a linking primer, optionally after cutting the hybridization probe and / or using the target nucleic acid molecule as a primer to extend the 3' end; when the single-stranded DNA padlock probe hybridizes with the target nucleic acid sequence, the valve region located at the 5' end that does not bind to the target forms a valve structure, which can be removed by a structure-specific nuclease to generate a linkable site at the 5' end.

[0034] The single-stranded DNA padlock probes described herein do not mean that they are composed solely of DNA. That is, the circularized single-stranded DNA padlock probes may be composed entirely of deoxyribonucleotides, or they may be composed primarily of deoxyribonucleotides and contain no more than four consecutive ribonucleotides.

[0035] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a multi-enzyme one-pot isothermal amplification nucleic acid detection method that, compared to existing technologies, fully leverages the advantages of its rapid, sensitive, and simple operation. Furthermore, we utilize various forms of tags—covalently or non-covalently bound to fluorescence detection and isothermal amplification products—to achieve the detection of target nucleic acids in samples. Therefore, this invention provides a simple and universal nucleic acid detection method, compatible with various fluorescence detection methods. The detection process requires no complex reagents or equipment, allowing for operation largely outside the laboratory environment. Moreover, the results are presented visually, intuitively and rapidly reflecting the presence and approximate concentration range of the analyte, enabling real-time detection and facilitating practical applications. Attached Figure Description

[0036] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments and descriptions of this application are used to explain this application and do not constitute an undue limitation of this application. To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0037] Figure 1 The diagram shows the principle of the two-enzyme one-pot method. (A) is a schematic diagram of nucleic acid detection using the two-enzyme one-pot method. (B) is a schematic diagram of the reaction principle of the two-enzyme one-pot method.

[0038] Figure 2 The effects of different enzyme, probe, and primer amounts on the two-enzyme one-pot rolling circle amplification reaction are shown. (A) Rolling circle amplification using different concentrations of DNA polymerase. (B) The linear relationship between the initial reaction rate V and enzyme concentration C0 is shown. (C) Rolling circle amplification reactions with different padlock probe concentrations are shown. (D) A comparison of the endpoint fluorescence values ​​of rolling circle amplification with different primer and enzyme concentrations is shown. (E) Rolling circle amplification reactions with fixed enzyme concentrations and different target concentrations are shown.

[0039] Figure 3 The effects of different reaction conditions on the two-enzyme one-pot rolling circle amplification reaction are shown. (A) shows conditions with different hybridization temperatures: a fixed hybridization time of 30 min, with different hybridization temperatures. (B) shows conditions with different reaction temperatures: a fixed reaction time of 30 min, with different reaction temperatures. (C) shows conditions with different hybridization times: a fixed hybridization temperature of 30℃, with different hybridization times. (D) shows conditions with different reaction times: a fixed reaction temperature of 37℃, with different reaction times.

[0040] Figure 4 The images show a comparison of gel electrophoresis patterns of two-enzyme one-pot padlock probes with different amounts of ligase and different reaction times. (A) compares the ligation efficiency of different amounts of ligase. (B) compares the ligation efficiency of the same amount of ligase at different ligation times.

[0041] Figure 5The effects of different optimized system conditions on the multi-enzyme synergistic isothermal amplification reaction were shown. (A) shows the comparison between a double-buffered system and a single-buffered system: with other reaction parameters fixed, reactions were performed using a Tris-HCl-HEPES double-buffered system (pH 8.5±0.5) and a single Tris-HCl buffer system (same pH); (B) shows the effect of different glycerol concentrations: with the buffer system and other parameters fixed, gradient groups were set with glycerol concentrations of 0% (no addition), 2%, 5%, and 10%; (C) shows the comparison between adding pyrophosphatase (PPI): with the buffer system and glycerol addition parameters fixed, groups with 1 U / μL PPI and no PPI were set.

[0042] Figure 6 Different padlock probes and different fluorescence detection methods are shown. (A) shows the detection method based on different concentrations of padlock probe A and fluorescently labeled oligonucleotides. (B) shows the detection method based on different concentrations of padlock probe B and fluorescently labeled nucleotides.

[0043] Figure 7 The diagram illustrates the principle of the three-enzyme one-pot method (containing polynucleotide kinase). (A) is a schematic diagram of nucleic acid detection using the three-enzyme one-pot method (containing polynucleotide kinase). (B) is a schematic diagram of the reaction principle of the three-enzyme one-pot method (containing polynucleotide kinase).

[0044] Figure 8 The diagram illustrates the principle of the three-enzyme one-pot method (containing structure-specific nucleases). (A) is a schematic diagram of nucleic acid detection using the three-enzyme one-pot method (containing structure-specific nucleases). (B) is a schematic diagram of the reaction principle of the three-enzyme one-pot method (containing structure-specific nucleases).

[0045] Figure 9 The reaction process of different padlock probes with the same target concentration is shown in the fluorescence detection diagram. (A) shows the real-time fluorescence detection diagram of different padlock probes. Here, T1 represents a 5' phosphorylated probe, T2 represents a 5' unmodified probe, and T3 represents a probe containing the 5' valve region. (B) compares the reaction rates of different padlock probes. Here, T1 represents a 5' phosphorylated probe, T2 represents a 5' unmodified probe, and T3 represents a 5' probe containing the 5' valve region.

[0046] Figure 10 The effects of different pH values ​​and ion concentrations on the reaction are shown using a three-enzyme one-pot method. (A) shows the effect of different concentrations of Tris-HCl and different pH solutions on the reaction. (B) shows the effect of different concentrations of KCl and different pH solutions on the reaction. (C) shows the effect of different concentrations of MgCl2 and different pH solutions on the reaction.

[0047] Figure 11 Different padlock probes and different fluorescence detection methods are shown. (A) shows the detection method based on different concentrations of padlock probe C and fluorescently labeled oligonucleotides. (B) shows the detection method based on different concentrations of padlock probe D and fluorescently labeled nucleotides. Detailed Implementation

[0048] The present invention will be further illustrated by the following examples. These examples are merely illustrative and do not constitute any limitation on the scope of the invention. The examples primarily employ conventional molecular biology cloning methods in genetic engineering, methods well-known to those skilled in the art, such as those found in Jane Rothschild et al.'s *Molecular Biology Laboratory Manual* and J. Sambrook and DW Russell's *Molecular Cloning: A Laboratory Manual* (3rd edition, August 2002, Science Press, Beijing). Those skilled in the art can readily implement the present invention by making minor modifications and variations according to specific circumstances, based on the following examples.

[0049] All primers used for amplification reactions in the examples were synthesized, purified, and correctly identified by mass spectrometry by Shanghai Jereh Biotechnology Co., Ltd. DNA ligases, DNA polymerases, and other tool enzymes used in each example were purchased from Shanghai Yisheng Biotechnology Co., Ltd., Thermo Fisher Scientific, TaKaRa, Beyotime Biotechnology, Merck, NewGene, and NEB. Polymerase and ligase buffers and dNTPs were included with the purchase of each enzyme. Unless otherwise stated, inorganic chemical reagents were purchased from Sinopharm Shanghai Chemical Reagent Co., Ltd. Kanamycin was purchased from Ameresco; ampicillin (Amp) was purchased from Ameresco; 384-well and 96-well fluorescence detection blackboards were purchased from Grenier. The DNA purification kits used in the examples were purchased from BBI (Canada).

[0050] The main instruments used in the examples are: Synergy Neo2 multi-functional microplate reader (Bio-Tek, USA), gel imaging system (Tianeng Company), qPCR instrument (Jena, Germany), flow cytometer (Beckman, USA), inverted fluorescence microscope (Nikon, Japan), X-15R high-speed refrigerated centrifuge (Beckman, USA), Microfuge 22R benchtop high-speed refrigerated centrifuge (Beckman, USA), PCR amplification instrument (Biometra, Germany), in vivo imaging system (Kodak, USA), photometer (Wako, Japan), and nucleic acid electrophoresis system (Sheneng Bocai Company).

[0051] Unless otherwise stated, the abbreviations used in this application have the following meanings: "h" refers to hour; "min" refers to minute; "s" refers to second; "d" refers to day; "μL" refers to microliter; "ml" refers to milliliter; "L" refers to liter; "bp" refers to base pair; "mM" refers to millimole; "μM" refers to micromolar.

[0052] Commonly used experimental methods and materials (a) Oligonucleotide dissolution The oligonucleotide powder synthesized by the biotechnology company was dissolved to 10 μM using TE Buffer, heated to 95 °C for 5 min to denature, immediately placed on ice for 5 min, and then placed at room temperature for 10 min before subsequent functional testing experiments could be performed.

[0053] (II) Preparation and purification of PCR fragments

[0054] PCR reaction conditions: Incubate at 94℃ for 2-5 min, then perform 30-25 cycles: 94℃ for 30 s, 50-60℃ for 30 s, 72℃ at 1-2 kb / min. After each cycle, incubate at 72℃ for 5-10 min. Finally, store at 4℃.

[0055] After PCR, agarose gel electrophoresis is performed to separate and identify nucleic acids. This experiment is conducted in a fume hood; gloves, masks, and goggles should be worn before the experiment. After the PCR reaction, DNA agarose gel electrophoresis is performed. The target DNA band is compared with the corresponding DNA marker to determine whether the obtained DNA size meets expectations.

[0056] 1. Agarose Gel Preparation: First, weigh 1 g of agarose into an Erlenmeyer flask, add 100 mL of 1×TAE buffer, shake well, and then heat in a microwave oven to dissolve. Place the cleaned gel tank flat on a fume hood surface, place the gel tray in the tank, and insert a comb (choose a different comb depending on the volume of the DNA sample; combs with 50 µL, 25 µL, or 10 µL wells are usually available). Add one drop of ethidium bromide (EB) to a small beaker, then pour the dissolved agarose into the beaker (the dissolved gel is usually cooled slightly before being poured into the beaker, usually for about half a minute, to avoid burning your hands from boiling gel and to reduce EB evaporation). Mix well and pour into the gel tank. Press the gel tray in the gel tank to remove air bubbles between the gel tray and the gel tank, and wait for the gel to solidify.

[0057] 2. DNA Loading: Gently remove the comb and place the agarose gel gently into the electrophoresis tank (the comb wells should be positioned close to the negative electrode of the electrophoresis tank, as DNA migrates from the negative electrode to the positive electrode). Ensure that the TAE buffer completely covers the gel and extends approximately 0.5 mm above the gel surface. Slowly add the DNA sample with the added DNA loading buffer into the gel wells. Because the DNA sample has a higher density than the TAE buffer, it will sink to the bottom of the wells, and you can observe the liquid level of the DNA sample slowly rising from the bottom of the wells during loading. Additionally, add 10 µL of DNA Marker to the wells (ideally in the wells in the middle of the sample for easy observation and comparison of DNA bands).

[0058] 3. Electrophoresis: After closing the electrophoresis tank lid (the positive and negative electrodes on the electrophoresis tank lid should correspond to the positive and negative electrodes on the electrophoresis tank), turn on the power and electrophore for 15 minutes at 120 V (adjust as appropriate according to the size of the DNA bands).

[0059] 4. Gel Imaging: Gently remove the gel from the electrophoresis tank and place it in a gel imaging system. Turn on the UV lamp to take a picture. If DNA recovery is required, cut the target DNA band with a blade, place it in a 2 mL centrifuge tube, and store at -20°C.

[0060] After electrophoresis, the DNA gel was recovered.

[0061] 5. Gel Dissolution: Weigh the DNA gel and place it in a 2 mL centrifuge tube. Add Binding Buffer II at a mass ratio of 3:1 (DNA gel to Binding Buffer II). Dissolve the gel in a constant temperature metal bath (55 °C, ~10 min). After the gel is fully dissolved, cool it to room temperature. 6. Sample loading: Place the adsorption column in a 2 mL collection tube, add the cooled liquid to the adsorption column, let stand for 2 min, and then centrifuge (10000 rpm, 1 min). The liquid in the collection tube can be transferred back to the adsorption column and centrifuged again to improve DNA adsorption efficiency. 7. Washing off impurities: Add 500 µL Wash Solution, centrifuge (10000 rpm, 1 min), discard the waste liquid, repeat the washing once, and then centrifuge for 5 min to fully remove the Wash Solution. In addition, place the adsorption column in a new centrifuge tube (1.5 mL), and let it stand in a 55℃ constant temperature metal bath for 2 min or place it in the air outlet of the clean bench to evaporate and remove the residual ethanol. 8. DNA elution: Add 50 µL of Elution Buffer (if used for enzyme digestion or ligation, elute with dd H2O water), let stand for 2 min to allow the DNA to fully dissolve in the elution buffer, centrifuge (10000 rpm, 5 min) to elute the DNA, and store at -20℃.

[0062] (III) Ethanol precipitation and recovery of amplified products 1. Add 40 μL of sodium acetate + 880 μL of anhydrous ethanol to 400 μL of the ligated and digested product.

[0063] 2. Cover and gently invert 20 times, then place in a -80℃ refrigerator for at least 30 minutes.

[0064] 3. Centrifuge at 12000 rpm for 10 min.

[0065] 4. Discard the supernatant and add 750 μL~800 μL of 70% ethanol.

[0066] 5. Centrifuge at 12000 rpm for 2 min.

[0067] 6. Abandon the Shangqing.

[0068] 7. After the ethanol has evaporated completely, add 30 μL of ultrapure water to dissolve and perform nucleic acid quantification.

[0069] (iv) Polyacrylamide gel electrophoresis 1. Wash the glass plate, plate holder, and plate clamps thoroughly, and shake off the water, or wash and dry them in advance.

[0070] 2. Insert the two glass plates (long and short plates aligned) into the plate clamp.

[0071] 3. Prepare agarose gel of any concentration, heat it, and add it to the gel pad using a dropper.

[0072] 4. Before the agarose gel solidifies, clip the plate clamps onto the plate holder and use a blue torch tip to secure the plate clamps more tightly.

[0073] 5. After the agarose gel has solidified, add 40 μL of TEMED and 80 μL of 10% APS to 10 mL of 8% PAGE gel premix. Quickly invert the glass 7-8 times and use a dropper to add the gel to the center of the glass plate. Insert a comb.

[0074] 6. Let stand at room temperature until the gel solidifies, then use as soon as possible. Alternatively, 1×TBE can be temporarily stored in a 4°C refrigerator.

[0075] 7. Remove the glass plate and place it into the electrophoresis clamp.

[0076] 8. Heat 1×TBE at medium-high heat for 1 min.

[0077] 9. Pour heated 1×TBE between the two pairs of glass plates, let it stand for a while, and check if the glass plates leak liquid.

[0078] 10. Add unheated 1×TBE to the electrophoresis tank and vertically pull up the comb.

[0079] 11. Sample loading: Use a 200 μL pipette to blow out the ionic solution from the well; otherwise, the sample will float out of the well during loading. Insert the tip of the pipette into the well and slowly add the sample; you will see the sample settle to the bottom of the well. Cover the electrode, plug in the power, and perform electrophoresis at 300 V for 15 min. Carefully remove the gel and perform gel imaging on a Tianneng gel imaging system.

[0080] Example 1: Rolling circle amplification using a two-enzyme one-pot method with different amounts of polymerase. This embodiment first elaborates on the one-pot rolling circle amplification using two enzymes, such as... Figure 1 As shown in Figure A, the sample to be tested, a single-stranded DNA padlock probe, DNA ligase or a variant thereof, DNA polymerase or a variant thereof with strand displacement activity, and reaction buffer are added to the same reaction vessel. The reaction principle is as follows: Figure 1 As shown in Figure B, the target binds to the linker region of the single-stranded DNA padlock probe, and the gap is closed by DNA ligase. Subsequently, the amplification product is obtained through continuous amplification by DNA polymerase. The obtained amplification product can be detected using various methods. Figure 1 Section B only lists forms such as nucleic acid dyes, fluorescently labeled nucleotides, fluorescently labeled oligonucleotides, and fluorescently labeled antibodies, which can be used to detect the accumulation of fluorescence in amplification products.

[0081] In this embodiment, the two-enzyme one-pot method with different amounts of polymerase is described in detail, and its main steps are as follows: (1) Probe design Single-stranded DNA padlock probe sequence: 5'-pho→3' CTGATAAGCTAGAAAGAAA GAGGCGTAATATGCGCGCTATACTACTTGCCGCCTC GAAAGAAATCAACATCAGT (SEQ ID NO: 1) Target nucleic acid sequence: 5'→3' TAGCTTATCAGACTGATGTTGA (SEQ ID NO: 2) In the above sequence, the underlined portion is the reporter region, which can be the binding region of fluorescently labeled oligonucleotides, fluorescently labeled antibodies, or fluorescently labeled nucleotides, or the binding site of nucleic acid dyes (such as SYBR Green). The bolded portion is the target recognition sequence, and the other portions are optional linker sequences. The target recognition sequence in the probe can be replaced according to the target sequence to be detected (the single-stranded DNA padlock probe sequence shown in this embodiment is used to detect miRNA-21, i.e., the target sequence is the nucleic acid sequence of miRNA-21).

[0082] (2) Isothermal amplification of nucleic acid Preparation of Reaction Buffer Solution. The reaction solution described here should be prepared fresh for immediate use, pH=8.4@25℃.

[0083] Add 5' phosphorylated single-stranded DNA padlock probe, target, DNA polymerase (such as PhI 29 DNA polymerase), DNA ligase (such as Splint R), labeled small molecules (nucleic acid dye, fluorescently labeled oligonucleotide, fluorescently labeled nucleotide, or fluorescently labeled antibody), and other necessary components for the reaction (such as dNTPs, reaction solution, etc.) to the reaction system and mix thoroughly. The reaction system is as follows:

[0084] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0085] (3) Detection of amplification reaction products There are two detection methods: ① Real-time fluorescence detection The labeled small molecules, such as fluorescent dyes, fluorescently labeled nucleotides, fluorescently labeled oligonucleotides, or fluorescently labeled antibodies, are added to other reaction systems, and fluorescence detection is performed using an ELISA reader and / or a real-time quantitative PCR instrument. The detection steps are as follows: 1. Prepare the above reaction system and add the sample.

[0086] 2. Set up the reaction and fluorescence detection program as follows:

[0087] 3. The fluorescence detection method in step 2 is to set up a fluorescence channel, bandwidth, and readout mode that match the spectral properties of the fluorescent aptamer and dye complex.

[0088] ②Endpoint fluorescence detection No labeled small molecules need to be added to the reaction system. After incubation in a conventional thermostat, add an appropriate amount of fluorescent dye, fluorescently labeled nucleotide, fluorescently labeled oligonucleotide, or fluorescently labeled antibody, and let stand for 5 minutes. Then, place the system in a fluorescence analyzer such as an ELISA reader or real-time quantitative PCR instrument and read the values ​​according to the following procedure:

[0089] After the detection is completed, the average value of the 5 fluorescence detection results is calculated as the endpoint fluorescence of the reaction.

[0090] The fluorescence detection results of different enzyme amounts in the two-enzyme-one-pot system in this embodiment are as follows: Figure 2 As shown in Figure A, it can be seen that the reaction rate gradually increases with the increase of enzyme concentration. When the polymerase concentration is between 10 U / mL and 200 U / mL, the relationship between the initial reaction rate V and the enzyme concentration C0 is linear, and the linear equation is V = 0.04999C0 - 0.3777. The results are as follows. Figure 2 As shown in B, this demonstrates that the isothermal chain displacement reaction based on the two-enzyme one-pot method can achieve real-time, rapid, sensitive, and easy-to-operate nucleic acid detection.

[0091] Example 2: Rolling circle amplification using a two-enzyme one-pot method with different padlock probe concentrations In this embodiment, the two-enzyme one-pot method with different padlock probe concentrations is described in detail, and its main steps are as follows: (1) Probe design The same single-stranded DNA padlock probe sequence and target sequence as in Example 1 were used.

[0092] (2) Isothermal amplification of nucleic acid Add 5' phosphorylated single-stranded DNA padlock probe, target, DNA polymerase (such as PhI 29 DNA polymerase), DNA ligase (such as Splint R), labeled small molecules (nucleic acid dye, fluorescently labeled oligonucleotide, fluorescently labeled nucleotide, or fluorescently labeled antibody), and other necessary components for the reaction (such as dNTPs, reaction solution, etc.) to the reaction system and mix thoroughly. The reaction system is as follows:

[0093] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0094] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0095] In this embodiment, the fluorescence detection results of different padlock probe concentrations in the two-enzyme-one-pot system are as follows: Figure 2 As shown in Figure C, it can be seen that when the final concentration of the target remains constant at 5 nM, the reaction rate gradually decreases when the amount of single-stranded DNA padlock probe in the system is reduced.

[0096] Furthermore, based on the above results, this embodiment also conducted orthogonal experiments on different enzyme amounts and different target amounts, and the results are as follows. Figure 2 As shown in Figure D, this method can provide significant reference for determining the optimal enzyme dosage and minimum target amount in chain displacement isothermal amplification reactions. The method of this invention can achieve target concentration detection down to the pM level, such as... Figure 2 As shown in E, this demonstrates extremely high sensitivity. This embodiment illustrates that isothermal chain displacement reaction based on a two-enzyme one-pot method can achieve real-time, rapid, sensitive, and easy-to-operate nucleic acid detection.

[0097] Example 3: Rolling circle amplification using a two-enzyme one-pot method under different reaction conditions This embodiment mainly illustrates and explains the tolerance range of the two-enzyme one-pot rolling circle amplification method to different nucleic acid hybridization temperatures, nucleic acid hybridization times, reaction temperatures, and reaction times. The main steps are as follows: (1) Probe design The same single-stranded DNA padlock probe sequence and target sequence as in Example 1 were used.

[0098] (2) Isothermal amplification of nucleic acid Add 5' phosphorylated single-stranded DNA padlock probe, target, DNA polymerase (such as PhI 29 DNA polymerase), DNA ligase (such as Splint R), labeled small molecules (nucleic acid dye, fluorescently labeled oligonucleotide, fluorescently labeled nucleotide, or fluorescently labeled antibody), and other necessary components for the reaction (such as dNTPs, reaction solution, etc.) to the reaction system and mix thoroughly. The reaction system is as follows:

[0099] Before adding the enzyme, set different nucleic acid hybridization incubation temperatures and incubation times as follows: ① At different incubation temperatures, the incubation time was fixed at 10 min, and the incubation temperature was changed to 20℃, 30℃, 40℃, 50℃, 60℃, 70℃, 80℃ and 90℃.

[0100] ② Different incubation times: 0 min, 5 min, 10 min, 30 min, 60 min and 120 min at room temperature.

[0101] After incubation, Splint R ligase and phi 29 DNA polymerase were added.

[0102] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0103] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0104] The results of this embodiment are as follows: Figure 3 As shown in Figures A to 3D, the rolling circle amplification nucleic acid detection method of the two enzymes in one pot described in this invention is shown to be tolerant to different hybridization temperatures, hybridization times, reaction temperatures, and reaction times. We found that the reaction starts very quickly, no additional annealing incubation step is required between the padlock probe and the target, and the amplification efficiency is relatively stable between 30℃ and 42℃.

[0105] Furthermore, this embodiment also compared the effects of different amounts of ligase and different ligation times on the cyclization effect of the padlock probe using gel electrophoresis, such as... Figure 4 A and Figure 4 As shown in Figure B, the ligase's efficiency in circularizing padlock probes increases with the amount of enzyme, and most circularized single-stranded DNA padlock probes can be obtained in a short time. This example illustrates that the isothermal strand displacement reaction based on the two-enzyme one-pot method can achieve real-time, rapid, sensitive, and easy-to-operate nucleic acid detection.

[0106] Example 4: Effects of different optimized system conditions on multi-enzyme synergistic isothermal amplification reaction This embodiment mainly describes the comparison between the double-buffered system and the single-buffered system, the comparison of different glycerol concentrations, and the comparison of whether or not pyrophosphatase (PPI) is added: (1) Probe design The same single-stranded DNA padlock probe sequence and target sequence as in Example 1 were used.

[0107] (2) Isothermal amplification of nucleic acid The reaction system includes the sample to be tested, a single-stranded DNA padlock probe, DNA ligase or a variant thereof, DNA polymerase or a variant thereof with strand displacement activity, structure-specific nuclease, and reaction buffer, as follows:

[0108] Note: In the above reaction system, all components remained constant, only the concentrations of HEPES, glycerol, or pyrophosphatase (PPI) were varied. The HEPES concentration was 100 mM, and the pH was set to 8.0, 8.5, and 9.0, respectively; the glycerol concentrations were set to 0% (no addition), 2%, 5%, and 10%, respectively; and the pyrophosphatase (PPI) was set to a group with 1 U / μL PPI and a group without PPI.

[0109] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0110] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0111] This embodiment demonstrates through optimization experiments of the multi-enzyme synergistic isothermal amplification reaction system that the buffer system, glycerol concentration, and pyrophosphatase addition all significantly regulate reaction efficiency: under the same reaction conditions, the endpoint fluorescence value of the system using the Tris-HCl-HEPES double buffer architecture is significantly higher than that of the single Tris-HCl buffer system (e.g., ...). Figure 5 As shown in A), it can stably maintain the pH of the reaction environment, providing a suitable ionic environment for multi-enzyme synergy; the addition of glycerol exhibits a concentration-dependent regulatory effect, with the 5% glycerol group showing the best amplification effect and the highest endpoint fluorescence value. Although the effects of the 2% and 10% glycerol groups are weaker than the 5% group, they are still better than the group without glycerol (e.g., Figure 5 As shown in B), an appropriate concentration of glycerol can alleviate steric hindrance of the enzyme protein and improve enzyme stability; the endpoint fluorescence value of the reaction group with added pyrophosphatase (PPI) was significantly higher than that of the group without added PPI (e.g., ...). Figure 5 As shown in C), pyrophosphatase can degrade the pyrophosphate products produced by the reaction, effectively alleviating the product inhibition effect.

[0112] In summary, the optimized reaction system, which employs a double-buffered approach and adds 5% glycerol and pyrophosphatase, can significantly improve the stability and efficiency of multi-enzyme synergistic isothermal amplification reactions, providing reliable system support for achieving rapid, sensitive, and easy-to-operate nucleic acid detection.

[0113] Example 5: Two-enzyme one-pot rolling circle amplification with different padlock probes and different fluorescence detection methods In this embodiment, the performance of padlock probes with different base compositions and different detection methods in the rolling circle amplification system of the two-enzyme one-pot method is described in detail. The main steps are as follows: (1) Probe design Padlock probe A: 5'-pho→3' GCTCAGCGCGAATTCTGAAAGAAA GAGGCGTAATATGCGCGCTATACTACTTGCCGCCTC GAAAGAAAGCGCTATGAGGCGTA (SEQ ID NO: 3) Padlock probe B: 5'-pho→3' GCTC A GCGCG AA TTCTG AAA G AAA TTC A GC A TT A TGCGCGCT A T A CT A CTTCG A TCG A G AAA G AAA GCGCT A TG A GGCGT A (SEQ ID NO: 4) Target sequence: 5'→3' TAGCTTATCAGACTGATGTTGATACGCCTCATAGCGC (SEQ ID NO: 5) Fluorescently labeled oligonucleotide sequence: 5'→3' (FAM labeling at the 5' end) GAGGCGGCAAGTAGTATAGCGCGCATATTACGCCTC (SEQ ID NO: 6) In the above padlock probe sequences, the underlined portions represent the fluorescent reporter regions. Specifically, the underlined portion of probe A is the binding region to the fluorescently labeled oligonucleotide sequence, while the underlined portion of probe B is the fluorescently labeled nucleotide Cy3-dUTP. Cy3-dUTP can replace TTP in the reaction as a substrate for polymerization. The bolded portions represent the target recognition sequence, and the other portions are optional linker sequences. The target sequences in the above probes can be replaced according to the target sequence to be detected.

[0114] (2) Isothermal amplification of nucleic acid Add 5' phosphorylated single-stranded DNA padlock probe, target, DNA polymerase (such as phi 29 DNA polymerase), DNA ligase (such as Splint R), labeled small molecules (fluorescently labeled oligonucleotides or fluorescently labeled nucleosides), and other necessary components for the reaction (such as dNTPs, reaction solutions, etc.) to the reaction system and mix thoroughly. The reaction system is as follows:

[0115] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0116] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0117] The results of this embodiment are as follows: Figure 6 A and Figure 6 As shown in Figure B, padlock probes with different base compositions can all be used to detect the target using a two-enzyme one-pot method, indicating the universality of this method. Furthermore, different fluorescence detection methods can all detect the amplification products, demonstrating the universality of methods based on multiple fluorescence detection techniques. This example illustrates that isothermal chain displacement reactions based on a two-enzyme one-pot method can achieve real-time, rapid, flexible, sensitive, and easy-to-operate nucleic acid detection.

[0118] Example 6: One-pot reaction of rolling circle amplification of different padlock probes with different target concentrations This embodiment first describes in detail the rolling circle amplification reaction of the three-enzyme one-pot method, such as... Figure 7 As shown in Figure A, the test sample, single-stranded DNA padlock probe, DNA ligase or its variant, DNA polymerase or its variant with strand displacement activity, polynucleotide kinase, and reaction buffer are added to the same reaction vessel. The reaction principle is as follows: Figure 7 As shown in B, polynucleotide kinase phosphorylates the 5' end of a single-stranded DNA padlock probe. The target then binds to the linker region of the single-stranded DNA padlock probe, and the gap is joined by DNA ligase. Subsequently, the amplification product is obtained by continuous amplification under the action of DNA polymerase.

[0119] For single-stranded DNA padlock probes with a 5' valve region, such as Figure 8 As shown in Figure A, the sample to be tested, a single-stranded DNA padlock probe, DNA ligase or a variant thereof, DNA polymerase or a variant thereof with strand displacement activity, a structure-specific nuclease, and a reaction buffer are added to the same reaction vessel. The reaction principle is as follows: Figure 8 As shown in B, by adding a structure-specific nuclease to remove the valve region, the 5' end of the remaining single-stranded DNA padlock probe is phosphorylated. Subsequently, the target binds to the linker region of the single-stranded DNA padlock probe, and the gap is joined by DNA ligase. Then, the amplification product is obtained by continuous amplification under the action of DNA polymerase.

[0120] The obtained amplification products can be detected using various methods. Figure 7 B. Figure 8 Section B only lists nucleic acid dyes, fluorescently labeled nucleotides, fluorescently labeled oligonucleotides, and fluorescently labeled antibodies, which can be used to detect the accumulation of fluorescence in amplification products. This embodiment mainly elaborates on the one-pot rolling circle amplification method with different target concentrations and different padlock probes. The main steps are as follows: (1) Probe design Single-stranded DNA padlock probe T1: 5'-pho→3' CTGATAAGCTAGAAAGAAA GAGGCGTAATATGCGCGCTATACTACTTGCCGCCTC GAAAGAAATCAACATCAGT (SEQ ID NO: 1) Single-stranded DNA padlock probe T2: 5'→3' (no special modification) CTGATAAGCTAGAAAGAAA GAGGCGTAATATGCGCGCTATACTACTTGCCGCCTC GAAAGAAATCAACATCAGT (SEQ ID NO: 1) Single-stranded DNA padlock probe T3: 5'→3' TATATGTATATATTAT CTGATAAGCTAGAAAGAAA GAGGCGTAATATGCGCGCTATACTACTTGCCGC CTC GAAAGAAATCAACATCAGT (SEQ ID NO: 7) Target sequence: 5'→3' TAGCTTATCAGACTGATGTTGA (SEQ ID NO: 2) In the above sequence, the underlined portion is the reporter region, which can be the binding region of fluorescently labeled oligonucleotides, fluorescently labeled antibodies, or fluorescently labeled nucleotides, or the binding site of nucleic acid dyes (such as SYBR Green). The bolded portion is the target recognition sequence. The italicized portion of probe T3 is the valve region that can be recognized by structure-specific nucleases. The other portions are optional linker sequences. The target sequence in the above probe can be replaced according to the target sequence to be detected (the padlock probe sequence shown in this embodiment is used to detect miRNA-21).

[0121] (2) Isothermal amplification of nucleic acid Add 5' phosphorylated single-stranded DNA padlock probe, target, structure-specific nuclease (such as FEN1), DNA polymerase (such as phi 29 DNA polymerase), DNA ligase (such as Splint R), labeled small molecules (fluorescently labeled oligonucleotides or fluorescently labeled nucleosides), and other necessary components for the reaction (such as dNTPs, reaction solutions, etc.) to the reaction system and mix thoroughly. The reaction system is as follows: Two-enzyme one-pot method

[0122] Three-enzyme one-pot method

[0123] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0124] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0125] In this embodiment, different padlock probes correspond to different detection systems, and the results are as follows: Figure 9 As shown in Figure A, the detection systems described in this invention can all achieve nucleic acid detection. Furthermore, different padlock probes exhibit different detection speeds and sensitivities for the same target. Compared to the three-enzyme one-pot method, the two-enzyme one-pot method reduces some protein-protein interactions. Additionally, it reduces the 5' phosphorylation modification reaction of single-stranded DNA padlock probes in the reaction system, thus its reaction speed is faster than the three-enzyme one-pot method. The results are as follows... Figure 9 As shown in B. This embodiment illustrates that isothermal chain displacement reactions based on both the two-enzyme one-pot method and the three-enzyme one-pot method can achieve real-time, rapid, flexible, specific, sensitive, and easy-to-operate nucleic acid detection.

[0126] Example 7: Effects of different pH values ​​and ion concentrations on nucleic acid amplification reactions using the three-enzyme-one-pot method. In this embodiment, the three-enzyme one-pot method with different pH and different ion concentrations is described in detail, and its main steps are as follows: (1) Probe design The same single-stranded DNA padlock probe sequence and target sequence as in Example 1 were used.

[0127] (2) Isothermal amplification of nucleic acid The reaction system includes the sample to be tested, a single-stranded DNA padlock probe, DNA ligase or a variant thereof, DNA polymerase or a variant thereof with strand displacement activity, structure-specific nuclease, and reaction buffer, as follows:

[0128] Note: The reaction buffers in the above reaction systems have different ion concentrations and pH values. Unless otherwise specified, the reaction buffer formulation remains the same in other reaction systems (50mM Tris-HCl, 2mM NH4+). + 10mM K+ 2mM Mg 2+ ).

[0129] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0130] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0131] In this embodiment, when the pH is between 8.5 and 9, the endpoint fluorescence values ​​of various components are generally higher than those at pH=7.5 and pH=8. Figure 10 As shown in A~C, Tris-HCl, K + and Mg 2+ All factors have a certain impact on the three-enzyme one-pot reaction, and the system exhibits some tolerance to metal ions within a certain range, indicating that the isothermal chain displacement reaction based on the one-pot method has a relatively stable reaction efficiency, demonstrating the stability of the reaction system. This example illustrates that the isothermal chain displacement reaction based on the three-enzyme one-pot method can achieve real-time, rapid, sensitive, stable, and easy-to-operate nucleic acid detection.

[0132] Example 8: Two-enzyme one-pot rolling circle amplification with different padlock probes and different fluorescence detection methods In this embodiment, the performance of padlock probes with different base compositions and different detection methods in the rolling circle amplification system of the two-enzyme one-pot method is described in detail. The main steps are as follows: (1) Probe design Single-chain padlock probe C: 5'→3' (no special modification) GCTACGCTAGCATGGTATCGAAAGAAA CGAGCGACGAGTTATCGAGCAGGC GAAAGAAAGCTACCGATCACAGG (SEQ ID NO: 8) Single-chain padlock probe D: 5'→3' (no special modification) TATATGTATATATTAT GCTACGCTAGCATGGTATCGAAAGAAA CGAGCGACGAGTTATCGAGCAGGC GAAAGAAAGCTACCGATCACAGG (SEQ ID NO: 9) Target sequence: 5'→3' GATACCATGCTAGCGTAGCCCTGTGATCGGTAGC (SEQ ID NO: 10) Fluorescently labeled oligonucleotide sequence: 5'→3' (CY5 labeling at the 5' end) GCCTGCTCGATAACTCGTCGCTCG (SEQ ID NO: 11) In the above sequences, the underlined portions represent the fluorescent reporter regions. Specifically, the underlined portion of probe C is the binding region to the fluorescently labeled oligonucleotide sequence, and the underlined portion of probe D is the fluorescently labeled nucleotide Cy3-dUTP. Cy3-dUTP can replace TTP in the reaction as a substrate for polymerization. The bolded portions represent the target recognition sequences, and the other portions are optional linker sequences. The target sequences in the above probes can be replaced according to the target sequence to be detected.

[0133] (3) Isothermal amplification of nucleic acid The reaction system containing probe C includes the sample to be tested, a single-stranded DNA padlock probe, DNA ligase or a variant thereof, DNA polymerase or a variant thereof with strand displacement activity, polynucleotide kinase, and reaction buffer, as follows:

[0134] The reaction system containing probe D is supplemented with the sample to be tested, a single-stranded DNA padlock probe, DNA ligase or a variant thereof, DNA polymerase or a variant thereof with strand displacement activity, a structure-specific nuclease, and a reaction buffer, as follows:

[0135] Place the mixed reaction system in a constant temperature reactor (such as a PCR instrument), and set the reaction program as follows:

[0136] (3) Detection of amplification reaction products The amplification reaction products can be detected by fluorescence using the same two methods as in Example 1 (real-time fluorescence detection and endpoint fluorescence detection).

[0137] The results of this embodiment are as follows: Figure 11 A and Figure 11 As shown in Figure B, different reaction systems with padlock probes (containing the same target sequence) can all be used to detect the target using different three-enzyme-in-one-pot methods, demonstrating the universality of this method. Furthermore, different fluorescence detection methods can all detect the amplification products, indicating that methods based on multiple fluorescence detection methods are universally applicable. This example illustrates that isothermal chain displacement reactions based on the three-enzyme-in-one-pot method can achieve real-time, rapid, flexible, sensitive, and easy-to-operate nucleic acid detection.

[0138] It should be understood that the dosages, reaction conditions, etc., in the various embodiments of this specification are approximate unless otherwise specified, and can be slightly modified according to actual circumstances to obtain similar results. Unless specifically defined, all technical and scientific terms used herein have the same meaning as understood by those skilled in the art. All documents mentioned herein are incorporated herein by reference. The preferred embodiments described in this specification are exemplary. Those skilled in the art can implement the invention using similar methods and materials to obtain the same or similar results. Various modifications or alterations to the invention still fall within the scope defined by the appended claims.

[0139] References 1. Paluzzi, VE, Zhang, C.&Mao, C. Near-Quantitative Preparation ofShort Single-Stranded DNA Circles. Angew Chem Int Ed Engl 62, e202218443(2023). 2. Yang, H.&Seela, F. Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with TerminalAlkynyl Groups Utilizing Bifunctional Azides. Chemistry 22, 1435-1444 (2016). 3. Ducani, C., Bernardinelli, G.&Högberg, B. Rolling circlereplication requires single-stranded DNA binding protein to avoid termination and production of double-stranded DNA. Nucleic Acids Res 42, 10596-10604 (2014). 4. Gadkar, V.J.&Filion, M. A novel method to perform genomic walksusing a combination of single strand DNA circularization and rolling circleamplification. J Microbiol Methods 87, 38-43 (2011). 5. Ma, C., Wang, Y., Zhang, P.&Shi, C. Accelerated isothermal nucleicacid amplification in betaine-free reaction. Anal Biochem 530, 1-4 (2017). 6. Ning, L. et al. A novel isothermal method using rolling circlereverse transcription for accurate amplification of small RNAsequences. Biochimie 163, 137-141 (2019). 7. Xu, L., Duan, J., Chen, J., Ding, S.&Cheng, W. Recent advances inrolling circle amplification-based biosensing strategies-A review. Anal Chim Acta 1148, 238187 (2021). 8. Gao, Z. et al. Nicking-enhanced rolling circle amplification forsensitive fluorescent detection of cancer-related microRNAs. Anal Bioanal Chem 410, 6819-6826 (2018). 9. Yang, N., Zhang, H., Han, X., Liu, Z.&Lu, Y. Advancements andapplications of loop-mediated isothermal amplification technology: acomprehensive overview. Front Microbiol 15, 1406632 (2024). 10. Huang, W. et al. Room Temperature Isothermal Colorimetric PadlockProbe Rolling Circle Amplification for Viral DNA and RNA Detection. bioRxiv (2020). 11. Zhu, Z. et al. An ultra-sensitive one-pot RNA-templated DNAligation rolling circle amplification-assisted CRISPR / Cas12a detector assayfor rapid detection of SARS-CoV-2. Biosens Bioelectron 228, 115179 (2023). 12. Wei, X.R., Meng, Y., Xu, Q., Hu, J.&Zhang, C.Y. Label-free andhomogeneous detection of flap endonuclease 1 by ligation-promotedhyperbranched rolling circle amplification platform. Talanta 243, 123342(2022).

Claims

1. A method for detecting target nucleic acids in a sample, characterized in that, The method includes the following steps: a) An amplification reaction is performed in the same reaction vessel as a sample containing the target nucleic acid, wherein the reaction component comprises i) a single-stranded DNA padlock probe comprising a first linker region at the 5' end, a second linker region at the 3' end, and an internal reporter region, wherein the first and second linker regions each comprise a polynucleotide sequence complementary to the target nucleic acid sequence; ii) a ligase or a variant thereof; iii) a DNA polymerase or a variant thereof with strand displacement activity; and iv) a reaction buffer; b) Detect the amplification reaction products of step a); Optionally, the circularized single-stranded DNA padlock probe is composed entirely of deoxyribonucleotides, or substantially of deoxyribonucleotides and contains no more than four consecutive ribonucleotides.

2. The method of claim 1, wherein the first base of the first linker region comprises a phosphorylation modification, the phosphorylation modification being added exogenously or generated in situ; Preferably, when the phosphorylation modification is generated in situ, then (1) the reaction component further includes a polynucleotide kinase; or (2) the single-stranded DNA padlock probe further includes a valve region at the 5' end and the reaction component further includes a structure-specific nuclease, wherein the valve region is not complementary to the target nucleic acid sequence and can be cleaved by the structure-specific nuclease.

3. The method according to claim 1, wherein the length of the polynucleotide sequence complementary to the target nucleic acid sequence is 15-200 bases, 15-100 bases, or 15-40 bases.

4. The method of claim 1, wherein the reporting region includes a specific nucleic acid binding region for visualizing the amplification product.

5. The method according to claim 1, wherein the ligase is selected from T4 DNA ligase, T4 RNA ligase 1, T4 RNA ligase 2, PBCV-1 DNA ligase, 9°N™ DNA ligase, Circ Ligase ssDNA / RNA cyclase, and other ligases that use ATP or NAD+ as substrates for DNA / DNA and / or DNA / RNA ligation reactions.

6. The method of claim 1, wherein the DNA polymerase having strand substitution activity is selected from Phi29 DNA polymerase, Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, SD DNA polymerase, and other natural and / or artificially modified DNA polymerases having strand substitution activity that use deoxyribonucleotides as substrates and depend on DNA templates.

7. The method according to claim 1, wherein the reaction buffer comprises 0.1-2 mM dNTP, 1-100 mM Tris-HCl, 1-300 mM HEPES, 5-25 mM MgCl2, 0-20 mM ATP, 0.5-10 mM DTT, 0-10% glycerol, and 0-3 U / μL PPI, and the pH of the reaction buffer is 8.0 to 9.0; Preferably, the reaction buffer contains 0.2 mM dNTP, 10 mM Tris-HCl, 100 mM HEPES, 10 mM MgCl2, 10 mM DTT, 5% glycerol, and 1 U / μL PPI, and the pH of the reaction buffer is 8.

5.

8. The method according to claim 1, wherein the amplification reaction is selected from rolling circle amplification (RCA), chain substitution amplification (CSA), cross primer amplification (CPA), chain substitution amplification (SDA), adjacent extension analysis (PEA) and variations thereof; preferably rolling circle amplification.

9. The method according to claim 1, wherein the reaction temperature in step a) is a constant temperature of 8°C to 65°C; preferably, the reaction temperature in step a) is 30°C to 37°C.

10. The method according to claim 1, wherein the reaction time of step a) is 5 minutes to 4 hours; preferably, the reaction time of step a) is 10 minutes to 60 minutes.

11. The method of claim 1, wherein the reporting region is covalently or non-covalently bound to a fluorescently detectable tag, the tag comprising a nucleic acid dye, a fluorescently labeled nucleotide or oligonucleotide, or an antibody.

12. The method according to claim 1, wherein the target nucleic acid is selected from one or more of single-stranded DNA, double-stranded DNA, and single-stranded RNA.

13. The method according to claim 1, wherein the nucleic acid sequence of the target nucleic acid is derived from a virus, bacteria, fungus, animal, plant, or synthetic construct; and the sample is derived from water, soil, blood, whole blood, leukocytes, peripheral blood, monocytes, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, nipple aspiration fluid, tracheal aspiration fluid, nasal aspirate, synovial fluid, joint aspiration fluid, cells, cell extracts, feces, tissue, tissue extracts, tissue biopsy, or cerebrospinal fluid.

14. The method according to any one of claims 1-13, wherein the concentration of the target nucleic acid is as low as the pM level.

15. The method according to any one of claims 1-13, wherein the single-stranded DNA padlock probe and the target nucleic acid do not require an annealing incubation step.

16. A kit for detecting target nucleic acids in a sample in the same reaction vessel, characterized in that, The kit contains a single-stranded DNA padlock probe comprising a first linker region at the 5' end, a second linker region at the 3' end, and an internal reporter region. The first and second linker regions each contain a polynucleotide sequence complementary to the target nucleic acid sequence; a ligase or a variant thereof; a DNA polymerase or a variant thereof with strand displacement activity; and a reaction buffer.

17. The kit according to claim 16, further comprising a polynucleotide kinase.

18. The kit of claim 16, wherein the 5' of the single-stranded DNA padlock probe further comprises a valve region and the kit further comprises a structure-specific nuclease, the valve region being non-complementary to the target nucleic acid sequence and cleavable by the structure-specific nuclease.

Images